ID: 1033331463

View in Genome Browser
Species Human (GRCh38)
Location 7:140420414-140420436
Sequence TTTTTTTTTTTTTTTTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428741
Summary {0: 702, 1: 87403, 2: 67138, 3: 121105, 4: 152393}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033331463_1033331466 6 Left 1033331463 7:140420414-140420436 CCATATCAAAAAAAAAAAAAAAA 0: 702
1: 87403
2: 67138
3: 121105
4: 152393
Right 1033331466 7:140420443-140420465 GAAGAAGAAGGAGCAGAAGGAGG No data
1033331463_1033331465 3 Left 1033331463 7:140420414-140420436 CCATATCAAAAAAAAAAAAAAAA 0: 702
1: 87403
2: 67138
3: 121105
4: 152393
Right 1033331465 7:140420440-140420462 GAAGAAGAAGAAGGAGCAGAAGG No data
1033331463_1033331467 10 Left 1033331463 7:140420414-140420436 CCATATCAAAAAAAAAAAAAAAA 0: 702
1: 87403
2: 67138
3: 121105
4: 152393
Right 1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG No data
1033331463_1033331464 -6 Left 1033331463 7:140420414-140420436 CCATATCAAAAAAAAAAAAAAAA 0: 702
1: 87403
2: 67138
3: 121105
4: 152393
Right 1033331464 7:140420431-140420453 AAAAAAAAAGAAGAAGAAGAAGG 0: 173
1: 467
2: 1601
3: 9513
4: 55138
1033331463_1033331468 11 Left 1033331463 7:140420414-140420436 CCATATCAAAAAAAAAAAAAAAA 0: 702
1: 87403
2: 67138
3: 121105
4: 152393
Right 1033331468 7:140420448-140420470 AGAAGGAGCAGAAGGAGGCAGGG 0: 1
1: 0
2: 18
3: 278
4: 2212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033331463 Original CRISPR TTTTTTTTTTTTTTTTGATA TGG (reversed) Intronic
Too many off-targets to display for this crispr