ID: 1033345592

View in Genome Browser
Species Human (GRCh38)
Location 7:140523377-140523399
Sequence CAGGGCCACCTGAAGCTTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 347}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033345582_1033345592 28 Left 1033345582 7:140523326-140523348 CCCTTCGTCCTGCTCACAAGCCA 0: 1
1: 0
2: 0
3: 5
4: 135
Right 1033345592 7:140523377-140523399 CAGGGCCACCTGAAGCTTCCGGG 0: 1
1: 0
2: 2
3: 28
4: 347
1033345585_1033345592 8 Left 1033345585 7:140523346-140523368 CCAGCTCGTTCCTCTGTTCCAGA 0: 1
1: 0
2: 0
3: 6
4: 191
Right 1033345592 7:140523377-140523399 CAGGGCCACCTGAAGCTTCCGGG 0: 1
1: 0
2: 2
3: 28
4: 347
1033345584_1033345592 20 Left 1033345584 7:140523334-140523356 CCTGCTCACAAGCCAGCTCGTTC 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1033345592 7:140523377-140523399 CAGGGCCACCTGAAGCTTCCGGG 0: 1
1: 0
2: 2
3: 28
4: 347
1033345586_1033345592 -2 Left 1033345586 7:140523356-140523378 CCTCTGTTCCAGAATGTGTTCCA 0: 1
1: 1
2: 3
3: 16
4: 210
Right 1033345592 7:140523377-140523399 CAGGGCCACCTGAAGCTTCCGGG 0: 1
1: 0
2: 2
3: 28
4: 347
1033345583_1033345592 27 Left 1033345583 7:140523327-140523349 CCTTCGTCCTGCTCACAAGCCAG 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1033345592 7:140523377-140523399 CAGGGCCACCTGAAGCTTCCGGG 0: 1
1: 0
2: 2
3: 28
4: 347
1033345589_1033345592 -10 Left 1033345589 7:140523364-140523386 CCAGAATGTGTTCCAGGGCCACC 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1033345592 7:140523377-140523399 CAGGGCCACCTGAAGCTTCCGGG 0: 1
1: 0
2: 2
3: 28
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033345592 Original CRISPR CAGGGCCACCTGAAGCTTCC GGG Exonic
900014489 1:138720-138742 CAGGCCCACCTTCTGCTTCCCGG - Intergenic
900044354 1:493922-493944 CAGGCCCACCTTCTGCTTCCCGG - Intergenic
900065761 1:728828-728850 CAGGCCCACCTTCTGCTTCCCGG - Intergenic
900241935 1:1621338-1621360 CACGGCCTCCTGCAGCCTCCCGG - Intronic
901035667 1:6334586-6334608 AAGCTCCACCAGAAGCTTCCAGG + Intronic
901232197 1:7647479-7647501 CCAGGCCACCTGGAGCTTGCAGG + Intronic
901650084 1:10738247-10738269 CAGGGCCGCCTGGGCCTTCCAGG + Intronic
901857321 1:12052739-12052761 CAGGGGCAACTGAAGCATCCAGG - Intergenic
901869071 1:12126929-12126951 CAGGAAGGCCTGAAGCTTCCAGG - Intronic
902534040 1:17108657-17108679 CTGTGCCACCTAAAGCATCCAGG - Intronic
903382485 1:22906730-22906752 AGTGGCCACCTGAAGCTGCCAGG + Exonic
904342425 1:29845500-29845522 CAGGGCCACTTCCAGGTTCCTGG + Intergenic
904399733 1:30248226-30248248 CAGGGCTACCTCCAGGTTCCTGG - Intergenic
904629515 1:31830470-31830492 CAGGACCCTCTGAAGCTGCCAGG + Intergenic
907181941 1:52578510-52578532 GAGGGCCACCTAAATCTTCCTGG - Intergenic
907238421 1:53067178-53067200 CCGGCACACCTGCAGCTTCCAGG - Intronic
907524030 1:55043524-55043546 CAGGGCCACCAGGAGCGACCAGG + Intronic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
910483338 1:87682750-87682772 CTGTGCCAGCTGAAGCTTCTGGG - Intergenic
911995327 1:104758370-104758392 CAGGGGCACCTTAGGCTTGCTGG + Intergenic
912286167 1:108371927-108371949 CACTGCTACCTGAAACTTCCAGG - Intergenic
912453171 1:109779930-109779952 CAGGGCCACCTGGAGCTCTGAGG - Intergenic
913063445 1:115228435-115228457 CAGTGCCACCCAAAGCTTCATGG - Intergenic
913597859 1:120395318-120395340 CACTGCAACCTCAAGCTTCCGGG + Intergenic
914089473 1:144483994-144484016 CACTGCAACCTCAAGCTTCCCGG - Intergenic
914309137 1:146450201-146450223 CACTGCAACCTCAAGCTTCCGGG + Intergenic
914592973 1:149122926-149122948 CACTGCAACCTCAAGCTTCCCGG - Intergenic
915320334 1:155052657-155052679 CAGTGCCACCTGCAGGTCCCAGG - Exonic
915497866 1:156294150-156294172 CAGGGCCACCTCTAGCTGACAGG + Exonic
918407583 1:184226010-184226032 CCGCGCAACCAGAAGCTTCCTGG + Intergenic
918536930 1:185584944-185584966 CCGGGGCACCACAAGCTTCCCGG + Intergenic
920165730 1:204034504-204034526 CAGGGCAACCTCCACCTTCCAGG + Intergenic
922100886 1:222476177-222476199 CAGGCCCACCTTCTGCTTCCCGG - Intergenic
922535035 1:226373358-226373380 CAGAGCAGCCTGAAGCTTCTGGG + Intronic
922733733 1:227968495-227968517 CAGGCCCACCTTCTGCTTCCCGG + Intergenic
922782383 1:228263688-228263710 CTGGGCCTCCTGTGGCTTCCTGG - Intronic
924343809 1:243056294-243056316 CAGGCCCACCTTCTGCTTCCCGG - Intergenic
924423643 1:243931645-243931667 CTGGGCCTCCTGGAGCCTCCTGG - Intergenic
924647762 1:245894928-245894950 CAGGGCCACGTGAAGGAGCCTGG + Intronic
924710875 1:246529148-246529170 CAGGGGCAACTGAGGGTTCCTGG + Intergenic
1064036905 10:11921406-11921428 CAGGGCCACCTGTAACTTGGGGG - Intronic
1065553031 10:26888082-26888104 CAGGGCTCTCTGTAGCTTCCTGG + Intergenic
1067431710 10:46249786-46249808 CAGGGCCCCCTGCTGCTGCCTGG + Intergenic
1070756404 10:78996138-78996160 CGGGGCCATCTGCATCTTCCAGG - Intergenic
1070820554 10:79351633-79351655 CAGGGCCTGCTGGGGCTTCCAGG - Intronic
1075216352 10:120539538-120539560 CAGGTCCACCTCAAGCTTCCAGG - Intronic
1076107350 10:127834285-127834307 CAGGGCCTGCTGAAGCTGCTTGG + Intergenic
1076244708 10:128937711-128937733 CAGGGCCAGCTGTGGCTTCCTGG - Intergenic
1076316909 10:129548722-129548744 CAGTCCCACCTGCAGCTTTCGGG + Intronic
1076970686 11:130397-130419 CAGGCCCACCTTCTGCTTCCCGG - Intergenic
1077036843 11:499454-499476 CAGGGCCACCTGCACGTCCCAGG + Intronic
1077348038 11:2073386-2073408 CAGGGCTGCATGAAGCTCCCTGG + Intergenic
1077352796 11:2100652-2100674 CAGGCCCATCTCAAGCTTGCTGG + Intergenic
1077412218 11:2408979-2409001 CAGGGCAACCTGGAGCTGGCAGG - Intronic
1077430970 11:2515841-2515863 CCGGGCCACCTGCACCCTCCGGG + Intronic
1077487204 11:2844488-2844510 AAGGGCTCCCTGAAGCTGCCTGG - Intronic
1079967233 11:26994360-26994382 CAGAGCCACATGAAGCCTGCTGG + Exonic
1080667469 11:34348506-34348528 CAGAGCCCCCAGAGGCTTCCAGG - Intronic
1082260840 11:50075385-50075407 CAGGCCCACCTTCAGCCTCCCGG - Intergenic
1082261343 11:50078019-50078041 CAGGCCCAGCTGCTGCTTCCAGG - Intergenic
1083302024 11:61744516-61744538 CAGGGCCACCTGCTCCTGCCTGG - Exonic
1083709145 11:64537188-64537210 CATGGCCACCTGATGCAGCCAGG - Intergenic
1084792235 11:71482202-71482224 CAAGGCCATCAGTAGCTTCCTGG + Intronic
1086051283 11:82594092-82594114 CATGGCCACCTGCTTCTTCCAGG + Intergenic
1092829471 12:12429780-12429802 CAGGGCCAGCCCAAGCTGCCAGG - Intronic
1096728966 12:53590646-53590668 CTGGGCCACCTAAATCTCCCTGG + Intronic
1097070189 12:56349011-56349033 CAAGGCCCCCTGGAGCTTGCTGG - Exonic
1097372905 12:58805859-58805881 GAGGGGCACCTTAAGTTTCCTGG + Intronic
1103566350 12:121817717-121817739 CCCGGCCCCCTGAGGCTTCCTGG - Intronic
1104392389 12:128402012-128402034 CAGGGCCACCTGGATGATCCAGG - Intronic
1104577147 12:129977874-129977896 CAGGGCCATCAGAAGATTGCTGG - Intergenic
1104871526 12:132001707-132001729 CAGGGCCACCAGAGGGCTCCTGG - Intronic
1104878289 12:132051939-132051961 CAGGGCCACCAGAGGGCTCCTGG - Intronic
1105020132 12:132810640-132810662 CAGGGCCACCAGAGGGCTCCTGG + Intronic
1105043055 12:132977062-132977084 CAGGGCCACCAGAGGGCTCCTGG + Intergenic
1105288135 13:19024456-19024478 CAGTGCAACCTCAATCTTCCCGG - Intergenic
1105523644 13:21154307-21154329 CAGGTCAACCTGAAGCTACCAGG + Exonic
1105835658 13:24209030-24209052 CAGGGTCAGCTGTGGCTTCCTGG + Intronic
1107478381 13:40763397-40763419 CAGGGCCACATGCAGTTTCCAGG + Intronic
1108286908 13:48917796-48917818 TAGGCCCACCTGAATCATCCAGG + Intergenic
1109534290 13:63695585-63695607 CAGGGCCAGCTGAACCTCCCCGG - Intergenic
1110553454 13:76832070-76832092 CAGGTCCACCTCCAGCTTCTAGG + Intergenic
1112164524 13:96904056-96904078 GAGGACCAGCTGGAGCTTCCAGG + Intergenic
1112563054 13:100530749-100530771 GAGGTCACCCTGAAGCTTCCTGG + Exonic
1112897363 13:104316339-104316361 CAGGACCTACTGAGGCTTCCTGG + Intergenic
1113064433 13:106359039-106359061 CAGGGCCACCTCAAGGTCCTGGG - Intergenic
1113881004 13:113626181-113626203 CAGGGACACCTGAGGATGCCTGG - Intronic
1114522645 14:23348628-23348650 CAGGGCCACCCGAAGCCTCTGGG + Exonic
1116946398 14:50839188-50839210 CAGGGCCACAGTAAGCTCCCAGG + Intergenic
1117042004 14:51776285-51776307 CAGGCACACCAGAAGCTGCCTGG - Intergenic
1117528537 14:56636433-56636455 CAGGGCTAGCTAAATCTTCCAGG - Intronic
1118316006 14:64726556-64726578 CAGGCCCACCTGGAGCAGCCGGG - Intronic
1118599779 14:67463990-67464012 GAGGCCCTCCTGAAGCTACCTGG - Intronic
1118925190 14:70185576-70185598 CACTGCCACCTACAGCTTCCTGG - Intronic
1119026224 14:71155078-71155100 CAGGGCTTCCTGAAGCTCCCAGG - Intergenic
1121255402 14:92526921-92526943 CTGGGCCACCAGAAGCTTGAAGG - Intronic
1202891077 14_KI270722v1_random:158634-158656 CAGGGCCACCTGCAGTTATCTGG + Intergenic
1124877334 15:33607370-33607392 CAGGCCCACCTGAAGTGCCCAGG - Intronic
1127286908 15:57540630-57540652 GAGGGCCAGCAAAAGCTTCCAGG - Intronic
1127791958 15:62406027-62406049 TACGGCCACCTGATGCTTCTCGG - Intronic
1129242498 15:74259849-74259871 CAGAGCCACATGAAGATCCCTGG + Intronic
1130578612 15:85115363-85115385 GAGGACCACCTGGAGTTTCCAGG + Intronic
1130996279 15:88906150-88906172 CAGGGCCACCTGTAACCTACAGG + Intronic
1131053961 15:89364860-89364882 CAGGGGCACCTGCAGCTACCAGG - Intergenic
1131795742 15:96014653-96014675 CATGGCCACATGTAGCTTCATGG + Intergenic
1132541919 16:514159-514181 CTGGGCCTCCTGCAGCTTCCTGG + Intronic
1133348348 16:5085039-5085061 CAAGGCCAACCAAAGCTTCCCGG - Exonic
1134893852 16:17866173-17866195 CTGGGTCCCCTGAAGTTTCCAGG - Intergenic
1136309413 16:29397656-29397678 CAGGGCGCCCTGAGGCGTCCAGG + Intronic
1136425270 16:30165942-30165964 CAGGGCCACCAGTAACTTCCTGG - Intergenic
1136569063 16:31086165-31086187 CAGGGCCCCCGGAATCTCCCTGG + Exonic
1137623124 16:49889824-49889846 CAGGCACACAAGAAGCTTCCAGG + Intergenic
1139587764 16:67915325-67915347 AAGGGCCACCAGAACCTGCCAGG - Intronic
1139965961 16:70745559-70745581 CAGGGGCTGCTGAGGCTTCCTGG + Intronic
1139969647 16:70765785-70765807 CACGGACACCTGGAGCTGCCAGG - Intronic
1140274184 16:73494065-73494087 CAGGGCCTCTTGAAGCTGGCAGG + Intergenic
1140407282 16:74719206-74719228 CAGGGACACCTGGAGCTACCAGG - Intronic
1140455050 16:75100103-75100125 AAAGGCCACCTGGAGGTTCCCGG - Intronic
1141175900 16:81719125-81719147 CAGAGCCACCGGAAGCTGCAGGG - Intergenic
1141763669 16:86045049-86045071 CAGGGCTGCCTGGAGCTCCCAGG + Intergenic
1141959377 16:87394058-87394080 CAGGGCCACTTTTAGGTTCCAGG - Intronic
1142144744 16:88488166-88488188 CAGGGCGCCCTGCAGCTTGCCGG - Intronic
1142449564 16:90167086-90167108 CAGGCCCACCTTCTGCTTCCCGG + Intergenic
1142457527 17:64760-64782 CAGGCCCACCTTCTGCTTCCCGG - Intergenic
1142614726 17:1127606-1127628 CAGGGCAGCCTGGAGCCTCCTGG - Intronic
1142686202 17:1578221-1578243 CCAGGCCACCTGCGGCTTCCAGG + Intronic
1143233645 17:5379194-5379216 CAGGGCCACCTTCAGCTACTGGG + Intronic
1143309347 17:5975674-5975696 CAGAGCCAAGTGAAGCATCCAGG + Intronic
1143326331 17:6100822-6100844 GAGAGCCACCTGAAGATGCCAGG + Intronic
1143407234 17:6685629-6685651 CAGAGCCTCCTGAAGCCTCTGGG - Exonic
1143828913 17:9635433-9635455 CAGGGCCTCCTCCAGCTTCTGGG - Exonic
1144655802 17:17035706-17035728 CAGGGCCACGTGCAGCTCCCTGG + Intergenic
1144672511 17:17140934-17140956 CTGTCCCACCTGCAGCTTCCAGG + Intronic
1146640537 17:34537353-34537375 CAGGGTCAAGTGAAGCATCCAGG - Intergenic
1148157191 17:45431180-45431202 CAGGGCCACCCAAAGCTCTCCGG + Intronic
1148806239 17:50265411-50265433 CAGGGCCACCAGCTGCTCCCTGG - Intergenic
1149516677 17:57286342-57286364 CAGGGACACACAAAGCTTCCAGG - Intronic
1151461836 17:74258932-74258954 CCTGGACCCCTGAAGCTTCCCGG + Intronic
1151798948 17:76366130-76366152 CAGGGACACCTTAACCCTCCTGG - Intronic
1152632138 17:81415082-81415104 CAGGGCCACCAGATGCTGCGCGG + Intronic
1152641954 17:81452924-81452946 CAGGCTCCCCTGAGGCTTCCAGG + Intronic
1152744321 17:82031993-82032015 CGGGCCCACCTGATGCTGCCCGG + Intronic
1152856621 17:82668357-82668379 CAGGCCCCCTTGAAGCTTCAAGG + Intronic
1155596435 18:27493427-27493449 CAGGGCAACCTGGAACTGCCAGG + Intergenic
1156517917 18:37696726-37696748 GAGAGCCCCCTGAAGCTGCCCGG - Intergenic
1157424903 18:47576657-47576679 CAGGGGCTCCTGAATCTTTCAGG - Intergenic
1158303848 18:56083145-56083167 CAGCGCCACCTGAAGGAGCCAGG + Intergenic
1158903842 18:61991731-61991753 GAGTGAAACCTGAAGCTTCCAGG - Intergenic
1160718439 19:586968-586990 CAGAGCTTCCTGCAGCTTCCCGG + Intergenic
1161591337 19:5130490-5130512 CAGGCCCATCTGACGCTTCCTGG + Intronic
1161776343 19:6264258-6264280 GAGGGAAACCTGAAACTTCCTGG - Intronic
1163059686 19:14751594-14751616 CAGGGCCTCCAGCAGCATCCAGG + Exonic
1163510745 19:17733646-17733668 CAGGGCCTCGTGAAGCCTCATGG + Intronic
1163777810 19:19228193-19228215 CAGGGCCACCTGAGGGCTCAAGG - Exonic
1164934882 19:32202495-32202517 CAGGGCCGGATGAAGCTCCCAGG - Intergenic
1165937620 19:39398661-39398683 CTGAGCTTCCTGAAGCTTCCAGG - Exonic
1167316235 19:48764642-48764664 CAGGTAGACCTGAAGCTTCCAGG + Intergenic
1167316597 19:48766978-48767000 CAGGTAGACATGAAGCTTCCAGG + Intergenic
1167358259 19:49016928-49016950 CTGCCCCACCTGAAGCTTACTGG + Intronic
1167361376 19:49032268-49032290 CTGCCCCACCTGAAGCTTACTGG - Intronic
1167362276 19:49036517-49036539 CTGACCCACCTGAAGCTTACTGG + Exonic
1167363803 19:49044341-49044363 CTGCCCCACCTGAAGCTTACTGG - Intronic
1167687165 19:50963531-50963553 CAGGAAGACCTGAAGATTCCTGG + Exonic
1167705693 19:51079684-51079706 CAGGGCAACCTGAAGGATCCTGG + Exonic
925238340 2:2298684-2298706 CTGTGCCACCAGCAGCTTCCTGG + Intronic
925791879 2:7497523-7497545 CAGGGGAACCTGAGGCTTTCTGG - Intergenic
928628398 2:33164897-33164919 CAGGTCCACCTGAACCTTCAGGG + Intronic
929393097 2:41494298-41494320 CAGGGGCAACTGAGGGTTCCTGG + Intergenic
929900102 2:45993259-45993281 CAGTGACACCTGCAGCCTCCAGG + Intronic
931155992 2:59630822-59630844 CAGGCCCATCTGATGCTTACAGG - Intergenic
931362310 2:61588098-61588120 CACTGCAACCTCAAGCTTCCAGG - Intergenic
931517782 2:63059803-63059825 CGGCGCCACCTGAGGCTGCCGGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934603617 2:95678080-95678102 CAGGTGCAACTGGAGCTTCCAGG - Intergenic
934757255 2:96832782-96832804 CAGGGCCGGCTGAAGGATCCAGG - Exonic
935300454 2:101689334-101689356 CAGGTCCTCCTGAATATTCCAGG - Intergenic
935956663 2:108383686-108383708 CAGTCTCACCTGCAGCTTCCTGG + Intronic
936042145 2:109158256-109158278 CAGGGCCACCTCCAGGCTCCCGG + Intronic
936536999 2:113320316-113320338 CAGGTGCAACTGGAGCTTCCAGG - Intergenic
938833352 2:135074540-135074562 CAGAGACAACTGAAGGTTCCTGG - Intronic
941684358 2:168432965-168432987 CAGAGCAACTTGCAGCTTCCCGG + Intergenic
943772798 2:191736877-191736899 CAGGGCCACTAGGAGCTGCCAGG + Intergenic
943894200 2:193332333-193332355 CAATGCCAGCAGAAGCTTCCTGG + Intergenic
947720270 2:232365786-232365808 GAAGGACACCTGGAGCTTCCAGG - Intergenic
947732896 2:232440770-232440792 GAGGGACACCTGTAGCCTCCAGG - Intergenic
947742906 2:232493015-232493037 TAGGTCCATCTCAAGCTTCCAGG + Intergenic
948274036 2:236694772-236694794 CAGGGGCTACTGCAGCTTCCTGG + Intergenic
949064493 2:241981399-241981421 CAGGCCCACCTCAGGCCTCCCGG - Intergenic
1169198701 20:3697247-3697269 CAGGGCTGCCAGCAGCTTCCCGG + Exonic
1169231905 20:3895405-3895427 CAGTGCAACCTCAATCTTCCGGG - Intronic
1169262354 20:4148513-4148535 CAGGGCCACCTCTACCCTCCTGG + Intronic
1170607028 20:17882293-17882315 AAGGGGCACCAGCAGCTTCCGGG - Intergenic
1172153585 20:32808048-32808070 CAGAGCCACCTGACTCTTGCAGG + Exonic
1174075154 20:47930055-47930077 CAGGACCACATCCAGCTTCCGGG - Intergenic
1175239009 20:57533050-57533072 TAGGCCCACCTGAAGAATCCAGG - Intergenic
1175700017 20:61130279-61130301 CAGGGCCAACACAGGCTTCCTGG - Intergenic
1175958781 20:62624561-62624583 CAGCGACACCTGCAGCCTCCAGG + Intergenic
1176141321 20:63546331-63546353 CAGGGCCACTTCCAGCCTCCTGG - Intronic
1176236883 20:64057587-64057609 CAGGGCCGCCAGACGCTCCCGGG - Intronic
1179726346 21:43343480-43343502 CAGGGCCACTGGCAGCTTCAGGG + Intergenic
1179960598 21:44765257-44765279 CAGAGCCACCTTCAGCTGCCAGG + Intergenic
1180950238 22:19717531-19717553 CAGGGCCACCTGAGGGCTGCAGG + Intronic
1181518877 22:23433967-23433989 CAAGGCCACCTCAGGCCTCCAGG + Intergenic
1181760756 22:25057286-25057308 CAGTGCCACCTGGAGCTCCGGGG + Intronic
1182704727 22:32269999-32270021 CGGGGGCTCCTGAAGCTTCTCGG - Intergenic
1183392184 22:37552061-37552083 CAGGGCCACGTGAAGCCCCCAGG + Intergenic
1183948671 22:41340653-41340675 CAGGGCCAAAGGAGGCTTCCTGG + Intronic
1184740872 22:46428460-46428482 CATCTCCACCTGAAGCTACCAGG + Intronic
1185125237 22:49006912-49006934 CATGGCCACCTGCAGGGTCCTGG + Intergenic
1185180917 22:49362635-49362657 CAGGGCCTCCTGGAGGCTCCGGG + Intergenic
1185367108 22:50441768-50441790 CAGGGCCACAGGAAGGTCCCTGG + Intronic
951634414 3:24757227-24757249 CAGGACCACATGAAGTTTTCTGG - Intergenic
951704578 3:25530665-25530687 CAGGCCCACCTGGATTTTCCAGG + Intronic
952210700 3:31226543-31226565 GTTGGCCACCTGCAGCTTCCTGG - Intergenic
953495901 3:43386789-43386811 CAGGACCACCTGTAGAGTCCAGG - Intronic
953877925 3:46676914-46676936 CAGGGCCTCCTGCAGGTCCCTGG + Exonic
957052694 3:75422285-75422307 CAGGGCCAACCACAGCTTCCCGG - Intergenic
958700968 3:97589056-97589078 CTGGGCCACATGAGGCTCCCAGG - Intronic
959476656 3:106820951-106820973 CAGGCACAGCTGAAGCCTCCTGG + Intergenic
961413119 3:126737622-126737644 CAGTACCACCTGATACTTCCTGG + Intronic
961886307 3:130098509-130098531 CAGGGCCAACCACAGCTTCCCGG - Intronic
962201550 3:133404424-133404446 CAGTGCCACCTGTAGGTACCTGG - Intronic
962708756 3:138068297-138068319 CAAGGCCACCTGCAGGGTCCTGG + Exonic
962986698 3:140542901-140542923 CAGGACCAGCTGAGGTTTCCTGG - Intronic
963306320 3:143657473-143657495 CAGGGACCCCTGGAGGTTCCTGG + Intronic
966910258 3:184555636-184555658 CAGGGCCAACTGGACCTTCAAGG - Intronic
968965071 4:3765695-3765717 CAGGGCCGCCTGCAGCCTGCGGG - Intergenic
969082682 4:4631893-4631915 CAGGGCCCCATGTAGCTGCCTGG - Intergenic
969172108 4:5372420-5372442 CTGGGCTACCTGAAGCTTCAGGG - Intronic
969416565 4:7063986-7064008 CTGGGCCACATAAAGGTTCCAGG - Intronic
969483899 4:7461038-7461060 CAGGCAGACCTGAAGCTTGCTGG + Intronic
969758493 4:9166130-9166152 CAGGGCCAACCACAGCTTCCCGG + Intergenic
970652317 4:18192513-18192535 CAGGGCAACCTGAAGATTAAGGG + Intergenic
971379482 4:26083804-26083826 CTGGGCTTCCTGAAGCCTCCTGG + Intergenic
973584248 4:52375261-52375283 CAGGGCCTGCTGCTGCTTCCTGG - Intergenic
974054841 4:56975097-56975119 CACTGCCACCTCAACCTTCCAGG + Intronic
976564890 4:86541755-86541777 CAGAGCTCCCTGAACCTTCCTGG + Intronic
979258906 4:118631394-118631416 CAGGCCCACCTTCTGCTTCCTGG + Intergenic
979329447 4:119409163-119409185 CAGGCCCACCTTCTGCTTCCCGG - Intergenic
981613631 4:146623054-146623076 CAGGGGCATCTGAAGATTCAGGG - Intergenic
981835703 4:149050943-149050965 GAGGGCCAGCTTAAGCTTTCGGG - Intergenic
983702422 4:170614482-170614504 CAGGGCTTCCTGAAGCTTTGTGG - Intergenic
984889064 4:184474976-184474998 CAGGGTGGCCTGAAGGTTCCAGG + Intergenic
985026927 4:185747551-185747573 CAGGGGCAGCACAAGCTTCCAGG + Intronic
985752228 5:1687186-1687208 CAGAGCCACTGGAAGCTTCCTGG - Intergenic
986679463 5:10220343-10220365 CAGGGCCACCTGAATCCTTTCGG - Intergenic
987709611 5:21491425-21491447 CAGGGCCAGCTGAAGGTGCTGGG + Intergenic
988750002 5:34182741-34182763 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
991738262 5:69645943-69645965 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
991759931 5:69910479-69910501 CAGGGCCAGCTGAAGGTGCTGGG + Intergenic
991787400 5:70207619-70207641 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
991789838 5:70225669-70225691 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
991817722 5:70522062-70522084 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
991839161 5:70785542-70785564 CAGGGCCAGCTGAAGGTGCTGGG + Intergenic
991879846 5:71208004-71208026 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
991882286 5:71226028-71226050 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
992277911 5:75140126-75140148 CAGGGCAACCTCCACCTTCCAGG - Intronic
992701445 5:79345210-79345232 CATGGCCACCAAAAGATTCCTGG + Intergenic
993306213 5:86278685-86278707 CACTGCTACCTGAAACTTCCAGG - Intergenic
994421735 5:99532733-99532755 CAGGGCCAGCTGAAGGTGCTGGG + Intergenic
994461108 5:100067828-100067850 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
994485257 5:100381272-100381294 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
995241621 5:109891101-109891123 CAGGGTCTCCTGAAGCTTGGAGG - Intergenic
996883897 5:128332950-128332972 CAGCTACACTTGAAGCTTCCTGG + Exonic
996946358 5:129074135-129074157 CATGGCCACCGGAAACTTCAGGG - Intergenic
997742482 5:136269257-136269279 CTGGCTCACCCGAAGCTTCCTGG + Intronic
1001397517 5:171427905-171427927 CACGGCCAACTGAAGCGTGCTGG - Intronic
1002400593 5:178989646-178989668 CAGAGCCAACTGGAGGTTCCAGG + Intronic
1002434667 5:179223886-179223908 AAGGGCCACCTCAGTCTTCCAGG - Intronic
1002504433 5:179669169-179669191 CAGAGTCCCCTGAAGCATCCTGG - Intergenic
1002729489 5:181325007-181325029 CAGGCCCACCTTCTGCTTCCCGG + Intergenic
1005548066 6:26889071-26889093 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
1005671988 6:28115517-28115539 CAGTGCAACCTGAGGCTCCCAGG - Intergenic
1005832281 6:29680644-29680666 CCCGGCCACCGGAAGCTTCGAGG - Intronic
1006603386 6:35240427-35240449 CAGAGACACTGGAAGCTTCCTGG - Exonic
1008179683 6:48312959-48312981 CAGGCCCACCTGGAGAGTCCAGG - Intergenic
1008688004 6:53945788-53945810 CCAGGGCACCTGAAGCTGCCTGG - Intronic
1009018826 6:57930165-57930187 CAGGGCCAGCTGAAGGTGCTGGG - Intergenic
1011791436 6:90903250-90903272 CAGGTCCACCTGGATCATCCAGG - Intergenic
1012825698 6:104144106-104144128 CAGGGCCTCTAGAAGCTGCCTGG - Intergenic
1012850201 6:104437624-104437646 GAGGGCCAAGTGAAGCTTCTGGG - Intergenic
1015936135 6:138407490-138407512 CAGGGCCACTTGAAGCCTTGGGG - Intronic
1018392078 6:163348241-163348263 TAGGCCCACCTGAATCATCCAGG - Intergenic
1018398837 6:163402353-163402375 CACGGTAACCAGAAGCTTCCTGG - Intergenic
1018732832 6:166665680-166665702 CAGGGCCGCCTGCAGCTTGCTGG - Intronic
1019322461 7:421905-421927 CATGCCCACCAGAGGCTTCCTGG + Intergenic
1019527481 7:1487252-1487274 CAAGGCCTCCGGAAGGTTCCGGG + Intronic
1019592411 7:1842358-1842380 CAAGGCCACCTCAGGCCTCCAGG - Intronic
1019702325 7:2480031-2480053 CAGTACCCTCTGAAGCTTCCAGG + Intergenic
1019740735 7:2671660-2671682 CAGGGCAACCTCCAGCCTCCAGG + Intergenic
1023873337 7:44274333-44274355 CAGGGCCCCCAGGACCTTCCAGG + Intronic
1024648441 7:51386999-51387021 CAGACCCACCTGCAGCCTCCCGG - Intergenic
1024649524 7:51391756-51391778 CAGGCCCACCTTCTGCTTCCCGG - Intergenic
1025053188 7:55744930-55744952 CAGGGCCAGCTCCAGCCTCCCGG - Intergenic
1025092117 7:56072909-56072931 CAGGGATATCTGAAGTTTCCTGG + Intronic
1025177545 7:56809716-56809738 CAGGGCCAGCTCCAGCCTCCTGG - Intergenic
1025182506 7:56830625-56830647 CAGGCCCACCTTCTGCTTCCCGG - Intergenic
1025689424 7:63746369-63746391 CAGGCCCACCTTCTGCTTCCCGG + Intergenic
1025694218 7:63766537-63766559 CAGGGCCAGCTCCAGCCTCCCGG + Intergenic
1025731581 7:64113192-64113214 CAGGGCCAGCTGAAGGTACCGGG + Intronic
1025928278 7:65976076-65976098 CAGGGCCAACTTAAGGTGCCAGG - Exonic
1026631021 7:72038283-72038305 CATGGAGACCTGAAACTTCCAGG - Intronic
1029153382 7:98497699-98497721 CTGGGCCACTTGAGGCTTGCAGG + Intergenic
1029737316 7:102472048-102472070 CAGGGCAAACTGAACCTTCCTGG + Intronic
1031215151 7:118881182-118881204 CAGGTGCACATTAAGCTTCCAGG + Intergenic
1032467281 7:132153939-132153961 CAGCCCTTCCTGAAGCTTCCTGG - Intronic
1033230896 7:139596688-139596710 CAGTGCCACCTTAGCCTTCCAGG - Intronic
1033345592 7:140523377-140523399 CAGGGCCACCTGAAGCTTCCGGG + Exonic
1033582918 7:142752864-142752886 CAGGGCCACCAGAATCACCCTGG - Exonic
1033585944 7:142774352-142774374 CAGGGCCACCAGAATCACCCTGG - Intergenic
1035241276 7:157531261-157531283 CAGGGAAAGCAGAAGCTTCCCGG + Intergenic
1035243458 7:157547269-157547291 CAGAGCCACCTGAAGCTCACGGG + Intronic
1035818712 8:2568175-2568197 CAGGGCAACCTCAACCTCCCAGG - Intergenic
1036848023 8:12182861-12182883 CAGGGCCAACCACAGCTTCCCGG - Exonic
1036869386 8:12425144-12425166 CAGGGCCAACCACAGCTTCCCGG - Intergenic
1037992511 8:23330938-23330960 CAGGGCCTCCTGAAATTGCCAGG + Intronic
1038611579 8:29064240-29064262 CAGAGCCACCTGCTGCTTTCTGG - Intronic
1039196361 8:35035901-35035923 CAAGACCACCTGAAGTTTTCAGG + Intergenic
1041554205 8:59134685-59134707 CACGGCAACCTGAAACTTCTGGG - Intergenic
1042683656 8:71414066-71414088 CTGGGGCAGCTGAAGCTTCCTGG - Intronic
1042736507 8:71995393-71995415 CAGGGACACATGAAGCTTATTGG + Intronic
1047025468 8:120818923-120818945 CATGGCCACTGGCAGCTTCCAGG + Intergenic
1047058802 8:121198482-121198504 CAAGGCCACATGAAGCTACAAGG - Intergenic
1047643836 8:126849384-126849406 GTGGGACAGCTGAAGCTTCCTGG + Intergenic
1048134014 8:131728412-131728434 CTGTGCAACGTGAAGCTTCCAGG + Intergenic
1048571266 8:135659090-135659112 CAGAGCCTCCTACAGCTTCCAGG + Intergenic
1049164278 8:141116858-141116880 CTGAGCCACCTGCAGGTTCCTGG + Intergenic
1049247261 8:141569536-141569558 CAGAGCCACCTGAAACACCCAGG + Intergenic
1049299440 8:141861921-141861943 CTGGGAAACCTGTAGCTTCCAGG - Intergenic
1049350012 8:142159394-142159416 CAAGGCCATGTGCAGCTTCCTGG + Intergenic
1049478638 8:142809523-142809545 CAGGGCCAGCCGCCGCTTCCTGG + Intergenic
1049804376 8:144532345-144532367 CTGGTCCACCTGCAGCTTCAGGG + Exonic
1051047153 9:12888728-12888750 CAGGGCCACATGACTCTGCCTGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055899049 9:81213448-81213470 GAGGTCCACCAGAATCTTCCAGG + Intergenic
1056581681 9:87891145-87891167 CGGGCCCACCAGAAGCTTTCAGG - Intergenic
1056762530 9:89425470-89425492 CAGGGCCACGTGCTGCTTCCAGG - Intronic
1057884460 9:98819471-98819493 CAGGGCCTCCTGATGCAGCCAGG + Intronic
1059389307 9:113988836-113988858 CTGGGCCCCCGGAAGGTTCCAGG - Intronic
1059974178 9:119698173-119698195 ACGGGCCAGCTGCAGCTTCCTGG + Intergenic
1060472602 9:123961024-123961046 CAGGGGTACCTGAAGCTTCCAGG + Intergenic
1061129762 9:128702472-128702494 CAGCGCCCCCTGAAGGTTGCCGG - Intergenic
1061486109 9:130921217-130921239 CAATGCCACCTGATCCTTCCTGG - Intronic
1061525895 9:131161925-131161947 CTGGGCCACATGAAGCCTGCAGG - Intronic
1061894615 9:133640789-133640811 CAGGGCCACCTGCAGAGCCCTGG + Intronic
1062049240 9:134438599-134438621 CAGGGGCAGCTGGGGCTTCCTGG - Intronic
1203577460 Un_KI270745v1:20276-20298 CAGGCCCACCTTCTGCTTCCCGG + Intergenic
1185485039 X:475656-475678 CAGGGACACCTGGAGCCCCCAGG - Intergenic
1185499770 X:587892-587914 CAGGGACACCTGGAGCCCCCAGG - Intergenic
1185517387 X:710321-710343 CAGGGACACCTGGAGCCCCCAGG - Intergenic
1185579883 X:1203645-1203667 CAGGGACACCTGGAGCCCCCAGG + Intronic
1185622721 X:1463401-1463423 CAGGGACACCTGGAGCCCCCAGG - Exonic
1185650461 X:1644096-1644118 CAGGGACACCTGGAGCCCCCAGG + Intergenic
1185653522 X:1666432-1666454 CAGGGACACCTGGAGCCCCCAGG - Intergenic
1185653577 X:1666773-1666795 CAGGGACACCTGGAGCCCCCAGG - Intergenic
1185677391 X:1859858-1859880 CAGGGACACCTGGAGCCCCCAGG - Intergenic
1185680401 X:1884262-1884284 CAGGGACACCTGGAGCCCCCAGG - Intergenic
1185680453 X:1884603-1884625 CAGGGACACCTGGAGCCCCCAGG - Intergenic
1185790484 X:2925274-2925296 CAGGGACACCTGGAGCCCCCAGG + Intronic
1185895347 X:3853675-3853697 CAGGGACACCTGGAGCCACCAGG + Intergenic
1185900464 X:3892099-3892121 CAGGGACACCTGGAGCCACCAGG + Intergenic
1185905580 X:3930530-3930552 CAGGGACACCTGGAGCCACCAGG + Intergenic
1186067664 X:5783566-5783588 CCAGGACACCTGAAGCTCCCAGG - Intergenic
1186068405 X:5791137-5791159 AAGGGACACCTGAAGCCACCAGG + Intergenic
1189549153 X:42075309-42075331 GAGTGCCTCCTGAAGCTTGCAGG + Intergenic
1190684151 X:52855465-52855487 CAGAAGCCCCTGAAGCTTCCTGG - Intergenic
1195388418 X:104335340-104335362 CAGGAACACCTAAAACTTCCTGG + Intergenic
1199078206 X:143547864-143547886 CGGGGCTACCTGCAGCTTCCAGG + Intergenic
1200708093 Y:6459895-6459917 CAGGGCCCCTTGAATCTACCAGG - Intergenic
1201026019 Y:9704813-9704835 CAGGGCCCCTTGAATCTACCAGG + Intergenic
1201283845 Y:12362694-12362716 CAGGGACACCTGGAGCCCCCAGG - Intergenic
1201543787 Y:15138331-15138353 CAGGCCCACCTGCAGCTACCCGG + Intergenic