ID: 1033356970

View in Genome Browser
Species Human (GRCh38)
Location 7:140607814-140607836
Sequence CTGCTGGCTCATATGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033356970_1033356973 -7 Left 1033356970 7:140607814-140607836 CCTTGTTCCATATGAGCCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1033356973 7:140607830-140607852 CCAGCAGCTCTCTTCCAAGCTGG 0: 1
1: 0
2: 1
3: 24
4: 277
1033356970_1033356975 9 Left 1033356970 7:140607814-140607836 CCTTGTTCCATATGAGCCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1033356975 7:140607846-140607868 AAGCTGGCTTCCCCTTTCACTGG 0: 1
1: 0
2: 2
3: 67
4: 238
1033356970_1033356981 29 Left 1033356970 7:140607814-140607836 CCTTGTTCCATATGAGCCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1033356981 7:140607866-140607888 TGGCACTAGGACAAGGTGCCAGG 0: 1
1: 0
2: 2
3: 8
4: 133
1033356970_1033356980 22 Left 1033356970 7:140607814-140607836 CCTTGTTCCATATGAGCCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1033356980 7:140607859-140607881 CTTTCACTGGCACTAGGACAAGG 0: 1
1: 0
2: 0
3: 7
4: 132
1033356970_1033356976 16 Left 1033356970 7:140607814-140607836 CCTTGTTCCATATGAGCCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1033356976 7:140607853-140607875 CTTCCCCTTTCACTGGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033356970 Original CRISPR CTGCTGGCTCATATGGAACA AGG (reversed) Intronic
902840329 1:19070241-19070263 CTGGTGGCTCAGATGCAATAGGG - Intergenic
907108466 1:51905367-51905389 CTGCTAGCTCATATAGCACCTGG + Intergenic
907464428 1:54625305-54625327 CTGCTGGCTGGAATGGAGCAGGG + Intronic
911237536 1:95427421-95427443 CTGTTGGCTAATATGTAAAATGG + Intergenic
911450112 1:98051554-98051576 TTGCTGGATCTTATGGAATAAGG - Intergenic
913402706 1:118454262-118454284 CTGATGTCTCATCTGAAACAAGG + Intergenic
913495605 1:119425572-119425594 CTGCTGTCTTATACAGAACAGGG - Intergenic
915037843 1:152943605-152943627 CTGAGGGGTGATATGGAACAAGG - Intergenic
915667695 1:157459778-157459800 CTTCTGGGTCATATGGTCCAAGG + Intergenic
916128650 1:161592755-161592777 CAGCTGTCTCATGTGGAAAATGG + Intronic
917074396 1:171188849-171188871 CTAGTGGCACATATGGACCATGG + Intronic
920381736 1:205538627-205538649 CTGCTGGCTCCTCAGGAACCTGG - Intergenic
922365231 1:224857124-224857146 TTACTGGTTCATATGGAACTTGG - Intergenic
922985183 1:229860804-229860826 CAGTTGGCTCATCTGGAAAATGG - Intergenic
1063264879 10:4436466-4436488 GTGCTGGCTCAGATGGCATAAGG - Intergenic
1063609857 10:7553216-7553238 CTGCTGGCTCATGTCGACCAGGG - Intergenic
1064511320 10:16095886-16095908 TTGCTGGGTCATATGGTAAAAGG - Intergenic
1067577747 10:47418868-47418890 CTGCTGGCCCAAATGGAGGATGG + Intergenic
1070742478 10:78912082-78912104 CTGGTGGCTCCTTTGGAGCAAGG + Intergenic
1073075884 10:100825774-100825796 CTGCTGGGTCTTATGGACTAGGG + Intronic
1075378363 10:121997760-121997782 CTGCTGGCTAATAGGGGAGAGGG + Intronic
1075507490 10:123037236-123037258 CTGCTTGGTCATACAGAACAGGG - Intronic
1076123260 10:127953211-127953233 CTGCTGGGTCATATGGCCCAAGG - Intronic
1076142168 10:128088227-128088249 CTGCTGGTCCATATGCAAGAGGG - Intergenic
1078467178 11:11559027-11559049 CTGCTTCCTCATTTGGAAAATGG + Intronic
1079329464 11:19521736-19521758 CTGCTTCCTCATCTGGAAAATGG - Intronic
1081406657 11:42706627-42706649 TTGCTGGATCATAAGGCACAAGG + Intergenic
1081665638 11:44915562-44915584 CTGCTGGCACATCTGGATGAGGG - Intronic
1089863710 11:121613306-121613328 CTGCTGGTACATACGTAACAGGG - Intronic
1090471442 11:126984759-126984781 CTGCGGGCTCACATGGAGCTTGG - Intronic
1093798567 12:23343761-23343783 CTGCTTCCTCACATGGAAGAAGG - Intergenic
1094311128 12:29084990-29085012 CTGCTGGCACAAATGCAAAATGG + Intergenic
1095739420 12:45590960-45590982 CTGCTGGCTGGTCTGGAACTCGG + Intergenic
1098816590 12:75172819-75172841 CAGCTGGCACATGGGGAACAAGG - Intronic
1099604174 12:84780730-84780752 TTGCTGTCTCAGATGGAACATGG + Intergenic
1104663426 12:130629189-130629211 CTGCTGGTTCATATGGATGCAGG - Intronic
1107959527 13:45545814-45545836 TTGCTGGCTGAGATTGAACAAGG - Intronic
1108532695 13:51342368-51342390 CTGCTCGCTCATATATAAAATGG + Intronic
1112928150 13:104702846-104702868 CTGATTGCTCATCTGGAAAATGG - Intergenic
1115801955 14:37004670-37004692 CTGAGGGCTCCTCTGGAACAGGG + Intronic
1121604929 14:95233739-95233761 CTGCTGGCAGAATTGGAACAAGG + Intronic
1121737557 14:96228948-96228970 CTGCTTTCCCATCTGGAACATGG + Intronic
1124509579 15:30311925-30311947 CTGATGGCTCATGTGGCTCAAGG - Intergenic
1124733981 15:32226737-32226759 CTGATGGCTCATGTGGCTCAAGG + Intergenic
1125088505 15:35761064-35761086 TTGCTGGCACATATGCTACAGGG + Intergenic
1127071537 15:55291635-55291657 CTAATGGCTGATATGGCACAGGG + Intronic
1127271980 15:57409688-57409710 CTCCTGACTTACATGGAACATGG - Intronic
1129509117 15:76107489-76107511 CAGTTTGCTCATATGGAAAATGG - Intronic
1131064279 15:89423612-89423634 CTGGTTCCTCATCTGGAACAGGG - Intergenic
1133182291 16:4066050-4066072 CTGCTGCCTCTTAAGGAACAGGG + Intronic
1137652832 16:50135100-50135122 CTGCTGGATCATATGGCCCAAGG + Intergenic
1139134603 16:64186896-64186918 CTGCTGGATCATATGGCCCAAGG - Intergenic
1140231328 16:73119592-73119614 CTGTTGGCTCACATGGAACATGG - Intergenic
1140522001 16:75589680-75589702 CTACTGGCTCATATGAATGAGGG + Intergenic
1141305068 16:82855157-82855179 CTGCTGACTCTTAGGGAAGAGGG - Intronic
1141748233 16:85940544-85940566 CTGCTTCCTCATCTGTAACATGG - Intergenic
1141758476 16:86010977-86010999 CTGTTGGCTCCTATGTAAGATGG + Intergenic
1141810947 16:86375260-86375282 ATGCTGGCTCATGTGGGAGATGG + Intergenic
1142782457 17:2191753-2191775 CTTCTTGCTCCTATGTAACAGGG + Intronic
1143058314 17:4179048-4179070 CTTCTGCATCCTATGGAACAAGG + Exonic
1144646270 17:16976006-16976028 CTGCTGGCTTATACAGATCAAGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1149333267 17:55608225-55608247 CAGTTGCCTCATATGGAAAAAGG + Intergenic
1149435963 17:56633794-56633816 CTTCTGGCATACATGGAACAAGG - Intergenic
1149991801 17:61387651-61387673 CTGTTGGCTCATATTGGAAATGG - Intronic
1153800228 18:8662264-8662286 CTGCAGGCTCTTCGGGAACATGG - Intergenic
1154317272 18:13314617-13314639 TTGCTGGCTCATAAGGGGCATGG + Intronic
1156028230 18:32681937-32681959 CAGATTGCTCATCTGGAACATGG + Intronic
1156711329 18:39950000-39950022 CTGTTGTCTCTTATGCAACAGGG - Intergenic
1159277119 18:66235362-66235384 CTGCTGGATCATATGGCCCAAGG - Intergenic
1160603211 18:80030304-80030326 CTGCTGTCTAATAAAGAACAGGG + Intronic
1164758192 19:30706631-30706653 CTGCTGGCCTATTTGGATCATGG + Intronic
1166467405 19:43044505-43044527 CTGGTTGCTGACATGGAACAGGG - Intronic
1166473539 19:43100586-43100608 CTGGTTGCTGACATGGAACAGGG - Intronic
1168318833 19:55496611-55496633 GTGCTGCCTCATCTGTAACATGG - Intronic
926390913 2:12391882-12391904 CTGCAGGCTCATATATAAAATGG - Intergenic
926408922 2:12581683-12581705 CTGCTGGGTCATATGGCCCAAGG - Intergenic
927623067 2:24682547-24682569 CTGCTGGAGTATATGGTACAAGG - Intronic
927864770 2:26581409-26581431 CTGCGGGCTCACATGGCTCACGG - Intronic
929247327 2:39717093-39717115 CTGCCTGCTGATGTGGAACATGG + Exonic
931249362 2:60516327-60516349 CTGCTGGCTCACAGGGAATCTGG + Intronic
932458737 2:71867630-71867652 CTGCTGGATCATCTGGTACATGG + Intergenic
932853572 2:75211716-75211738 TAGCTGGATCATTTGGAACAAGG - Intergenic
934752354 2:96801121-96801143 CTGCTGGCTCACAGGTAACGTGG + Intronic
937829931 2:126408524-126408546 CTGCTGGCAGATCTGGAATACGG + Intergenic
938989539 2:136613752-136613774 CTGCTGGCTCCTGTGCAGCAAGG + Intergenic
939008860 2:136821505-136821527 CTGGTGGCTGAGTTGGAACAGGG + Intronic
941001089 2:160204657-160204679 CTGCTGGCTAATTTGTACCAAGG + Intronic
942801949 2:179885660-179885682 CTGTTTGTTTATATGGAACATGG - Intergenic
944080665 2:195784624-195784646 TTGCTGGATCATATGGTAAAAGG + Intronic
946913864 2:224495238-224495260 CTGCTGGCAAATAAGGAAAATGG + Intronic
947274188 2:228372256-228372278 CTGTTAGCTTATATGGTACATGG - Intergenic
947677595 2:231997453-231997475 GTTTTGGCTCATATGAAACAGGG + Intronic
947946087 2:234103554-234103576 CTGCTGGGGCCTATGGACCAGGG - Intergenic
947981584 2:234414973-234414995 ATGCTGGTTCAAATGGAGCAAGG - Intergenic
1169427681 20:5509500-5509522 CTGCTGGGTCATTTTGAAGATGG - Intergenic
1173247283 20:41345376-41345398 CTGCTGGCTCATCTGTAAACAGG + Intronic
1177805187 21:25868404-25868426 CTCCTGGCTCATTTGAAACATGG - Intergenic
1178500972 21:33125164-33125186 CTGCTGGCTCTGGGGGAACAGGG - Intergenic
1179838436 21:44053744-44053766 CTGGAGGCACATGTGGAACAAGG - Intronic
1180659895 22:17457635-17457657 CCGCTGGGTCATATGGTAAATGG - Intronic
1181559348 22:23691030-23691052 CGGTTGGCTCCTCTGGAACAGGG + Exonic
1181783897 22:25211983-25212005 CTGTTGCCTCATCTGTAACATGG + Intergenic
949751303 3:7355401-7355423 CTGGTGAATCATATGGACCAAGG - Intronic
949905853 3:8857897-8857919 CTGCTGGGTCATGTGGCGCAAGG - Intronic
950823373 3:15787505-15787527 CAGCTGGCTTGTATGGAACGTGG - Intronic
951814389 3:26737194-26737216 CTTCTGGATAATATGGAACTTGG - Intergenic
953902198 3:46849730-46849752 CTGCTTGCTTAAATGCAACAGGG - Intergenic
955000311 3:54921283-54921305 CTGCTTGCTCATCTGGAAAGTGG + Intronic
958856687 3:99393973-99393995 CTGCAGGCCCAAAGGGAACACGG + Intergenic
960250044 3:115441599-115441621 CAGATTTCTCATATGGAACAAGG - Intergenic
962848795 3:139292411-139292433 CTGCTGACTCATCTGTAAAATGG + Intronic
963043738 3:141087611-141087633 CTGTTTGCTCATCTGGAAAATGG - Intronic
963124527 3:141802878-141802900 CTGCTGGTTCATCAGGCACAAGG - Intronic
969282906 4:6183176-6183198 CTGATGTCTAAAATGGAACAGGG + Intronic
974269527 4:59632846-59632868 CTGATGTCTCATCTGAAACAAGG + Intergenic
975395864 4:73872541-73872563 GCTCTGGCTAATATGGAACAGGG + Intergenic
977091097 4:92676568-92676590 CTGTTGATTCATATGGAGCATGG + Intronic
977883395 4:102232755-102232777 CTGCTTGCTAATGTGTAACAGGG + Intergenic
982597798 4:157407192-157407214 CTGCTGGGTCATGTGGCCCAAGG + Intergenic
982866034 4:160512946-160512968 CTTCTGGATCATATGGCTCAAGG + Intergenic
983962335 4:173769913-173769935 CTTCTGGCCAATATGGCACAGGG + Intergenic
984056921 4:174941864-174941886 TTGCAGGCTCATATGCAAAAGGG - Intronic
984445446 4:179830433-179830455 CTGCTGGGTCATATGGTCCAAGG - Intergenic
984921480 4:184768011-184768033 CTGCTTCCTCATGTGTAACACGG - Intronic
986198668 5:5561287-5561309 CTGATGGCTCAGCTGGAACCAGG + Intergenic
987908674 5:24113129-24113151 CTGCTGGCACTTCTGGAACCTGG + Intronic
988631966 5:32941144-32941166 GTGCTGGGACACATGGAACATGG + Intergenic
995954260 5:117755765-117755787 CAGCTGGTGGATATGGAACAAGG + Intergenic
999238133 5:150112266-150112288 CTGGTGTCTCATCTGTAACATGG + Intronic
1001085759 5:168699108-168699130 CTGCTGGCTCACATAGAGCAGGG - Intronic
1001173567 5:169444482-169444504 CTGCTGGGTCATATGGCCCAAGG - Intergenic
1004510459 6:16280086-16280108 GTGCTGGCTCACCTGGAAGATGG + Intronic
1006994151 6:38242468-38242490 CTGCTGTCTCATCTGTAAAATGG + Intronic
1007421556 6:41722927-41722949 CTGCTTCCTCATCTGTAACATGG - Intronic
1009856069 6:69265458-69265480 CAGCTTCCCCATATGGAACATGG - Intronic
1014539809 6:122661795-122661817 CTGCTGGCTGAAATGTAAAATGG - Intronic
1015282731 6:131451237-131451259 CTCCAGGATCTTATGGAACAAGG + Intergenic
1017733703 6:157340840-157340862 TTGCTGCCTGATGTGGAACATGG - Intergenic
1017948234 6:159114090-159114112 CTGCTGGGTCATATGGTAATAGG - Intergenic
1019535220 7:1525728-1525750 CTGCTTGTTCATATGTAAAAGGG - Intergenic
1023603439 7:41904157-41904179 CTGCTAGATCATATGTTACATGG - Intergenic
1026351354 7:69518146-69518168 CTGCCTGCTTATATGTAACAAGG - Intergenic
1030349949 7:108473441-108473463 TTGCTGGTTCATATGGTAAAGGG + Intronic
1031788819 7:126072956-126072978 CTGTGAGCTCATATGGCACAAGG + Intergenic
1032071861 7:128812760-128812782 CTCCTGGCTTATCTGGTACATGG - Exonic
1033356970 7:140607814-140607836 CTGCTGGCTCATATGGAACAAGG - Intronic
1037421442 8:18707595-18707617 TTGCTGTCTCATCTGGAACATGG - Intronic
1038611498 8:29063602-29063624 CTTTTGGCTCATATGCAACAAGG - Intronic
1038689122 8:29745246-29745268 CTGCTGGCTCTTACCAAACATGG - Intergenic
1039373662 8:37012198-37012220 CTGCTGGCTCCTAAGGATCTGGG + Intergenic
1039579430 8:38651580-38651602 CTCCTGGCTCATTTGGAACCAGG - Intergenic
1039614806 8:38946878-38946900 CTCCTGGCTTATATAGATCATGG + Intronic
1041020303 8:53632054-53632076 CTGCAGGCTTATATGCAAAAAGG + Intergenic
1043194409 8:77273655-77273677 CTTCTGGCCAATATGGAATATGG - Intergenic
1047413217 8:124641177-124641199 CTGATGGGTCAAATGGACCAGGG + Intronic
1048561085 8:135538221-135538243 CTGCTGGTTCAGATTGAAGATGG + Intronic
1051605118 9:18910858-18910880 CTGCTGGCTAATGTGGAAGGAGG + Exonic
1051741682 9:20258513-20258535 CTGCTGTCTCTTCTGGAACCAGG + Intergenic
1055223465 9:73966245-73966267 CTGCTGGATCATATGGCCCAAGG - Intergenic
1055288273 9:74754573-74754595 CTGCTTGTTCATATGGTAAATGG - Intronic
1056514371 9:87336124-87336146 CTTCTAGCCCAGATGGAACATGG + Intergenic
1057004959 9:91548978-91549000 CTGCTGGGTCATATGGCCCAAGG + Intergenic
1061241477 9:129376532-129376554 CTGCTGTCTTATTTGGAAAAAGG + Intergenic
1186670810 X:11765454-11765476 CTCCTGGCTCCTAGGGAAGATGG - Exonic
1187729423 X:22237942-22237964 CTGCTGACTCATGTTGGACATGG - Intronic
1192442431 X:71184603-71184625 CAGCTGGCTCATCTGCAAAATGG - Intergenic
1193640881 X:84008548-84008570 CTGCTTTCTCGTAAGGAACAGGG + Intergenic
1195461388 X:105129516-105129538 CTGCTGACTCTTAGGCAACATGG + Intronic
1195475172 X:105277166-105277188 CTGCCTGCTCATAGTGAACATGG - Intronic
1197841627 X:130753885-130753907 CTGCTGGATCATATGGAAAGGGG + Intronic
1200060397 X:153481317-153481339 CTGCTGGGTCACAAGCAACAGGG - Intronic