ID: 1033351894

View in Genome Browser
Species Human (GRCh38)
Location 7:140568673-140568695
Sequence CGCTTCTGTCCCTCATACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033351888_1033351894 7 Left 1033351888 7:140568643-140568665 CCACGCCTTGCCAAGCAAGCTCC 0: 1
1: 0
2: 2
3: 9
4: 221
Right 1033351894 7:140568673-140568695 CGCTTCTGTCCCTCATACTAAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1033351890_1033351894 2 Left 1033351890 7:140568648-140568670 CCTTGCCAAGCAAGCTCCGGCAG 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1033351894 7:140568673-140568695 CGCTTCTGTCCCTCATACTAAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1033351883_1033351894 28 Left 1033351883 7:140568622-140568644 CCCCACTGTCTCCCGAGATGTCC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1033351894 7:140568673-140568695 CGCTTCTGTCCCTCATACTAAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1033351887_1033351894 16 Left 1033351887 7:140568634-140568656 CCGAGATGTCCACGCCTTGCCAA 0: 1
1: 0
2: 2
3: 4
4: 80
Right 1033351894 7:140568673-140568695 CGCTTCTGTCCCTCATACTAAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1033351885_1033351894 26 Left 1033351885 7:140568624-140568646 CCACTGTCTCCCGAGATGTCCAC 0: 1
1: 0
2: 0
3: 20
4: 153
Right 1033351894 7:140568673-140568695 CGCTTCTGTCCCTCATACTAAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1033351884_1033351894 27 Left 1033351884 7:140568623-140568645 CCCACTGTCTCCCGAGATGTCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1033351894 7:140568673-140568695 CGCTTCTGTCCCTCATACTAAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1033351886_1033351894 17 Left 1033351886 7:140568633-140568655 CCCGAGATGTCCACGCCTTGCCA 0: 1
1: 0
2: 1
3: 5
4: 52
Right 1033351894 7:140568673-140568695 CGCTTCTGTCCCTCATACTAAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1033351892_1033351894 -3 Left 1033351892 7:140568653-140568675 CCAAGCAAGCTCCGGCAGGACGC 0: 1
1: 0
2: 1
3: 11
4: 77
Right 1033351894 7:140568673-140568695 CGCTTCTGTCCCTCATACTAAGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033351894 Original CRISPR CGCTTCTGTCCCTCATACTA AGG Intronic
917241537 1:172954190-172954212 CCCTTCTGACCCTCATCCTCAGG + Intergenic
918113107 1:181475581-181475603 TGTTTATGTACCTCATACTATGG + Intronic
920179668 1:204124679-204124701 CGCGCCTGTTCCTCATAGTAGGG - Exonic
1063095305 10:2903648-2903670 GGGCTCTGTCCCTCATGCTATGG + Intergenic
1063458086 10:6199116-6199138 CACTTCTCTCCCTCATACATGGG + Intronic
1063583091 10:7327035-7327057 CCCTGCTGTCCTTCATACGAGGG + Intronic
1063962620 10:11319394-11319416 CCCCTCTGTCCCTGTTACTATGG - Intronic
1064807201 10:19148721-19148743 CGTTTTTGTCCCTCACACTCTGG - Intronic
1071448928 10:85776301-85776323 CACTTCTGTCCCTTATAAAAAGG - Intronic
1074183305 10:111081591-111081613 GGCTTATGGCCCTCATACTATGG + Intergenic
1076268887 10:129133248-129133270 CTCTTCTGTCGTTAATACTACGG + Intergenic
1076281991 10:129254182-129254204 CGCTTCTTCCCCTCAAACTTTGG - Intergenic
1077100943 11:822063-822085 CTCCTCTGTCCCTCATCCCACGG - Intronic
1080345901 11:31324644-31324666 CCCTTCTGTCACTCATTCCACGG + Intronic
1090237878 11:125163060-125163082 CGCTTCTGTACCACATAAAAAGG + Intergenic
1094608940 12:31974549-31974571 CGCTGGTGTCCCTCTTCCTATGG + Intronic
1101215823 12:102581192-102581214 CCCATCTGTCCCTCATTTTATGG - Intergenic
1105389585 13:19962219-19962241 CACTTCTGTACCTCAAACAAGGG - Intronic
1108144690 13:47464056-47464078 CGGTTCTGTCCCTGAGACTCTGG - Intergenic
1112758995 13:102672099-102672121 CAAGTCTGTCCCTCAGACTATGG + Intronic
1115960189 14:38827746-38827768 CCCTTGTTTCCCTCATCCTATGG - Intergenic
1119523923 14:75307384-75307406 CCCTGGTGTCCCTCATACTATGG - Intergenic
1123755975 15:23398070-23398092 TCCCTCTGTCCCTCATGCTAAGG + Intergenic
1132357836 15:101185911-101185933 CCCTGCTTTCCCTCATATTATGG + Intronic
1133911009 16:10066643-10066665 TGCTTCAGTCACTCATCCTAAGG - Intronic
1135266199 16:21027943-21027965 GGCTTTTGTCCCTCCTGCTATGG - Intronic
1144529031 17:16018316-16018338 TGCTTCTGTCCCACATGCTCTGG + Intronic
1144549245 17:16225031-16225053 CCTTTCTGTCTCTGATACTATGG + Intronic
1167884959 19:52492913-52492935 CGCTTCTGTCCCTAGGACTTTGG + Intronic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
927108132 2:19845039-19845061 AGCCTCTGTCCCTCACACCAGGG + Intergenic
935856362 2:107278961-107278983 CACCTTTGTCCCTAATACTAGGG - Intergenic
936863686 2:117053326-117053348 CTCTTCTTTCCCTCAGAGTAGGG + Intergenic
937962465 2:127470814-127470836 AGGTTTTGTCCCTCATGCTATGG + Intronic
938301727 2:130219254-130219276 CCCTTCTCTCACTCATACAATGG - Intergenic
938454973 2:131455197-131455219 CCCTTCTCTCACTCATACAATGG + Intergenic
942224171 2:173800557-173800579 CACTTCTGTCACTGAGACTAAGG - Intergenic
943995664 2:194762667-194762689 CCCTTCTCACCCTCATACTGGGG + Intergenic
1178666402 21:34550847-34550869 AGCTTCAGTCCCCCATACTAAGG + Intronic
1182576946 22:31279255-31279277 GGCTTCTGTTACTCATACTCGGG + Intronic
957157704 3:76566705-76566727 CCCTTCTTTCCCTCACTCTATGG - Intronic
960058326 3:113292891-113292913 CTCTTCTGTCCCTTTTATTAAGG - Intronic
963540774 3:146584682-146584704 AGCTTCTCTCCCCCATACTCTGG - Intronic
971775438 4:30957917-30957939 CTCTTGTCTCCCTCATACTGAGG - Intronic
972969407 4:44554261-44554283 GACTTCTGTCCCTAAGACTAAGG - Intergenic
977505251 4:97893920-97893942 CCTTTCTGTTCCTGATACTAGGG - Intronic
977828357 4:101559892-101559914 CTCTTCTGCCTCTCATACCAGGG - Intronic
983979179 4:173973259-173973281 CTGTTCTGTGCCTCATTCTATGG - Intergenic
984315471 4:178124707-178124729 TTCTTCTGTCCCTGATTCTAGGG - Intergenic
991422158 5:66452795-66452817 CTCTCCTGTCCTTAATACTATGG + Intergenic
995706175 5:114991246-114991268 CCCTTCCGTCCCTCATGGTATGG + Intergenic
998248276 5:140529926-140529948 TTTTTCTGTCCCTCATAGTAAGG + Intronic
1003568658 6:7241541-7241563 GGCTTCTATTCCTCAGACTAGGG + Intronic
1004473010 6:15945945-15945967 ACCTTCTGTCCCTCTTCCTATGG - Intergenic
1007032777 6:38643233-38643255 AGCTTCTGTCCTAGATACTATGG + Intergenic
1016397915 6:143646414-143646436 CAGGTCTGTCACTCATACTATGG - Intronic
1029251168 7:99237603-99237625 CTCATATGTTCCTCATACTAAGG - Intergenic
1031748277 7:125535022-125535044 GGCGTCTGTTCCTCATACTTTGG + Intergenic
1032297228 7:130650620-130650642 CTTTTCTGTCCCTAATACTTGGG + Intronic
1033351894 7:140568673-140568695 CGCTTCTGTCCCTCATACTAAGG + Intronic
1033766973 7:144504732-144504754 TGATTCTATCCCTCAAACTATGG - Intronic
1042331200 8:67582491-67582513 CTCTTCAGTCACTCACACTATGG - Intronic
1051731536 9:20148415-20148437 CGCTTCTGTACCTTTGACTATGG + Intergenic
1053180042 9:35960964-35960986 CGCTTCTCTCCCTCCTCTTATGG - Intergenic
1058336429 9:103835052-103835074 GGTCTCTGTCCATCATACTAAGG + Intergenic
1186958160 X:14705515-14705537 TGCTTCTGTCCCTTAGATTAGGG - Intronic
1188800525 X:34524373-34524395 CCCTTCTGCACCTCATTCTACGG + Intergenic
1195066816 X:101244820-101244842 CGCTTCTCTCCCTGATGTTAGGG - Intronic