ID: 1033331467

View in Genome Browser
Species Human (GRCh38)
Location 7:140420447-140420469
Sequence AAGAAGGAGCAGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033331463_1033331467 10 Left 1033331463 7:140420414-140420436 CCATATCAAAAAAAAAAAAAAAA 0: 702
1: 87403
2: 67138
3: 121105
4: 152393
Right 1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033331467 Original CRISPR AAGAAGGAGCAGAAGGAGGC AGG Intronic
No off target data available for this crispr