ID: 1033338402

View in Genome Browser
Species Human (GRCh38)
Location 7:140472686-140472708
Sequence TTGTAACAATGCAAAAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 428}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033338402_1033338405 4 Left 1033338402 7:140472686-140472708 CCCTTGTTTTTGCATTGTTACAA 0: 1
1: 0
2: 2
3: 25
4: 428
Right 1033338405 7:140472713-140472735 CTATTTTGACATTCCAGCCTGGG 0: 1
1: 0
2: 2
3: 11
4: 182
1033338402_1033338406 10 Left 1033338402 7:140472686-140472708 CCCTTGTTTTTGCATTGTTACAA 0: 1
1: 0
2: 2
3: 25
4: 428
Right 1033338406 7:140472719-140472741 TGACATTCCAGCCTGGGTGATGG 0: 1
1: 2
2: 82
3: 711
4: 3570
1033338402_1033338404 3 Left 1033338402 7:140472686-140472708 CCCTTGTTTTTGCATTGTTACAA 0: 1
1: 0
2: 2
3: 25
4: 428
Right 1033338404 7:140472712-140472734 ACTATTTTGACATTCCAGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033338402 Original CRISPR TTGTAACAATGCAAAAACAA GGG (reversed) Intronic
901294382 1:8149133-8149155 TTGTTACAAGGCAAAAACCAAGG - Intergenic
901658087 1:10782046-10782068 TTGTAATTCTGCCAAAACAAGGG + Intronic
902854990 1:19195573-19195595 ATTTAAAAATGCAAAATCAACGG + Intronic
902961509 1:19966511-19966533 TTGTATAAATGAAAAAACAGAGG - Intergenic
903024877 1:20420521-20420543 TTTTAAAAATGAAAATACAATGG + Intergenic
904506575 1:30960972-30960994 TTTTAAAAATGAAAAAAAAAAGG + Intronic
907940616 1:59083865-59083887 TTTTAACAATGAATAAAAAAAGG + Intergenic
908913098 1:69095764-69095786 TAGAAACAAAGTAAAAACAAAGG - Intergenic
909077853 1:71074453-71074475 TTGTGACAATGGAAAAAAAGCGG + Intronic
909141961 1:71878416-71878438 TGTTAACAATGCAAAAATATTGG - Intronic
909311277 1:74153093-74153115 TTGTAAAAAAGGAAAAAGAATGG - Intronic
909945743 1:81661244-81661266 TTGTAACAATGAGAAAATGAAGG + Intronic
910000105 1:82331151-82331173 TTGTGAGTATGCAAAAAAAAAGG + Intergenic
910479409 1:87642031-87642053 TTGTAAAAATGCAAAATGACAGG + Intergenic
911067716 1:93806414-93806436 GTGAAACTATGCAAGAACAAAGG + Intronic
911867040 1:103041529-103041551 TTGCAACAGAGCAAAAATAAGGG - Intronic
912020495 1:105103399-105103421 TTGTAACAGTGAAAAAATTATGG + Intergenic
912211838 1:107564894-107564916 TTCTAACTATGCAGAAACAGAGG + Intergenic
912496588 1:110095628-110095650 TAGCAACTATGCAAAACCAAAGG - Intergenic
912524328 1:110269822-110269844 TTGTAAAAATGCAAAATAACTGG - Intronic
915772207 1:158438486-158438508 TGGAAAGAATGCAAAAAAAAGGG - Intergenic
916117670 1:161501446-161501468 TAGTAACAAGCCAAAAACCAGGG + Intergenic
916196380 1:162227376-162227398 ATATAACAATTAAAAAACAAGGG + Intronic
916773801 1:167938209-167938231 TTGTAAGAATGCAAACAAAAAGG - Intronic
916955725 1:169832577-169832599 TTTTAAAAATGGAAAAAAAAAGG - Intronic
917030098 1:170680943-170680965 ATGTATCAATGAAACAACAAAGG + Intronic
917847125 1:179029102-179029124 TTCTATTAATGCAAAAACACTGG - Intronic
917948114 1:179997775-179997797 TAATAACAATCCAAATACAATGG - Intronic
918574691 1:186043421-186043443 AGGAAAAAATGCAAAAACAATGG - Intronic
920316626 1:205080419-205080441 GTTCAACAAGGCAAAAACAATGG + Intergenic
920823665 1:209404249-209404271 TTGTAAGAATGCTATAAAAAGGG - Intergenic
921496307 1:215846141-215846163 TTTTAACATTTCCAAAACAAAGG - Intronic
922436520 1:225612829-225612851 TTACAATAATGCAAAAAAAAGGG + Intronic
1063156961 10:3388812-3388834 TTGAATCAATGCATAAATAAAGG + Intergenic
1063784764 10:9368470-9368492 CTGAAACAATACAAAAAAAATGG + Intergenic
1063875204 10:10468997-10469019 TTATTACAGTGCAAAAAAAATGG + Intergenic
1064239191 10:13609814-13609836 TTAAAACAATGCACAAACAATGG - Intronic
1064607042 10:17053064-17053086 ATGTAAAAATACAAAAAAAAAGG + Intronic
1064749413 10:18511282-18511304 TTGTAATAGTGTACAAACAATGG + Intronic
1064817233 10:19279651-19279673 TTGTAGCAGTGGAAGAACAAAGG + Intronic
1065125617 10:22570745-22570767 TATAAATAATGCAAAAACAATGG + Intronic
1065633744 10:27709535-27709557 TGGTAACAATAGCAAAACAAGGG + Intronic
1067961711 10:50860536-50860558 TTTTAACAAAACAAGAACAATGG + Intronic
1068064356 10:52109977-52109999 TTGTAACAGTGCAAAGATCAGGG + Intronic
1068138342 10:52973297-52973319 TAATAAAAATTCAAAAACAATGG + Intergenic
1068378815 10:56220468-56220490 TTGTAAAAATGCCTAAACATTGG - Intergenic
1069248282 10:66236130-66236152 AAGTAAGAATGGAAAAACAAAGG + Intronic
1072728865 10:97831410-97831432 CTGAAACAATGCAGGAACAAGGG - Intergenic
1073411012 10:103341846-103341868 GTGTAAAAATTCAAACACAATGG + Intronic
1073545168 10:104341834-104341856 CTGTAACATGGTAAAAACAAAGG + Intergenic
1074036466 10:109744235-109744257 TTGTAACAATGCTGAATCACTGG + Intergenic
1074911877 10:117918259-117918281 TTTTAACAAAACAAATACAATGG + Intergenic
1075010856 10:118869095-118869117 TTCTACAAATGCAAAAACAAAGG + Intergenic
1076283152 10:129267550-129267572 TTTTCACAATACAAAAAGAAGGG + Intergenic
1078192763 11:9105531-9105553 TTGGAACAATTAAAAAACATTGG - Intronic
1078670072 11:13356819-13356841 GTGTAACAGTGCAAAGAAAATGG - Intronic
1078905857 11:15687133-15687155 TTTTAAAAATGAAAAGACAAAGG - Intergenic
1078973682 11:16446189-16446211 ATGTAAGAATGCAAAATGAAGGG + Intronic
1079686537 11:23365783-23365805 TTGTAACAAAAAAAAAAAAAAGG - Intergenic
1079778864 11:24572532-24572554 ATGTGACAATGCACAAACCATGG + Intronic
1080003864 11:27383309-27383331 TTGTAACAGAGAAGAAACAATGG + Intronic
1080042305 11:27771636-27771658 TTCTGACAATGCAAAGGCAAAGG + Intergenic
1080340921 11:31262935-31262957 TTATAAGGATGCAAAAACAGAGG + Exonic
1080796904 11:35573128-35573150 TTTTAACAAGGAAAAAAGAATGG - Intergenic
1081314725 11:41617889-41617911 TTTTAACAATAAAAAAAAAAAGG - Intergenic
1082052731 11:47785650-47785672 TTTTAGAAATGCAGAAACAAAGG - Intronic
1084365426 11:68694415-68694437 TTATTTCAATGCAAAAAAAAAGG + Intergenic
1084367760 11:68714115-68714137 TTGTAAAAATTCAAATACAGAGG + Intronic
1084400855 11:68942115-68942137 TTTTAACAATGCATCACCAAGGG - Intergenic
1085318165 11:75558452-75558474 TTATACCAATGTAAAAAGAAGGG + Intergenic
1085390171 11:76178220-76178242 TTTTAAAGATGAAAAAACAAAGG + Intergenic
1085595885 11:77809360-77809382 TTACAAAAATGCAAAAATAAGGG - Intronic
1085605664 11:77895982-77896004 TTGTAAGTAGGCAAAGACAATGG + Intronic
1086428705 11:86714532-86714554 TTGTAAGAAAGCAGAAACACAGG + Intergenic
1086625667 11:88948672-88948694 TTCTAACAATGAAAATAAAAAGG - Intronic
1087461029 11:98447560-98447582 TTGTAAAAAATTAAAAACAAAGG - Intergenic
1088042416 11:105403449-105403471 TTAACACAATGGAAAAACAATGG + Intergenic
1088195736 11:107271758-107271780 TTCTAACAATGAAAATGCAATGG - Intergenic
1088319123 11:108536563-108536585 TTGTAAAAATCCAAAAAGAAAGG - Intronic
1088772396 11:113048274-113048296 TTAAAACAATGTTAAAACAATGG + Intronic
1093001147 12:13997798-13997820 CAGTAACAAAGCAAAATCAATGG + Intergenic
1093073984 12:14738107-14738129 TTGCAATTTTGCAAAAACAAAGG + Intergenic
1093504861 12:19853469-19853491 TTTTAGCAATGCAATAAAAAAGG + Intergenic
1093966001 12:25326366-25326388 TTGTAACCATGTAAAGATAAAGG + Intergenic
1094155865 12:27336284-27336306 TAGTAACCTTGCAAAAACCAGGG - Intronic
1095438356 12:42216434-42216456 GTGTAACAATACAGAAACAGAGG - Intronic
1096939601 12:55327752-55327774 TTGTAACAATGTATAAGGAATGG + Intergenic
1096944543 12:55390012-55390034 TATTTACAATGCAAAAACCAAGG - Intergenic
1097317819 12:58191044-58191066 TTAAAAAAATGCAAAAACAAAGG - Intergenic
1098302943 12:69072578-69072600 TCGTAACATTTCAAAAACAGGGG + Intergenic
1098353885 12:69591450-69591472 TGGTAAAAATGGAAAAACCATGG - Intronic
1098569515 12:71973048-71973070 TTTTAACAAAGCAAATAAAAAGG - Intronic
1098699201 12:73602097-73602119 ATGTATCACTGCAAAGACAAGGG - Intergenic
1098864992 12:75752169-75752191 TTGTAAGAAGGAAAGAACAAAGG - Intergenic
1099121438 12:78694562-78694584 TAATAAAAATTCAAAAACAATGG - Intergenic
1099216506 12:79860297-79860319 TTGCAATAATACAAAAATAAGGG + Intronic
1099318028 12:81108725-81108747 TAGTAACAATGCAAAATAACAGG - Intronic
1099587381 12:84535715-84535737 TAAAAACAATACAAAAACAAAGG - Intergenic
1099661401 12:85568133-85568155 TAGAAATAATCCAAAAACAATGG + Intergenic
1099704432 12:86133083-86133105 ATGAAACAAAGCAATAACAAAGG - Intronic
1100044563 12:90363603-90363625 TCCTAACAATGCCAAAATAAAGG + Intergenic
1101094693 12:101325433-101325455 TACTGACAAGGCAAAAACAATGG + Intronic
1102563315 12:113778246-113778268 TTTTAAAAATGCAAAAAATATGG + Intergenic
1102593834 12:113977396-113977418 TTGTGAAAATGAAAAAAGAAGGG + Intergenic
1104469159 12:129015175-129015197 TTTTAACAGTGGAAAACCAAAGG - Intergenic
1104615485 12:130264745-130264767 CTGTAACAACGAAAAAGCAACGG - Intergenic
1105391628 13:19984952-19984974 TTTTAAGTATGCCAAAACAAAGG + Intronic
1105429204 13:20321815-20321837 TCGTAACATTGCCAGAACAAGGG + Intergenic
1106218943 13:27728761-27728783 ATGTCATAATGCAAACACAAAGG + Intergenic
1106860905 13:33907237-33907259 TTTTCACAATCCAAAAGCAAGGG - Intronic
1106957564 13:34957747-34957769 TCTTAAAAATACAAAAACAAAGG - Intronic
1107061255 13:36162059-36162081 TTATAATAATGAAAAACCAATGG - Intergenic
1107140744 13:36996253-36996275 TAGAAACAATGTAAAAACAATGG - Intronic
1108079210 13:46716536-46716558 TAGCCACAATGCAAACACAATGG + Intronic
1109204829 13:59469782-59469804 TTGTCGAAATTCAAAAACAAAGG + Intergenic
1109676003 13:65676292-65676314 TTGGAAGAATACAAGAACAAGGG - Intergenic
1110179725 13:72601391-72601413 TTGTCACTATGATAAAACAATGG + Intergenic
1110272658 13:73608247-73608269 TTGTACAAATAGAAAAACAAAGG + Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110850038 13:80234526-80234548 TTGTGACAATGAAAAAATTAGGG - Intergenic
1110913582 13:80993948-80993970 TTATAACAATGCAACAGGAAGGG - Intergenic
1111239425 13:85455721-85455743 TTAAAACCATGCAAAAACTAAGG + Intergenic
1111472421 13:88700261-88700283 TTGAAACAATAGAAATACAAAGG - Intergenic
1115257511 14:31418880-31418902 TTGAAACAAAGCAAGAAGAAAGG + Intronic
1115375548 14:32671502-32671524 TTTTACCGATGGAAAAACAACGG + Intronic
1115806876 14:37061753-37061775 TTATAATAATGCAATAACATGGG - Intronic
1115850588 14:37587274-37587296 TTTTTAAAATGCCAAAACAAGGG + Intergenic
1115896263 14:38091249-38091271 TTGTAACAGCGCAAGAATAAAGG + Intergenic
1116219062 14:42058553-42058575 TAGTAATATTGCAAACACAAGGG - Intergenic
1116846211 14:49867283-49867305 TTTTAACAGTGCAAAAAACAAGG + Intergenic
1116993232 14:51297330-51297352 ATTTAAAAATGCAAAAAAAAAGG + Intergenic
1117637700 14:57762914-57762936 TTGTAGCAATGCAAAAGAATTGG + Intronic
1117947911 14:61049854-61049876 TTGTGAGAATGCAAGAACACTGG + Intronic
1118078999 14:62336643-62336665 TTGTAACAATTCACAGACTATGG - Intergenic
1118795049 14:69135204-69135226 TACTGACAATGCAAAAGCAATGG + Intronic
1118801058 14:69190366-69190388 TTGAAACACTTAAAAAACAAAGG - Intergenic
1119011333 14:70992709-70992731 TTATAACACTGCAAAAGAAAAGG - Intronic
1120049940 14:79853690-79853712 TTTTAACAATGCTAAAGAAAGGG - Intronic
1121814025 14:96915379-96915401 TTATAGCAATGCAAGAACATAGG + Intronic
1125564136 15:40662261-40662283 TTGTAATGACGTAAAAACAAAGG - Exonic
1126277202 15:46897636-46897658 TTGTATCAGAGTAAAAACAAAGG + Intergenic
1130542259 15:84828728-84828750 TTGTAAGAATGCAATGACAATGG - Intronic
1130754362 15:86746806-86746828 ATGTAACTATGCAACAACATAGG + Intronic
1130905560 15:88238353-88238375 TTATAATAAAGAAAAAACAAAGG + Intronic
1131128185 15:89874251-89874273 TTGTAACAAATGAAAAACAAAGG - Intronic
1131581857 15:93651106-93651128 TTGAAATAATGCCAAAACAAAGG - Intergenic
1131704860 15:94982689-94982711 TTTTAAAAATACATAAACAAGGG - Intergenic
1131886624 15:96922642-96922664 TTGTACCTATTCAAACACAATGG - Intergenic
1135900490 16:26455014-26455036 TTGTAACAATGAGGAAGCAAAGG - Intergenic
1136068369 16:27773740-27773762 TTGTCACTATGCATAATCAAGGG - Intronic
1136665217 16:31805267-31805289 TTGAAATAATGCAATCACAAAGG - Intergenic
1137485393 16:48886219-48886241 TTTTAACAATGTAAGAAAAAGGG - Intergenic
1137759882 16:50931982-50932004 TTGTACAGATGCAGAAACAAAGG - Intergenic
1137951715 16:52790146-52790168 ATGTTAAAATGCAAAAAAAAAGG - Intergenic
1138032197 16:53568518-53568540 TTGAACCTATGCAAAAAAAATGG - Intergenic
1139130429 16:64136039-64136061 TTCTAAGGATGCATAAACAATGG - Intergenic
1139265146 16:65631449-65631471 TTGTTACAATGCAAGATCAATGG - Intergenic
1139735031 16:68980144-68980166 TTTTAAAAATCAAAAAACAAGGG - Intronic
1139818267 16:69695325-69695347 TTGTTTCATTGCAAAACCAAGGG + Exonic
1140750697 16:78020976-78020998 TTGTCTCAAAGAAAAAACAAAGG + Intergenic
1142066879 16:88067824-88067846 GTGTAACCATGCAGGAACAATGG - Intronic
1143224946 17:5293365-5293387 CTGTAACAAATAAAAAACAAAGG - Intronic
1146798822 17:35802176-35802198 TTTTAAAAAGGAAAAAACAATGG - Intronic
1147346566 17:39800799-39800821 CTGAGACACTGCAAAAACAATGG + Intronic
1148040474 17:44702631-44702653 TAGTAAAAATGCAAAGAAAAGGG - Intergenic
1148517651 17:48236076-48236098 TTGTAACATTTCAAAGTCAAGGG + Intronic
1148915439 17:50973236-50973258 TAGTAAAAATACAAAAACAGGGG + Intronic
1151170883 17:72245323-72245345 TTGTAAAAATGCAAAAGCCCAGG + Intergenic
1152137343 17:78512265-78512287 ATGAAAGAATGCAAGAACAACGG - Intronic
1153864989 18:9258475-9258497 TAGAAACAAAGCAAATACAATGG + Exonic
1155723033 18:29043047-29043069 TTGAAAAAATGCAAACAAAAAGG + Intergenic
1156201665 18:34839706-34839728 TTGTAACTATGGAAAATCCATGG - Intronic
1156882046 18:42092474-42092496 TAGTCACAATGTAAACACAAGGG - Intergenic
1156913421 18:42437934-42437956 TTGCAATATTGCCAAAACAAAGG + Intergenic
1157733189 18:50022508-50022530 TAGTAAGAAGGCAAAGACAAGGG + Intronic
1158205670 18:54990147-54990169 TTGCAACAAGACAAAAAGAATGG + Intergenic
1158542107 18:58366546-58366568 GTGTTAGAATTCAAAAACAAAGG + Intronic
1159125173 18:64215760-64215782 TTGATAAAATGCAAAAAGAAAGG + Intergenic
1159705065 18:71675922-71675944 TTGACAGAAAGCAAAAACAATGG - Intergenic
1159763925 18:72462303-72462325 TTGTCACAAAGTAAAAAAAAAGG + Intergenic
1160461730 18:79043763-79043785 TTGTCACAATGTCTAAACAAGGG + Intergenic
1162133271 19:8540359-8540381 TTGTGACAAAGAAAAAATAAAGG - Intronic
1162942861 19:14024110-14024132 TTAAAACACAGCAAAAACAAGGG - Intergenic
1164135492 19:22411335-22411357 TACTTACAATGCAAAAGCAAGGG - Intronic
1164220554 19:23189165-23189187 TACTAAAAATGCAAAAAAAATGG + Intergenic
1164640990 19:29825566-29825588 TAGTAAAAATGCAAAAATTAAGG + Intergenic
1166530788 19:43542266-43542288 TCTTAAAGATGCAAAAACAAAGG + Intergenic
925109884 2:1324585-1324607 TAATAAAAATTCAAAAACAATGG + Intronic
925260105 2:2521505-2521527 TTATTAAAATGCAAAAATAATGG - Intergenic
925535676 2:4913460-4913482 TTATACAAATGGAAAAACAAAGG - Intergenic
925685334 2:6465915-6465937 TTATAATGATGGAAAAACAAAGG + Intergenic
926392931 2:12412563-12412585 CTGTAAAAATGCAAATTCAAAGG + Intergenic
926455121 2:13057639-13057661 TTGTATAAATGAAAAAACACAGG - Intergenic
926608675 2:14923465-14923487 TTGTCACAAAGCAAACACTAGGG - Intergenic
927096025 2:19748137-19748159 TTGGCACATTGCAAAAACAGTGG - Intergenic
928095520 2:28402487-28402509 TTGTGACAAGGCAAAGACAATGG + Intronic
928332563 2:30368818-30368840 TTTTAACAATGAAGAAACCAGGG - Intergenic
929010043 2:37432656-37432678 TTAAAACCATGCAAATACAATGG - Intergenic
929347055 2:40897146-40897168 TTGTAACAATGAGGAAACTAAGG + Intergenic
929813271 2:45209916-45209938 TTGTAACATTGCAAGAGCAAAGG - Intergenic
930290469 2:49486806-49486828 GTGTAATAATGCAAAAAGTAGGG - Intergenic
930309729 2:49724985-49725007 TTGTAAGAAAGAAAAAAGAAAGG - Intergenic
930554233 2:52875107-52875129 TTGAAATAATGAAAAGACAAGGG - Intergenic
930704159 2:54487655-54487677 TTGTAACACTAGAAAAGCAATGG - Intronic
931270624 2:60699241-60699263 TTGGAACAACCCAAACACAATGG + Intergenic
931910143 2:66890067-66890089 ATGTAGCAATGCTAAAAGAAAGG - Intergenic
931965616 2:67530236-67530258 TTGCACTGATGCAAAAACAATGG + Intergenic
932392298 2:71405781-71405803 TGGTAACAATAAAAAAATAAAGG + Intronic
932463835 2:71900569-71900591 TTGTAACAAATGACAAACAAAGG - Intergenic
932962689 2:76432639-76432661 TTGTGACTATATAAAAACAATGG - Intergenic
933446770 2:82390496-82390518 AAGAAACAATGCAAACACAAAGG + Intergenic
933473105 2:82752672-82752694 TTTTAGCAATGAAAAACCAATGG + Intergenic
933742230 2:85543337-85543359 TTGTTGCAATGTAAAAACCATGG + Intronic
934053772 2:88234095-88234117 TTGTTTCAATTAAAAAACAATGG + Intergenic
934980193 2:98833240-98833262 TTGTATTAATGAAAAAACCAAGG + Intronic
936490618 2:112968917-112968939 TTGAAACAATGCAAAAAGTTGGG + Intergenic
937476782 2:122222254-122222276 TCCTAACAAAGCAACAACAATGG - Intergenic
938877108 2:135543690-135543712 TTGCAAAAATGTTAAAACAATGG - Intronic
939303023 2:140371587-140371609 ATGTAACACTTCAAAATCAAAGG - Intronic
939534924 2:143416250-143416272 TTTTAAAAAAACAAAAACAAAGG + Intronic
940419770 2:153466526-153466548 TTGTAATAATCCAAAAACAGAGG + Intergenic
940995223 2:160142443-160142465 TTGTAACGTTGCAGAAACCAAGG + Intronic
941208309 2:162602748-162602770 TTGTATCAATGAATAAACAGAGG + Intronic
941432996 2:165434487-165434509 TAGTAAGAACCCAAAAACAAAGG + Intergenic
941488984 2:166119680-166119702 TTGTAACAATGGAAAAGCTTTGG - Intronic
942932592 2:181513584-181513606 TGTTAATAATGCAAAATCAAAGG - Intronic
944140922 2:196455736-196455758 TTTTAACACTGGAAATACAAAGG + Intronic
944997711 2:205312808-205312830 TAGTAATAATGGAAAAAAAAGGG - Intronic
945135151 2:206619114-206619136 TTTTAACAATGCGGATACAAAGG - Exonic
945427033 2:209719052-209719074 TTTTCATAATGCAAGAACAAAGG + Intronic
945699908 2:213156465-213156487 TTCCATTAATGCAAAAACAAGGG + Intergenic
946625964 2:221612587-221612609 TTGTAAATATGCACAAATAAAGG - Intergenic
946964121 2:225019084-225019106 TTGTAACAATTCAAAAATAAAGG - Intronic
947033232 2:225821895-225821917 TTGTGCAAATGGAAAAACAAAGG - Intergenic
947082627 2:226415703-226415725 TTGTAAAAATAAAAAAAAAATGG + Intergenic
1173825387 20:46044796-46044818 TTTTATCAAGGAAAAAACAATGG + Intronic
1173937201 20:46877295-46877317 TTTTATCAATACAAAAATAAAGG + Intergenic
1174617605 20:51848020-51848042 TTGTAAAAATTAAAAAAAAAGGG - Intergenic
1174757766 20:53176472-53176494 TTGTTAGAATGAAAAACCAAGGG + Intronic
1174900027 20:54489765-54489787 TTGTAACAGAGGAAAAAAAATGG - Intronic
1177237998 21:18418848-18418870 GTAGATCAATGCAAAAACAACGG + Intronic
1177306804 21:19328822-19328844 GTTTAAAAATGCAAAAAAAAAGG - Intergenic
1177426535 21:20930415-20930437 TTGAAAAAATGCAACTACAAAGG - Intergenic
1177658155 21:24046854-24046876 TTGGTACAATGATAAAACAAAGG - Intergenic
1180010297 21:45045189-45045211 TTGTAAAAATACAACACCAAAGG + Intergenic
1182321099 22:29479115-29479137 TTGTACAGATGGAAAAACAAGGG + Intergenic
1182649115 22:31836387-31836409 TTTTAACAATCCAAAAATGAAGG - Intronic
1182730082 22:32481881-32481903 GTGTAAAAATGAAAAAAAAAAGG - Intronic
951038191 3:17957276-17957298 TTGTAACAAATCACAGACAAAGG - Intronic
952375176 3:32761167-32761189 TTGTCACAATTCAAATATAAGGG + Intronic
952672439 3:35986502-35986524 TTGTATAGATGAAAAAACAAAGG - Intergenic
954309070 3:49750529-49750551 TTCTAAAAATACAAAAAAAAAGG + Intronic
954559044 3:51540025-51540047 GAGTCACAATTCAAAAACAACGG - Intergenic
955601932 3:60654846-60654868 ATTTGACAATGCAAAAATAATGG + Intronic
955640832 3:61082051-61082073 TTGGAGCAATGCAAAAATGAGGG - Intronic
955667720 3:61368142-61368164 TTGTAAATATCCAAACACAAAGG - Intergenic
956146532 3:66196245-66196267 TTTTGAAAAGGCAAAAACAAGGG + Intronic
957151475 3:76491605-76491627 ATGTAATAATGCCTAAACAAGGG - Intronic
957489439 3:80905364-80905386 TTTTCACAATGCACAAACCAGGG + Intergenic
957501375 3:81062077-81062099 TTCCAACAATTAAAAAACAATGG + Intergenic
957826976 3:85459901-85459923 ATGAAACAATGCAGTAACAAAGG - Intronic
959187182 3:103059152-103059174 TTGTAACAATTAAAAAGGAAAGG - Intergenic
959461587 3:106632233-106632255 TTGTAAGGATGCACAAACTAAGG - Intergenic
959619790 3:108387461-108387483 TTATTACAATGAAGAAACAAAGG + Intronic
959873584 3:111356312-111356334 TTCTATCAATGAAACAACAAAGG + Intronic
959997753 3:112697321-112697343 TTGTTACAATGTAAAAACCATGG - Intergenic
960086627 3:113597956-113597978 TTTTAAGAATGCAAAAACCAAGG - Intronic
960551905 3:118985377-118985399 CTGTCACAATGCAAAGACAAGGG + Intronic
962102133 3:132353758-132353780 TTGTAATAATGTTTAAACAATGG + Intronic
962986086 3:140537375-140537397 TTCTAGCAATGAAAAAAAAATGG + Intronic
964242521 3:154613495-154613517 TTCTCACAATACAAAAAGAAAGG - Intergenic
964568727 3:158089027-158089049 TTGTATCAGTGACAAAACAATGG - Intergenic
965046042 3:163578238-163578260 TAATAACAATGCAAAGAAAATGG - Intergenic
965058848 3:163756347-163756369 TTGTCAAAATTCAAAGACAAAGG + Intergenic
965272515 3:166637192-166637214 TTCTAACAATGCAGACTCAATGG - Intergenic
966366062 3:179188423-179188445 TTGTACTACTGGAAAAACAAAGG + Intronic
966832572 3:184022541-184022563 ACGTAACAATGAAATAACAAGGG - Intergenic
967646258 3:191927989-191928011 TATTAAAAATCCAAAAACAACGG + Intergenic
968792052 4:2672019-2672041 TAGTTACAAAGCAAATACAAAGG - Intronic
969842961 4:9896935-9896957 TTGTAACAATGTTCAAACATGGG - Intronic
969857122 4:10009051-10009073 TTGTGTCACTGCAGAAACAACGG - Intronic
970675817 4:18449365-18449387 TTTTAAAAAAGCAAAAACATAGG + Intergenic
971615671 4:28788147-28788169 TTGTAACAGTGAGAAAACTATGG + Intergenic
972233143 4:37098647-37098669 GAGAAACAATGCAAAAAAAATGG + Intergenic
972850309 4:43041006-43041028 TTCTAATAAGGCAAAAGCAATGG + Intergenic
973771183 4:54208532-54208554 TTCTAACATTTCAATAACAATGG - Intronic
973911003 4:55580146-55580168 TTTTAACAATAAAAAAACAGTGG - Intronic
974078745 4:57191838-57191860 TTGTCAAAATGCAACATCAAAGG + Intergenic
974524634 4:63033051-63033073 TAGGAACAATGCAATCACAAAGG + Intergenic
974536012 4:63176654-63176676 TTGTACCAATGCAAAAAAACTGG - Intergenic
975657720 4:76658317-76658339 TTCTAAAAATGGAAAATCAAAGG + Intronic
975771454 4:77727719-77727741 TTTTAACAAATCAAATACAATGG + Intronic
976184858 4:82432984-82433006 CTGTCACAATCCAAAAAAAAAGG - Intronic
976391326 4:84507345-84507367 TTTTAAGAATGAAAAAACTAGGG + Intergenic
976875191 4:89845810-89845832 ATGTAGCTATGCCAAAACAAAGG - Intergenic
976896720 4:90120970-90120992 TGTTAACAATTTAAAAACAATGG - Intergenic
977061443 4:92262290-92262312 TAGTGACAATCCAAAGACAATGG - Intergenic
977122118 4:93115273-93115295 TTTGAACAATGCAAATACACAGG - Intronic
977491106 4:97712934-97712956 TTTTAAGCATTCAAAAACAATGG - Intronic
977815929 4:101414122-101414144 TTGTTACAATGGTAAAACTAAGG - Intronic
978353882 4:107849820-107849842 TTGTAATAATGTAATAATAATGG - Intronic
978540008 4:109806246-109806268 TGCTATCAATGGAAAAACAATGG + Intergenic
979043047 4:115823979-115824001 TTATCATAAAGCAAAAACAATGG - Intergenic
979385870 4:120064812-120064834 TAGTAAAAATGCAATAAAAACGG + Intronic
979428809 4:120601696-120601718 TTGAGATTATGCAAAAACAACGG + Intergenic
980673388 4:136041306-136041328 TAGAAACAATGCAAATAAAAGGG - Intergenic
981106956 4:140892389-140892411 TTGTAGTGATGCAACAACAAGGG + Intronic
982316174 4:154034208-154034230 TTTTACTAATGCAAAAACCAAGG - Intergenic
982336483 4:154244992-154245014 TTGTAACATTGTGAAAATAATGG - Intronic
982677990 4:158398248-158398270 TTGTAAAAATGAGAAAATAATGG + Intronic
982739770 4:159045184-159045206 TTGTAATAATCCAAATAAAATGG + Intergenic
983528505 4:168785100-168785122 TTGTTACAAGGGAAATACAATGG + Intronic
984199558 4:176700708-176700730 TTGAAACAATGGAAAATCCATGG + Intronic
984507500 4:180638049-180638071 TTTTAACAATGAATCAACAAGGG - Intergenic
984574504 4:181432038-181432060 TTCTATCAGTGCAAAAACATGGG - Intergenic
986074152 5:4317226-4317248 CATTAAGAATGCAAAAACAATGG - Intergenic
987270849 5:16307377-16307399 TTTTCACAATACAAAAGCAATGG + Intergenic
987912729 5:24169959-24169981 TTATAGCAATGCGAGAACAAGGG + Intronic
988207724 5:28161900-28161922 ATTTAACAATGAGAAAACAAGGG - Intergenic
988529575 5:32015844-32015866 TTTTAACAAAGAAAAAAAAATGG + Intronic
989063595 5:37435609-37435631 TTGCAACAATACAGAAATAAAGG - Intronic
991445657 5:66697659-66697681 TTGCAAAAAGGTAAAAACAATGG + Intronic
991678490 5:69113282-69113304 CTGGAACAATGGAAAAAGAAAGG + Intronic
992948748 5:81835679-81835701 TAGTAACAATGTAATAAAAATGG - Intergenic
993318555 5:86442883-86442905 TTGTAACAATGCAAGCATATTGG - Intergenic
993417540 5:87653762-87653784 TAGTAACAATGCAATAATAATGG - Intergenic
993452306 5:88087218-88087240 GTGAAACCATACAAAAACAAAGG + Intergenic
994607739 5:101991436-101991458 TACTAACAGTGCAAACACAATGG + Intergenic
994892869 5:105660910-105660932 TTGTATTAAAGCAAGAACAAAGG - Intergenic
995258196 5:110071995-110072017 TAGAATCAATGCAAAAACAATGG - Intergenic
995601345 5:113800254-113800276 TTGTCAAAATGCAAAATAAAAGG + Intergenic
996817298 5:127588320-127588342 TTATAACAATGGTTAAACAACGG - Intergenic
996938400 5:128973900-128973922 TTGGAACAATAAAAACACAAAGG + Intronic
998202664 5:140137629-140137651 TTATATAAATGCACAAACAATGG - Intergenic
998266606 5:140671754-140671776 TAGGAAAAATGCAAAGACAAGGG + Exonic
998892296 5:146759180-146759202 CTGGAACAATGCAATAGCAAGGG - Intronic
999022027 5:148176837-148176859 CTCTTACAATGCAAAAACCAAGG + Intergenic
999350341 5:150864255-150864277 GTGAAAAAATGCATAAACAAAGG - Intronic
999402405 5:151275740-151275762 TTTTAAAAATGCAACAACATAGG + Intergenic
999685322 5:154097570-154097592 TTGTAACAATGCCAGAGAAACGG - Intronic
1000740661 5:164965920-164965942 TTGTTGAATTGCAAAAACAATGG - Intergenic
1001626363 5:173138620-173138642 TCATAACAATGTAAACACAATGG + Exonic
1002216658 5:177639751-177639773 TTGCAATAAGGCAAAAAAAAAGG - Intergenic
1002645930 5:180654486-180654508 GTGTAACAAAACAAAAACTAAGG + Intergenic
1003855668 6:10271683-10271705 TAGTAACAATGAAAAAAATAAGG + Intergenic
1003966951 6:11261777-11261799 TTTTAGCAGAGCAAAAACAAGGG - Intronic
1004995618 6:21189225-21189247 TTGTATCACTGCACAAAGAAGGG + Intronic
1005358276 6:25006317-25006339 TTAAAACAATGCACAAAAAATGG + Intronic
1007051290 6:38833004-38833026 TAGTGAGAATGCAAAATCAATGG - Intronic
1008436229 6:51479545-51479567 TTGAAACAAAGCAAACAGAAGGG + Intergenic
1008662162 6:53679510-53679532 TGGTAACAAAACAAAAACACAGG + Intergenic
1009389367 6:63127150-63127172 TTTTAACAAAACAAAAATAAAGG + Intergenic
1009601533 6:65807396-65807418 TTGTAAGAATGAGAAAACAGTGG + Intergenic
1010462376 6:76128069-76128091 TTGTGACAATGAAAGAAAAAAGG - Intergenic
1010573941 6:77509850-77509872 TATTAACAGTGCAAAACCAACGG - Intergenic
1010829256 6:80510465-80510487 TTGTATGAATTGAAAAACAACGG + Intergenic
1011050775 6:83147170-83147192 TTGCAACAATGAAAAAGCAAAGG + Intronic
1012196332 6:96345581-96345603 TTGTAAGTATGCAAAGAAAAGGG - Intergenic
1012214214 6:96561648-96561670 GTGTAACATAGCAAAACCAAGGG + Intergenic
1012298663 6:97556645-97556667 TTGTAAGAATGCACAAACAATGG - Intergenic
1012928632 6:105293951-105293973 TTGTACCCATGAAAATACAAAGG - Intronic
1013574135 6:111463726-111463748 TTATAACAATGAGAAAAAAACGG + Intronic
1013700065 6:112756534-112756556 ATGGAACAATTCAAACACAATGG - Intergenic
1014677226 6:124382117-124382139 TTATATGAATGCAAAAAAAATGG - Intronic
1014908898 6:127065072-127065094 ATGCAACAATGGCAAAACAAAGG + Intergenic
1015117728 6:129667883-129667905 ATGAAACAATGGAAAAGCAAGGG + Intronic
1015816339 6:137215136-137215158 TTTTACCAATGAGAAAACAAAGG + Intronic
1016134908 6:140528541-140528563 TTCTATCAATGCAAAACCATCGG - Intergenic
1016352535 6:143183605-143183627 TTTAAACAAAGCAACAACAAGGG - Intronic
1016594578 6:145785126-145785148 TTGTAGCAAAGCAGAAACCATGG - Intergenic
1016956273 6:149629708-149629730 TTATAATAATGAAAAAAGAAGGG + Intronic
1017289857 6:152723282-152723304 TTCTAACAATGTAACGACAACGG - Exonic
1017362409 6:153590660-153590682 ATGTAACATTGCAATAAAAAAGG + Intergenic
1018334207 6:162767820-162767842 TAGTAAAAATTCAAAAATAATGG - Intronic
1018594802 6:165467534-165467556 TTCTAGAAATGCAAGAACAAAGG + Intronic
1018643346 6:165925459-165925481 TTGTAATAATAAAAAAACACTGG + Intronic
1019030983 6:169011447-169011469 ATGTAATAAGGCAAAAACAAAGG - Intergenic
1020778407 7:12486596-12486618 TTTTAAAAATGTAAAATCAATGG - Intergenic
1021086623 7:16428236-16428258 TTGTAAGAAGGGAAACACAAGGG + Intergenic
1021384548 7:20012197-20012219 TGAGAACAATGCAAAAACACAGG - Intergenic
1021402145 7:20221509-20221531 TTCTACCAATACAAATACAAAGG - Intergenic
1021477707 7:21081211-21081233 TTTTAACAAGGAAAAAAAAAAGG - Intergenic
1021592993 7:22284828-22284850 TTCTAAAAATGCAAAAAAATGGG - Intronic
1023111449 7:36815423-36815445 TTGTGACAATAAAAACACAAAGG + Intergenic
1024032272 7:45471527-45471549 ATGTAACAATGTAAGAACCATGG + Intergenic
1024331210 7:48157112-48157134 TTTTACAAATGCAAAAACTAAGG - Intergenic
1024939455 7:54746790-54746812 TTGTAACATTGGAAAGACCATGG - Intergenic
1026453584 7:70551411-70551433 TTGATACAATGTGAAAACAATGG + Intronic
1026484893 7:70809287-70809309 TTGTAACAATGCAATGACAGTGG - Intergenic
1028155892 7:87429039-87429061 TAGAAACAATACCAAAACAAGGG + Intronic
1028215745 7:88130688-88130710 TTTTCACACTGTAAAAACAAAGG + Intronic
1029733567 7:102453272-102453294 TATTAAAAATGCAAAAAGAAAGG - Exonic
1029854464 7:103500924-103500946 TATTGACAATGCAAAAGCAAAGG + Intronic
1030539018 7:110805739-110805761 TTCTAACAATGCAGTAACATTGG + Intronic
1031554607 7:123157071-123157093 TTGTAAGAAAGCAGAAACACAGG - Intronic
1033338402 7:140472686-140472708 TTGTAACAATGCAAAAACAAGGG - Intronic
1033673711 7:143517542-143517564 TGGTCAAAAGGCAAAAACAAAGG - Intergenic
1033826554 7:145198278-145198300 ATGTATCTATACAAAAACAAAGG - Intergenic
1033949596 7:146767821-146767843 TTGAAATAATGGAAAAACTAAGG + Intronic
1035828662 8:2671456-2671478 TTGTAAAAATGAAACAAAAAAGG + Intergenic
1035873418 8:3160584-3160606 TTGTAACTCTGCAAAAAGATTGG - Intronic
1036059180 8:5295849-5295871 TTGTGACAATGGAGAGACAAGGG + Intergenic
1036070371 8:5435843-5435865 TTGTCATAAGGCAAAAACAAAGG - Intergenic
1037519680 8:19668394-19668416 TTCTAAAATTACAAAAACAAAGG - Intronic
1038279513 8:26151262-26151284 TTGTACCAATGGAAAATAAAGGG - Intergenic
1038309601 8:26436140-26436162 TACTAAAAATACAAAAACAATGG - Intronic
1039579067 8:38649220-38649242 TTGTATCAATGCATAAAAGAAGG + Intergenic
1039727301 8:40232617-40232639 TGCTAACATTGGAAAAACAAAGG - Intergenic
1040350410 8:46561070-46561092 TTGAAACAATGAGAAATCAAAGG - Intergenic
1040366588 8:46723660-46723682 TTGTAACAATGAGCAATCAAAGG + Intergenic
1040716926 8:50266995-50267017 TAGTAACTATGAAAAAAAAAGGG - Intronic
1041961417 8:63621362-63621384 CTGAAACATTGCAATAACAAAGG + Intergenic
1042607247 8:70557802-70557824 TTATAGCAATGCAAAACAAATGG + Intergenic
1043156839 8:76793096-76793118 CTGTAACCATACAATAACAATGG + Intronic
1043503679 8:80881617-80881639 TTTTAACAAGGCAAAAAAATAGG - Intergenic
1044001590 8:86888526-86888548 TTTTACCAATGAAAAAACCAAGG - Intronic
1044527164 8:93265143-93265165 TTGTTACACAGCAAAAAGAATGG - Intergenic
1044774758 8:95676716-95676738 TTGTAAAAATGCATATATAATGG + Intergenic
1045631270 8:104126214-104126236 TTGTCAAAATGCAAAATAAAAGG + Intronic
1045749728 8:105468792-105468814 TTGCAACAATGCCAACAAAAAGG - Intronic
1046489005 8:114922935-114922957 ATGAAACAATGAAAAAATAAGGG - Intergenic
1046641003 8:116731445-116731467 TTACAACAAAACAAAAACAAAGG - Intronic
1046741297 8:117831899-117831921 TTGCAACACTGAAAAAACAGAGG + Intronic
1051317029 9:15849863-15849885 TTTTAACATTTTAAAAACAATGG + Intronic
1052769293 9:32672740-32672762 TTTTAAAGATGCAGAAACAAAGG - Intergenic
1052975586 9:34407685-34407707 TGGTTAAAATGCAAAGACAAGGG - Intronic
1055610869 9:78022566-78022588 ATGTAATAATTTAAAAACAATGG - Intronic
1055838283 9:80471866-80471888 CTGCATGAATGCAAAAACAAAGG - Intergenic
1056403750 9:86254239-86254261 TAATAAAAACGCAAAAACAATGG - Intronic
1056478982 9:86981855-86981877 TTGGTTCAATGCAAAAATAATGG + Intergenic
1057092815 9:92275174-92275196 TTTTACCAATGCAAAAAGGAAGG - Intronic
1058898516 9:109420977-109420999 TTTGAACAATGCAAACAAAAGGG + Intronic
1059199570 9:112401658-112401680 TAGGAATAATGAAAAAACAAGGG + Intronic
1060453608 9:123767402-123767424 TTGTAAAAAAGAAAAAAAAAAGG + Intronic
1060464660 9:123892555-123892577 TTATAAGAATACAAAAACAGAGG + Intronic
1060633217 9:125178690-125178712 TTGTAATAATGCACCAACAAAGG + Intronic
1186357810 X:8805567-8805589 TAGAATCAATACAAAAACAAAGG + Intergenic
1186683010 X:11895627-11895649 TGGTAACATTGCAGAGACAAGGG + Intergenic
1187629730 X:21155773-21155795 ATGCAAAAATGCAAAACCAAGGG + Intergenic
1188406907 X:29822773-29822795 TTGAAATAATGAAAAAAGAAAGG + Intronic
1188526193 X:31090446-31090468 TCTTAACAATCCATAAACAAAGG - Intergenic
1188620676 X:32219210-32219232 TAGTAAACATGCAAAAACATTGG - Intronic
1188885121 X:35540175-35540197 TTGTATACATTCAAAAACAAAGG + Intergenic
1189718633 X:43891516-43891538 TTGGAAAATTGCTAAAACAATGG + Intergenic
1190401744 X:50043459-50043481 TTGTAAAGATGAAAAAAGAATGG - Intronic
1191770912 X:64757228-64757250 ATGTAACAATTCAAAAAAATGGG - Intergenic
1192658402 X:73016718-73016740 TTGTAAAAATAGAAAAAAAAAGG - Intergenic
1193715987 X:84935147-84935169 GTGAAACAAAGCAAGAACAAGGG + Intergenic
1193798778 X:85910785-85910807 TTTTAAAAATGCAATAACAGAGG + Intronic
1193916955 X:87377777-87377799 TTGTAACAGTGAAACAGCAAAGG + Intergenic
1195369706 X:104161412-104161434 CTGTAACAATGGCTAAACAAAGG + Intergenic
1197100009 X:122641621-122641643 TTTTAACAAATCAAAAACATAGG - Intergenic
1197313087 X:124930258-124930280 TTGTGTCAATGTAAAAAGAATGG - Intronic
1198516448 X:137413249-137413271 TTTTAACAATGAGAAAACCAAGG + Intergenic
1199556848 X:149118660-149118682 GTGTAACAAGGCAAAACAAATGG - Intergenic
1200599638 Y:5189685-5189707 TTTTAACAATGCATGAAAAAAGG + Intronic