ID: 1033340933

View in Genome Browser
Species Human (GRCh38)
Location 7:140491729-140491751
Sequence TAGAGCTTTCTCAATGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033340930_1033340933 26 Left 1033340930 7:140491680-140491702 CCAGAGGCTGGGAATGCTGGTAC No data
Right 1033340933 7:140491729-140491751 TAGAGCTTTCTCAATGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033340933 Original CRISPR TAGAGCTTTCTCAATGGACC TGG Intergenic
No off target data available for this crispr