ID: 1033357332

View in Genome Browser
Species Human (GRCh38)
Location 7:140610841-140610863
Sequence CAGGATTCTAAAGGAGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033357332_1033357341 21 Left 1033357332 7:140610841-140610863 CCGGCAGCTCCTTTAGAATCCTG 0: 1
1: 0
2: 1
3: 18
4: 158
Right 1033357341 7:140610885-140610907 CTTTCTTCTGCTGCCATTTTTGG 0: 1
1: 1
2: 6
3: 47
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033357332 Original CRISPR CAGGATTCTAAAGGAGCTGC CGG (reversed) Intronic
901541818 1:9922835-9922857 CAGCATGCTAAAGGGGCTGCAGG + Intronic
901692482 1:10982444-10982466 CAGAGTTCAAAAGGAGCTGAGGG + Intergenic
902882566 1:19382430-19382452 CAGGTTTCAAACGGTGCTGCTGG + Intronic
904112766 1:28139607-28139629 CAGGTTTCTAAAGAAAATGCAGG + Intergenic
904788254 1:32998595-32998617 AAGGATGCCCAAGGAGCTGCAGG - Intergenic
906778185 1:48548659-48548681 GAGGGTTCTAGAAGAGCTGCAGG - Intronic
907554070 1:55329392-55329414 CAGGATGCTAATGAACCTGCAGG - Intergenic
909263034 1:73519550-73519572 CAGGATTCTTAAGGCAGTGCAGG - Intergenic
917520087 1:175741052-175741074 CAGAAGTCTCAAGGTGCTGCTGG - Intronic
917856796 1:179107794-179107816 CAGGTTTCTTCAGCAGCTGCTGG - Exonic
923954793 1:239004307-239004329 AATGATTCAAAAGAAGCTGCTGG + Intergenic
924274528 1:242372134-242372156 TAGGAATATACAGGAGCTGCAGG - Intronic
924324038 1:242877523-242877545 CAAGAATCTGAATGAGCTGCAGG - Intergenic
924479271 1:244413045-244413067 CTGTATTCTAAAAGATCTGCAGG + Intronic
1062845167 10:697773-697795 GAGGATGCTAGAGGGGCTGCAGG - Intergenic
1064222810 10:13455981-13456003 CCGTGTCCTAAAGGAGCTGCAGG - Intronic
1064418934 10:15173531-15173553 TATGATTCTTCAGGAGCTGCTGG - Intergenic
1067101308 10:43336716-43336738 CCAAATTCTAAAGAAGCTGCAGG - Intergenic
1067282591 10:44883629-44883651 CAGGAGGCTAATGGAGCTTCAGG - Intergenic
1071324586 10:84500038-84500060 CAGGATAGAAAAGGAGGTGCTGG - Intronic
1073353345 10:102835200-102835222 CTGGATCCCACAGGAGCTGCTGG - Intronic
1073543388 10:104329944-104329966 CAGGCTTCTGGAGGAGCTGCAGG - Intronic
1074405197 10:113175525-113175547 CTGGATTCTAAAGGTAGTGCTGG + Intergenic
1075737769 10:124674588-124674610 CAGGCTTCTGAAGGAGAAGCAGG - Intronic
1076166498 10:128286690-128286712 CAGGACTCGGGAGGAGCTGCAGG - Intergenic
1078398987 11:11007685-11007707 CTGGATTCTGAAGGTGCTGCAGG - Intergenic
1081779576 11:45700631-45700653 AAGGAGTTTAAAGGAGCTCCAGG + Intergenic
1082871252 11:57945252-57945274 CTGGAGTCTGAAGGAGCAGCGGG - Intergenic
1083150759 11:60790497-60790519 CAGCCTTCTTAAGGAGCTGGGGG + Exonic
1084461501 11:69298987-69299009 CAGGATTCTATAGGAGCTGAGGG + Intronic
1084915467 11:72425913-72425935 CAGGAAACTACAGGGGCTGCAGG - Intronic
1089054566 11:115575114-115575136 CATGGTTCTAAAGGAGCCACAGG + Intergenic
1091139187 11:133220776-133220798 CTGGACTCCAAAGGAGCTTCGGG + Intronic
1091214929 11:133895089-133895111 CGGCATTCTACAGGAGCAGCTGG - Intergenic
1091626124 12:2122220-2122242 AAGAATTCTAAAGGAGGTGGTGG + Intronic
1092778850 12:11966829-11966851 CAGGTGTCTCAATGAGCTGCTGG - Intergenic
1093982735 12:25492784-25492806 CTGGATTCCAAAGGAGAAGCTGG + Intronic
1099018241 12:77371300-77371322 CAGGAATATAAAGGAGGTGGGGG + Intergenic
1099661935 12:85575344-85575366 CAGTATTCAAATGGTGCTGCTGG + Intergenic
1102955089 12:117053950-117053972 CAGGATTTAAAAGGAGGTGAGGG + Intronic
1104003249 12:124873879-124873901 CAGGCTTCTACCGCAGCTGCTGG - Intronic
1104648140 12:130511586-130511608 AAGCATTCTTAAGGAGGTGCAGG - Intronic
1106809862 13:33349585-33349607 AAGGATTCTTAAGGACCTCCTGG + Intronic
1107611073 13:42113588-42113610 CTGGAGTCAAAAGGAGCTGATGG + Intronic
1107655695 13:42590294-42590316 TAGGATTCTTAAGGGGCTGGAGG + Intronic
1107711825 13:43158163-43158185 CAGGATCCCAAAGGAACTGGCGG + Intergenic
1114799498 14:25757322-25757344 CAGAATTCTGTAGGAGGTGCAGG - Intergenic
1117065574 14:52010496-52010518 CTGGTTTCTAAATGTGCTGCTGG + Exonic
1117878591 14:60282950-60282972 CAGGATTTTAAAGGGTCTGCAGG + Exonic
1119433467 14:74583324-74583346 CAGGTTTCTCAAGCAGTTGCTGG - Intronic
1120198020 14:81507501-81507523 CAGAATTCTAAAGGAGGAGTAGG + Intronic
1121986309 14:98509905-98509927 CAGGATTCTAAAGGAACTCACGG - Intergenic
1122659005 14:103281957-103281979 CAGGAGTTCAAAGGAGCAGCTGG - Intergenic
1124994967 15:34714661-34714683 CAGGATTCCACAGCAACTGCAGG - Intergenic
1125833513 15:42732110-42732132 CAGCAGGCTAGAGGAGCTGCAGG + Intronic
1129034029 15:72639145-72639167 CCAGGTACTAAAGGAGCTGCTGG + Intergenic
1129215853 15:74098071-74098093 CCAGGTACTAAAGGAGCTGCTGG - Intergenic
1129267948 15:74404055-74404077 CTGGATTGTGGAGGAGCTGCCGG + Intergenic
1129408952 15:75338384-75338406 CCAGGTACTAAAGGAGCTGCTGG + Exonic
1129732992 15:77942402-77942424 CCAGGTACTAAAGGAGCTGCTGG - Intergenic
1129824152 15:78623690-78623712 CAGGACTCTAAAGGAATAGCAGG + Intergenic
1131097531 15:89665951-89665973 CAGGACTCTAAGGCGGCTGCCGG - Intronic
1133444668 16:5849744-5849766 CAAGATCATACAGGAGCTGCAGG - Intergenic
1134914742 16:18060220-18060242 CTGGAATCTCAAGGACCTGCTGG - Intergenic
1141089450 16:81120262-81120284 CAGCTTTCTGAAGCAGCTGCAGG + Intergenic
1142177926 16:88653389-88653411 CAGGTTTCTGAAGGGGCTGCAGG - Exonic
1142344297 16:89544382-89544404 CAGGATGCTGTAGGAGCTCCCGG + Intronic
1144672585 17:17141326-17141348 CAGGAAGCTAAGGAAGCTGCTGG - Intronic
1145365896 17:22266616-22266638 AAGGATCCAAAAGGATCTGCAGG + Intergenic
1145413320 17:22692926-22692948 AAGGATCCAAAAGGAACTGCAGG + Intergenic
1146951459 17:36909505-36909527 CTGCATTCTAAAGGAGGGGCAGG + Intergenic
1146968224 17:37051110-37051132 CAGTCTTCCAAAGGAGCTGGCGG - Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1151419785 17:73989685-73989707 CAGGATTCCAAAGCAGGTGTCGG + Intergenic
1151957963 17:77389828-77389850 CCGGGTTCTAAACCAGCTGCTGG - Intronic
1151958242 17:77391356-77391378 CAGGAATCTCCAGGAGCCGCCGG - Intronic
1156072258 18:33226315-33226337 CTGGATTCCAAAGGATATGCAGG + Intronic
1156190180 18:34709895-34709917 AATGTTTCTAAAGGAGCTGTGGG + Intronic
1156914329 18:42447665-42447687 CAGCCTTTTAAAGCAGCTGCAGG - Intergenic
1158282835 18:55846275-55846297 CATGGTTCCAAAGTAGCTGCTGG - Intergenic
1159565757 18:70046758-70046780 CAGGCTTCTGAAGGCGCTGCTGG + Intronic
1165406166 19:35632672-35632694 CAGGGTTCTCAGGGAGCTCCTGG - Intronic
1165924605 19:39319752-39319774 CAGGATGCTGAATGTGCTGCAGG - Intergenic
925633495 2:5918596-5918618 CACGATTTTAAAGTATCTGCTGG + Intergenic
926245837 2:11121951-11121973 CAGGGTCCTAAAGGAGCAGCGGG - Intergenic
927090223 2:19704945-19704967 CAGAATTCTGGAGGAGCTGGTGG - Intergenic
927772054 2:25871408-25871430 CAGAATTCTACAAGAGATGCAGG + Intronic
928097258 2:28412344-28412366 CAGGATTCGGAGGGAGATGCGGG - Exonic
929145925 2:38707036-38707058 CGGGACTCTAGAGCAGCTGCTGG + Intronic
936314535 2:111413127-111413149 CAGGACTCTAAAGGAGACACTGG - Intergenic
938035164 2:128028671-128028693 CCGGATTATAAAGGAGCTGAAGG + Intergenic
940817897 2:158316716-158316738 CAGCATTCTAATGGAGATGCAGG - Intronic
945511386 2:210707102-210707124 GAGGATTCCAAAGGGGCTGGTGG - Intergenic
1171783478 20:29442437-29442459 GGGGATTCTAAAGGAGGTGTAGG + Intergenic
1172250278 20:33474693-33474715 CAGGATGCAAAAAGACCTGCTGG + Intergenic
1173835324 20:46121472-46121494 CAGGACTCCAGGGGAGCTGCTGG + Intronic
1173922909 20:46759266-46759288 CAGGAGGCTGCAGGAGCTGCAGG + Intergenic
1178855303 21:36245604-36245626 CAGGCTGCTAAAGCAGCAGCGGG + Exonic
1183936037 22:41262943-41262965 AAAGATTCCAAAGGACCTGCAGG + Intronic
950636675 3:14320358-14320380 CATGCTTCTGGAGGAGCTGCTGG - Intergenic
951544626 3:23811457-23811479 CAGAATTCAGAAGGAGCTGGCGG + Exonic
961458560 3:127036244-127036266 CTGGATTCTGAAGGTGATGCAGG - Exonic
961818942 3:129565459-129565481 CAGCATCATGAAGGAGCTGCTGG - Exonic
966730186 3:183144499-183144521 ATGGATGCTAAAGGAGCTGAGGG + Intronic
967275702 3:187772459-187772481 CAGGATTCCAGAGGAGATCCAGG + Intergenic
968571338 4:1343159-1343181 CACGGTTCTAGAGGAGATGCTGG + Intergenic
969841957 4:9889268-9889290 CAGGTTCCTTGAGGAGCTGCCGG + Intronic
971464647 4:26943385-26943407 CATGATTTTAAATGAGCTTCAGG + Intronic
975217241 4:71769891-71769913 CAGGACTTTAAAGGAGGTACAGG + Intronic
980994861 4:139770495-139770517 CAGGATCCTAAGGGAGTTGGTGG + Intronic
981076556 4:140598307-140598329 AAGCATTCTAAAGGGGGTGCAGG + Intergenic
982122542 4:152156827-152156849 TTGGACTCTAAAGGAGCTGCAGG - Intergenic
988466002 5:31493066-31493088 CTGTATTGTAAATGAGCTGCAGG - Intronic
990799767 5:59587514-59587536 GAGGATTCCAAAGGTTCTGCTGG - Intronic
994560991 5:101372147-101372169 CATCATTCTAAAGGACCTGGGGG - Intergenic
995092964 5:108201173-108201195 CATGATTCTAAAGGGGCTCCTGG - Intronic
996628548 5:125600214-125600236 TGATATTCTAAAGGAGCTGCAGG - Intergenic
996897360 5:128501008-128501030 AAGGATTCTCAGGGAGCAGCAGG + Intronic
997644337 5:135470919-135470941 CAGGATTCTGAATGAGATTCTGG + Intergenic
998002119 5:138633633-138633655 CAGGATCCTAAAGGAAGTGAAGG - Intronic
998166925 5:139849474-139849496 CAGACTTCTGAAGGAGCTGGTGG - Intronic
1000165133 5:158640905-158640927 CAGGATTCAAACAGATCTGCAGG - Intergenic
1000528540 5:162388937-162388959 CAGAATTCAAATGGAGCAGCTGG - Intergenic
1001763625 5:174227245-174227267 CAGGATTTTGCAGGGGCTGCCGG + Intronic
1002896468 6:1383004-1383026 CAGGGTTCTACAGGGGCTGAAGG - Intergenic
1003575702 6:7292500-7292522 GAGGACTGCAAAGGAGCTGCTGG - Intronic
1006406847 6:33850438-33850460 CAGGGTTCTATGAGAGCTGCAGG - Intergenic
1008122266 6:47632152-47632174 CAGGCTTCTTAAGGAGTTTCTGG + Intergenic
1011211947 6:84964832-84964854 AAGCATTCTAAAGGGGGTGCAGG + Intergenic
1011794707 6:90939798-90939820 CAGGATTCTTAAGAAGGGGCAGG - Intergenic
1012540059 6:100352132-100352154 AAGGATTTTAAAGGATTTGCAGG + Intergenic
1014407799 6:121072088-121072110 TAGGATTCTAAAGTAGATGTTGG + Intergenic
1018277636 6:162149873-162149895 CAGGATTCTAGAGGTGCAGCAGG + Intronic
1018867600 6:167758379-167758401 CAGGGGTCTGAAGGAGCTGCCGG - Intergenic
1019103281 6:169649492-169649514 CAGGATTTTAAAGGAGTCACAGG - Intronic
1019715913 7:2539277-2539299 CAGGGTCCTGGAGGAGCTGCAGG + Exonic
1022078355 7:26995821-26995843 CAGGTTTCTAAAGGCTCAGCAGG + Intergenic
1023133861 7:37031506-37031528 CTGGATTCTGAAAGACCTGCAGG - Intronic
1023462409 7:40413301-40413323 CAGTATTCTTGAGGAGATGCCGG - Intronic
1024053934 7:45647405-45647427 CAGCATTCGACAGGACCTGCAGG + Intronic
1030777316 7:113550708-113550730 CATGATTTTTAAAGAGCTGCCGG + Intergenic
1032448006 7:132001218-132001240 AAGGATTTCAAAGGAGCTGCAGG - Intergenic
1032508677 7:132454953-132454975 GAGGATGCTGAAGGAGCTGTGGG - Intronic
1033357332 7:140610841-140610863 CAGGATTCTAAAGGAGCTGCCGG - Intronic
1034576388 7:152002452-152002474 GAGAATTCTAAAGGAGCAGGTGG - Intronic
1034844777 7:154434365-154434387 CATGCTTCTAAAGGCCCTGCAGG - Intronic
1034931478 7:155167166-155167188 CAGGGTTCGGAAGGAGGTGCTGG - Intergenic
1035323731 7:158051387-158051409 CAAGACTCCCAAGGAGCTGCTGG + Intronic
1035390333 7:158500103-158500125 CAGGTGTCTAAAGGAGCAGAAGG - Intronic
1036749901 8:11436950-11436972 CAGGAATCTATAGCAACTGCAGG - Intronic
1038432925 8:27514420-27514442 CACGATCCTAAAGGAAATGCAGG - Intronic
1039770747 8:40684475-40684497 CAGTATCCTATAGGAGCTACAGG + Intronic
1041722865 8:60992049-60992071 CAGGAACCTAAAGAAGCAGCAGG - Intergenic
1041764483 8:61404077-61404099 GAGGATTCTTATGGAGCTGCTGG + Intronic
1042639251 8:70915148-70915170 CTGTATTCTAATGGACCTGCTGG - Intergenic
1043878047 8:85508828-85508850 CTGGGTTCTGAAGGAGCTGGTGG - Intergenic
1046996721 8:120531829-120531851 CTGGATTCCAGAGCAGCTGCTGG - Intronic
1052039203 9:23719159-23719181 CGGGATTCTCAAGGTGCTTCTGG - Intronic
1053303900 9:36970458-36970480 CAGGAGTCTTGAGGAGCTACGGG + Intronic
1056112084 9:83406114-83406136 CAGCATTGCTAAGGAGCTGCAGG + Intronic
1058052276 9:100418968-100418990 AGGGAAGCTAAAGGAGCTGCAGG + Intergenic
1058115598 9:101081019-101081041 CAGAATTCTAAATCAGCAGCAGG - Intronic
1061254812 9:129448673-129448695 CAGGTTTCCAAAGGAACTACTGG - Intergenic
1061836386 9:133332664-133332686 GAGGAAGCGAAAGGAGCTGCGGG - Exonic
1187025145 X:15427229-15427251 AAGGATTTTAAAGGGGCTTCTGG + Intronic
1187812973 X:23200478-23200500 CGGAATACTAAAGGAACTGCAGG + Intergenic
1188848236 X:35100547-35100569 CAGGATTTTAAAGCAGCTTCGGG - Intergenic
1189202919 X:39213158-39213180 CAGGTTCCTACAGGTGCTGCTGG - Intergenic
1198746919 X:139900508-139900530 CAGGATTCTATAGTAACTGTTGG - Intronic
1199744380 X:150762576-150762598 CCAGAATCTCAAGGAGCTGCTGG + Exonic
1200699812 Y:6392501-6392523 AAGGATCCAAAAGGAACTGCAGG - Intergenic
1200705678 Y:6440603-6440625 AAGGATGCAAAAGGATCTGCAGG - Intergenic
1200913533 Y:8551551-8551573 AAGGATCCAAAAGGATCTGCAGG + Intergenic
1200917746 Y:8586142-8586164 AAGGATTCAAAAGGATCTGCAGG + Intergenic
1200937200 Y:8748746-8748768 AAGGATCCAAAAGGATCTGCAGG - Intergenic
1201028433 Y:9724105-9724127 AAGGATGCAAAAGGATCTGCAGG + Intergenic
1201034299 Y:9772197-9772219 AAGGATCCAAAAGGAACTGCAGG + Intergenic
1202135895 Y:21660915-21660937 CAGGATAAAAAAAGAGCTGCAGG + Intergenic