ID: 1033348667

View in Genome Browser
Species Human (GRCh38)
Location 7:140544544-140544566
Sequence GACCCTCTAGTCTGTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033348667_1033348669 21 Left 1033348667 7:140544544-140544566 CCTGCTCTACAGACTAGAGGGTC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1033348669 7:140544588-140544610 CGCTTTAGCAGAAGTAGCCAAGG 0: 1
1: 0
2: 0
3: 4
4: 64
1033348667_1033348670 24 Left 1033348667 7:140544544-140544566 CCTGCTCTACAGACTAGAGGGTC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1033348670 7:140544591-140544613 TTTAGCAGAAGTAGCCAAGGCGG 0: 1
1: 0
2: 0
3: 11
4: 170
1033348667_1033348671 25 Left 1033348667 7:140544544-140544566 CCTGCTCTACAGACTAGAGGGTC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1033348671 7:140544592-140544614 TTAGCAGAAGTAGCCAAGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033348667 Original CRISPR GACCCTCTAGTCTGTAGAGC AGG (reversed) Intronic
911057790 1:93722784-93722806 GACCCTCTAGTCAGGCGAACAGG + Intronic
913519638 1:119632404-119632426 GCTCCTCTTGTCTGGAGAGCGGG - Intronic
916382679 1:164229928-164229950 GACTCTCTAGTCTGTAAATGTGG - Intergenic
920707669 1:208266400-208266422 GGACCTCTAGTCTGTGGAGAAGG - Intergenic
922218505 1:223539966-223539988 GGCTCTGTAGACTGTAGAGCAGG - Intronic
1063538984 10:6913038-6913060 GAGCATTGAGTCTGTAGAGCTGG - Intergenic
1067974468 10:51008397-51008419 GAACTTCTAGTCTACAGAGCTGG - Intronic
1075557904 10:123446741-123446763 GACCCTCAAGTCAGAAGACCTGG - Intergenic
1077663594 11:4089951-4089973 TACCTTTTTGTCTGTAGAGCAGG + Intronic
1077721764 11:4637254-4637276 CTCCCTCTAGTCTCTTGAGCTGG + Intergenic
1081577663 11:44329263-44329285 GAACCTCTGGTGTGGAGAGCTGG + Intergenic
1081984490 11:47291695-47291717 GACCTGCTAGTCTGGAGATCTGG + Intronic
1089092453 11:115889134-115889156 GACCCAATAGCCTATAGAGCAGG - Intergenic
1092232419 12:6783494-6783516 GCCTCTCTAGGCTGTAGAACGGG - Intergenic
1100908312 12:99328221-99328243 GAGTCTCTAGGCTGTAGTGCAGG + Intronic
1104963400 12:132498594-132498616 GACATTCCAGGCTGTAGAGCAGG - Intronic
1105661087 13:22496084-22496106 GAGGCTCTAGTGTGTAGGGCAGG + Intergenic
1113556947 13:111244456-111244478 GACTGTCTAGTTTGTATAGCAGG + Intronic
1129223222 15:74147046-74147068 GACCCTCTGTTCTTTAGAGGTGG + Intergenic
1132669901 16:1098241-1098263 GAGCCCCCAGTCTGTACAGCAGG - Intergenic
1134902964 16:17955158-17955180 GACCCTATAGTCAGAAAAGCAGG + Intergenic
1139945663 16:70640011-70640033 GAAACTCTAGGCTGTAGACCAGG + Intronic
1143702327 17:8670309-8670331 GCCGCTCTTGTCTTTAGAGCAGG + Intergenic
1144188389 17:12819079-12819101 GACTCTCTAGTCTGCTGAGTTGG - Intronic
1148397745 17:47323857-47323879 GACCCTATCGGCTGTCGAGCCGG - Intronic
1150547159 17:66171129-66171151 GACTCTCTATTCAGTAGAGATGG - Intronic
1153590063 18:6664272-6664294 CAGCCTCTAGCATGTAGAGCAGG - Intergenic
1166002648 19:39886996-39887018 GAACCTGGAGTCTGCAGAGCTGG + Intronic
1166005434 19:39903248-39903270 GAACCTGGAGTCTGCAGAGCTGG + Intronic
934742394 2:96734255-96734277 GCCCTTCTAGTCTCTAGAACGGG - Intronic
935066454 2:99652597-99652619 AACCATCTAGTGTGTTGAGCCGG + Intronic
944195851 2:197052125-197052147 GACCCACTGGTGTGTAGACCAGG + Intronic
945066437 2:205951364-205951386 CACCCTCTATTCTGTTCAGCTGG - Intergenic
948593628 2:239066182-239066204 GACGCTGTGGTCTGTACAGCTGG - Intronic
1172513369 20:35515681-35515703 GACCCAGTACTCTGCAGAGCGGG + Exonic
1172803765 20:37596883-37596905 GACTCTCTGCTCTGCAGAGCAGG + Intergenic
1173406110 20:42766636-42766658 GGCCCTCTTTTCTGTAGAGTGGG - Intronic
1182023430 22:27099845-27099867 GACCCTGTAGTCTGGAGACCTGG + Intergenic
1183641367 22:39094942-39094964 GCCTCCCTAGTCTGTAGTGCCGG + Intergenic
1184441261 22:44517744-44517766 CACCCTCTGGCCTGTACAGCTGG - Intergenic
1184613084 22:45618460-45618482 GACCCTCTTCTCTGTGGACCTGG - Intergenic
1184918704 22:47590672-47590694 GACCCTCTTCTCTGTGGACCTGG + Intergenic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
957861177 3:85952642-85952664 CAGCCTCTAGTCTGTACAACAGG - Intronic
961573578 3:127817406-127817428 GCCCCTCAACTCTGGAGAGCTGG - Intronic
964737108 3:159928529-159928551 GACCATCAATTCTGTAAAGCAGG - Intergenic
967953192 3:194856712-194856734 GCCCCTCTGGTGTTTAGAGCTGG - Intergenic
969540878 4:7788046-7788068 GACCCTCCAGTGGGGAGAGCAGG - Intronic
984046150 4:174801390-174801412 GACCCAATAGTCTGTAGTGCAGG - Intronic
988920571 5:35937591-35937613 GACCTTATAGTCTGTCTAGCAGG - Intronic
990023736 5:51159984-51160006 CCCCCTCTAGTCTGTAGGACTGG - Intergenic
990158424 5:52906760-52906782 GCCCCTCTAGTCTAGAGAGTTGG - Intronic
998211848 5:140205613-140205635 TGCCTTCTTGTCTGTAGAGCTGG + Intronic
999926667 5:156386210-156386232 GACCCTATAGTGTGTAGGGTAGG + Intronic
1001836187 5:174834737-174834759 GACGCTCAAGTGTGTAGATCAGG - Intergenic
1002154452 5:177265576-177265598 CATCCTGTAGTCTGTGGAGCAGG + Intronic
1010955341 6:82084538-82084560 GACCCTATTCTCTTTAGAGCTGG + Intergenic
1013316549 6:108948660-108948682 GAAGCTCTAGGCTGTAGGGCAGG - Intronic
1013540949 6:111108451-111108473 GACCCTCAATTCTTTAGAGATGG + Intronic
1032394207 7:131577486-131577508 GAACCACTAGGCTGTGGAGCAGG - Intergenic
1033315038 7:140290083-140290105 AACCCTCTTCTCTGTAGAGCTGG - Intergenic
1033348667 7:140544544-140544566 GACCCTCTAGTCTGTAGAGCAGG - Intronic
1035606897 8:935339-935361 GACCCTCTGGACTGAGGAGCCGG - Intergenic
1037754542 8:21702571-21702593 GACCCTATAGCCTGCAAAGCAGG + Intronic
1046171822 8:110518290-110518312 GACCCTGAAGCCTGTAGAGAGGG + Intergenic
1046558896 8:115813831-115813853 GACAGTCTAGGCTGTGGAGCAGG + Intergenic
1053440558 9:38112832-38112854 GACCCCCTAGTTTGCAGGGCTGG - Intergenic
1055462335 9:76530566-76530588 GATCCTGTAGTCTGTAGAGGGGG + Intergenic
1062710478 9:137972579-137972601 GGCCCTCTGGTCTACAGAGCAGG - Intronic