ID: 1033345123

View in Genome Browser
Species Human (GRCh38)
Location 7:140520433-140520455
Sequence GTGGAGGTGTGGAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033345116_1033345123 -9 Left 1033345116 7:140520419-140520441 CCAGGAGTCCCTCTGTGGAGGTG 0: 1
1: 1
2: 0
3: 12
4: 185
Right 1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG No data
1033345113_1033345123 8 Left 1033345113 7:140520402-140520424 CCAAGTGGCTTAGTTTTCCAGGA 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG No data
1033345110_1033345123 14 Left 1033345110 7:140520396-140520418 CCCTGGCCAAGTGGCTTAGTTTT 0: 1
1: 1
2: 3
3: 33
4: 379
Right 1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG No data
1033345111_1033345123 13 Left 1033345111 7:140520397-140520419 CCTGGCCAAGTGGCTTAGTTTTC 0: 1
1: 0
2: 1
3: 24
4: 278
Right 1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG No data
1033345108_1033345123 26 Left 1033345108 7:140520384-140520406 CCTGTACGAGGGCCCTGGCCAAG 0: 1
1: 0
2: 1
3: 10
4: 115
Right 1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033345123 Original CRISPR GTGGAGGTGTGGAGGGAGGA TGG Intronic
No off target data available for this crispr