ID: 1033358113

View in Genome Browser
Species Human (GRCh38)
Location 7:140617301-140617323
Sequence TTGATATTGAAGGCCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033358113_1033358119 1 Left 1033358113 7:140617301-140617323 CCCTCCATGGCCTTCAATATCAA 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1033358119 7:140617325-140617347 GCTCCCCCGTACTCTAAAGGAGG No data
1033358113_1033358124 8 Left 1033358113 7:140617301-140617323 CCCTCCATGGCCTTCAATATCAA 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1033358124 7:140617332-140617354 CGTACTCTAAAGGAGGCCTCAGG No data
1033358113_1033358118 -2 Left 1033358113 7:140617301-140617323 CCCTCCATGGCCTTCAATATCAA 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1033358118 7:140617322-140617344 AAGGCTCCCCCGTACTCTAAAGG No data
1033358113_1033358127 25 Left 1033358113 7:140617301-140617323 CCCTCCATGGCCTTCAATATCAA 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1033358127 7:140617349-140617371 CTCAGGACCAGGAGCATCAACGG 0: 1
1: 0
2: 5
3: 33
4: 247
1033358113_1033358125 14 Left 1033358113 7:140617301-140617323 CCCTCCATGGCCTTCAATATCAA 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1033358125 7:140617338-140617360 CTAAAGGAGGCCTCAGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033358113 Original CRISPR TTGATATTGAAGGCCATGGA GGG (reversed) Intronic
901372905 1:8815942-8815964 TTGATTTTGATGGCCTGGGATGG - Intronic
903112913 1:21152484-21152506 TTCATGTTGAAGGCCCTGTAAGG - Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
906445567 1:45894567-45894589 TTAATATTGTAGGTAATGGATGG + Intronic
907172044 1:52477279-52477301 TAAATAATGAAGGCCATGCACGG + Intronic
908978044 1:69921782-69921804 TTTAGCTTGAAGGCAATGGAAGG - Intronic
909469638 1:76012550-76012572 TTGATATTTAAGGCCACGTAAGG - Intergenic
914416246 1:147485261-147485283 ATGATAGTGAAGGCCAAGCAAGG - Intergenic
915017057 1:152744044-152744066 CTGACTTTGAAGGGCATGGAGGG + Intronic
920818610 1:209359100-209359122 TTGATATTGAAAGCCTTAAAAGG - Intergenic
920926828 1:210349309-210349331 AAGCTATTGAAGGCCGTGGAGGG + Intronic
921251071 1:213298885-213298907 ATGATATTGTAAGCCATGAAGGG - Intergenic
921431365 1:215069816-215069838 GGGATAATGAAGGTCATGGAGGG + Intronic
922218416 1:223539540-223539562 TTGATTCTGAAGGCTAGGGAGGG + Intronic
924488562 1:244512892-244512914 TTGTTATTGAAGGCTATGGTGGG + Intronic
1063172258 10:3519584-3519606 CTGATATTTATGGACATGGATGG - Intergenic
1065724810 10:28659029-28659051 TTGAGAAAGAAAGCCATGGAAGG + Intergenic
1068147513 10:53090085-53090107 TTGATGTTGAAGAACATTGATGG + Intergenic
1069646304 10:70000755-70000777 TAGAAATTGAAGGCCAGGCATGG - Intergenic
1070037261 10:72738738-72738760 TTGGTATTGAAAGCCCTTGATGG + Intronic
1073090313 10:100932008-100932030 TTTATATGGGAGGGCATGGATGG + Intronic
1074100672 10:110352558-110352580 GTGATTTTGAAGTCCAGGGAGGG + Intergenic
1074406218 10:113182095-113182117 TTGATCCTGAAGGCCATGCTGGG - Intergenic
1075674614 10:124287773-124287795 TTGACATTGAAGGGCTTGGTGGG - Intergenic
1078080003 11:8197274-8197296 TTGATAGAGAAGGGCATGAAAGG - Intergenic
1080717297 11:34816627-34816649 TTGAGATTGAAGGGCAAGAAGGG - Intergenic
1081617550 11:44599751-44599773 TTGATGTTCAAGTCCACGGAGGG + Intronic
1083416556 11:62529515-62529537 TTGATATTGAAGGTCCAGAAGGG - Exonic
1083861140 11:65420850-65420872 TCGCTTTTGAAGGCCATGGTGGG - Intergenic
1086354205 11:85976276-85976298 CTGATATTGTAGGGCATGGGAGG - Intronic
1088152052 11:106757504-106757526 TTGATATTGGTGACTATGGATGG + Intronic
1089399943 11:118158642-118158664 TTGAACTTGAAGGGCATTGAAGG - Intergenic
1089831320 11:121330748-121330770 TTTATCTTGAAGGCCATGTATGG - Intergenic
1089981320 11:122774995-122775017 TTGATGTTAAGTGCCATGGAGGG - Intronic
1094372039 12:29749596-29749618 TTTTTGTTGAGGGCCATGGAGGG - Intronic
1100467143 12:94856153-94856175 TTGATCTTGTGGGCAATGGAAGG + Intergenic
1100520941 12:95375184-95375206 TTGATACTGTAGGCAAAGGAGGG - Intergenic
1102129346 12:110513412-110513434 TTGATATAGAAAGCCACTGATGG - Intronic
1102170735 12:110840612-110840634 TTTATTTTGAATGCCATGGGTGG + Intergenic
1102538366 12:113599425-113599447 TTGCAATAGGAGGCCATGGATGG + Intergenic
1104123265 12:125819435-125819457 ATGATATGAGAGGCCATGGAGGG + Intergenic
1105607607 13:21939734-21939756 TACATAATGAAGCCCATGGAAGG + Intergenic
1110185059 13:72664367-72664389 TTGATATGGAGGGTAATGGAGGG - Intergenic
1111992854 13:95134041-95134063 TTGAAATTGTAGCGCATGGAAGG - Intronic
1112525515 13:100143011-100143033 TTGGAATTGAAGCCCATGTAAGG - Intronic
1115783547 14:36798731-36798753 TTGATATAGAAGGAGATGAAGGG - Intronic
1116249619 14:42464268-42464290 CTAAGATTCAAGGCCATGGAGGG + Intergenic
1117603186 14:57396740-57396762 TTTATTTTTAAGGCCATGGTAGG + Exonic
1119141615 14:72272487-72272509 TAGAAATTGAGAGCCATGGAAGG - Intronic
1124416053 15:29474023-29474045 TTGCTATTGAAGGCTGTAGATGG - Intronic
1125281150 15:38043665-38043687 ATGATAGTGAACGCCAAGGATGG + Intergenic
1126669521 15:51103373-51103395 TTGATATCCTTGGCCATGGAAGG - Intronic
1126719558 15:51562956-51562978 AAGTTATTGAAGGACATGGAAGG + Intronic
1127672990 15:61213280-61213302 CTGATATTGAAGGCCAAGACTGG - Intronic
1131819079 15:96253524-96253546 ATGATGTGGAAGTCCATGGAAGG + Intergenic
1132086449 15:98912101-98912123 TGGATATAGAAGGCAAAGGAAGG - Intronic
1144038836 17:11390629-11390651 GTGATCTTAAAGGCCATTGAGGG - Intronic
1144076841 17:11727208-11727230 TTCATATTGAATGCCCAGGATGG + Intronic
1144082539 17:11777918-11777940 ATGAAATTGAAGGGGATGGATGG + Intronic
1145202335 17:20957624-20957646 TGCATATTGAAAGACATGGAAGG + Intergenic
1149723351 17:58867495-58867517 CTAAGATTGAAGGCCTTGGAGGG - Intronic
1151066219 17:71153009-71153031 ATGATTTTGGAGGCCAAGGAGGG + Intergenic
1153037216 18:774844-774866 TGGATCTTGAAGGCCATAGTAGG - Intronic
1154149825 18:11897734-11897756 TTGATTTTTAAGGTCAAGGAGGG - Intronic
1156728493 18:40160113-40160135 TTCAGAGTGAAGGCTATGGATGG - Intergenic
1158900899 18:61961052-61961074 TTGACAGTGAAGCCCAAGGAAGG + Intergenic
1160059574 18:75516825-75516847 TTCAGAATGAAGGCCATGCATGG - Intergenic
1161359685 19:3840899-3840921 TAGATTTTGATGGCCATGCATGG + Intronic
1166749020 19:45155982-45156004 CTGATAGTGGGGGCCATGGAGGG - Intronic
1167157721 19:47749706-47749728 TTGACACTGAAGCCCAGGGAGGG - Intronic
924964683 2:64798-64820 TTGAGAGTGAAGGCCAGGCATGG - Intergenic
925117680 2:1394330-1394352 TTCATTTTGACGACCATGGAGGG + Intronic
927523315 2:23715282-23715304 ATCATATTGAAGGCCAGGCACGG + Intergenic
930329901 2:49969302-49969324 ATGATTTTGAAGCCAATGGAGGG + Intronic
931358496 2:61557614-61557636 TTTATATTGCAGGCCAGGCATGG - Intergenic
932670602 2:73734463-73734485 TTGAGAAGAAAGGCCATGGAAGG - Exonic
934705556 2:96475755-96475777 TTGAGACTTAAGGCTATGGAAGG - Intergenic
934879545 2:97963422-97963444 TTGAGATTGCAGGCCAGGTATGG + Intronic
937624780 2:124031646-124031668 TTGATACTGAAGTCAGTGGATGG - Intronic
943141788 2:183992543-183992565 TTGACATGTAAGCCCATGGATGG + Intergenic
947129737 2:226909064-226909086 TTGGTAGGGAAGGCCAGGGAAGG + Intronic
947815484 2:233033857-233033879 TGCATATTGATGGCAATGGAAGG + Intronic
1169062426 20:2671143-2671165 TTGGGAATGAAGGCCATGGGAGG - Intergenic
1172090272 20:32426479-32426501 TTGATTCTGAAGACCATGTATGG + Intronic
1172436515 20:34932426-34932448 AGGATCTTGAAGGCCATGGTAGG - Intronic
1172735525 20:37124394-37124416 CTGATATGGAAGGCCTGGGATGG - Intronic
1173236213 20:41247953-41247975 TTTATACTGTAGGCCATGGGAGG - Intronic
1174732272 20:52929534-52929556 TACATATTGAAGGCCTGGGAAGG + Intergenic
1174887810 20:54354808-54354830 TTGCTATTGAAGGACAGAGAAGG + Intergenic
1174951971 20:55052071-55052093 TTGATATTAAAGGCCTTTAAAGG + Intergenic
1175179402 20:57134859-57134881 TTTAGATTGATGGCCAGGGAAGG + Intergenic
1176359944 21:5986779-5986801 GTGATATTTAATGCCATGGAGGG + Intergenic
1178698278 21:34812781-34812803 TTGATTTACAAGGCCAAGGAAGG + Intronic
1179763574 21:43551771-43551793 GTGATATTTAATGCCATGGAGGG - Intronic
1179832190 21:44003960-44003982 TTGAAAGTGAAGGCCAGGCACGG - Intergenic
1181753121 22:25003796-25003818 TTGATATAGATGCACATGGATGG - Intronic
1183151251 22:36039224-36039246 TTGATATTGAAGGAGAGTGATGG + Intergenic
1183735725 22:39643815-39643837 TGAATATGCAAGGCCATGGATGG - Intronic
1184034620 22:41912606-41912628 TTGGGGTTGAAGGCCAGGGAAGG - Intronic
949247874 3:1946683-1946705 TCCATATTTAAGGCCAGGGAAGG + Intergenic
951365835 3:21781328-21781350 TAGATATGGAAGGGTATGGAAGG - Intronic
953491303 3:43354306-43354328 CTGAGATGGAAAGCCATGGAAGG - Intronic
955023956 3:55149073-55149095 TGGAGATTGGAGGCCATAGAAGG + Intergenic
957010143 3:74995375-74995397 TTGAGATTGAAAGCGATTGAAGG + Intergenic
957412323 3:79857890-79857912 TTTATATTGGATGACATGGAAGG + Intergenic
958984105 3:100760588-100760610 GTGATATTCAAAGCCATGCATGG - Intronic
959244169 3:103842233-103842255 TTTATATTGAAGGCCTTTGTGGG - Intergenic
959304764 3:104648010-104648032 TTGTTATTTAAGCCCAAGGAAGG - Intergenic
959343562 3:105162671-105162693 TTCATATAAAAGCCCATGGAGGG - Intergenic
959829888 3:110848426-110848448 TTGATGTAGAAGGAAATGGATGG - Intergenic
960533913 3:118795548-118795570 TTGATCGTGGAGGCCATGGATGG - Intergenic
963012749 3:140788672-140788694 TGTATATTGAAAGCCATAGAAGG + Intergenic
965578028 3:170238050-170238072 TTTTTTTTTAAGGCCATGGAGGG - Intronic
967494033 3:190122764-190122786 TGTATATTGAATGCCTTGGATGG + Intergenic
967606610 3:191454502-191454524 TTGATGTTTGAGGCCATGGTAGG + Intergenic
968117461 3:196100179-196100201 TGGGTATTGAAGGGGATGGAAGG + Intergenic
969121730 4:4915862-4915884 TTGAGAATGTAGGCCATAGATGG - Intergenic
971013245 4:22462267-22462289 TAAATATAGAAGGCCAGGGAAGG - Intronic
971938815 4:33188768-33188790 TTGTCATGGATGGCCATGGATGG + Intergenic
972046138 4:34666735-34666757 TTGATTATGGAGGCCATGGAGGG + Intergenic
972642156 4:40934744-40934766 TTGATATTTGAGGCAATGAATGG - Intronic
973883336 4:55295821-55295843 TTTATTTTGAGGGCAATGGAAGG + Intergenic
976002580 4:80388685-80388707 GTGATCTTTAAGGCCCTGGAGGG - Intronic
976526711 4:86100369-86100391 TTTAAAATGAAGGCTATGGAAGG - Intronic
977096516 4:92751652-92751674 CTGACATTGAAGGCAAAGGAAGG - Intronic
977539174 4:98294994-98295016 TAGATACTGAAGGACATGAAGGG + Intronic
982249855 4:153393667-153393689 TTGAACTTGAAGGCCAAGCACGG - Intronic
982782447 4:159505532-159505554 TTGAGATTCAAGGGCATGGAAGG + Intergenic
984044955 4:174785324-174785346 TTTATTTTGAAGGCCATAGTGGG - Intronic
984329124 4:178292563-178292585 TTGGTCTAGAAGGCCATGGTTGG + Intergenic
985909887 5:2870859-2870881 ATGATGGTGCAGGCCATGGAGGG + Intergenic
986229753 5:5852553-5852575 TTCATATGGATGGCCAGGGAAGG + Intergenic
986849551 5:11795233-11795255 TTTATTTAGAAGGCCAAGGAAGG + Intronic
993153480 5:84191258-84191280 TTGATCTTGAAGGCAGTGGCAGG + Intronic
993385938 5:87263022-87263044 TTGGCATTGAAGGCCAGGCATGG - Intergenic
994514509 5:100753704-100753726 TTGAAATTAAAGGCCAGGCATGG + Intergenic
997961738 5:138327283-138327305 TAGATAATGAAATCCATGGAGGG - Intronic
998339975 5:141408830-141408852 TTGATATTGACTGCCTTGGACGG + Exonic
998600830 5:143583221-143583243 ATGACATTTAAGTCCATGGATGG + Intergenic
998787425 5:145727788-145727810 TTGATAATTAAAGCCAGGGAAGG - Intronic
1000520140 5:162284863-162284885 TTGGTAGTGATTGCCATGGAGGG + Intergenic
1001446701 5:171790787-171790809 CTGATATTCAAGCCCCTGGAAGG - Exonic
1003047655 6:2748716-2748738 TTGATAGTGAAGTCCAGAGAAGG - Intronic
1012984107 6:105856653-105856675 TGATTATTGAAGGCCCTGGAAGG - Intergenic
1014443985 6:121505318-121505340 TTGATTTTTAAGGCCAGAGAAGG - Intergenic
1014957332 6:127636961-127636983 TTGATATTGATAGCCAAGCAAGG + Intergenic
1015911715 6:138175184-138175206 TTGATATTCAATGCCAGGGAGGG + Intronic
1016840596 6:148520509-148520531 TTGAAATTGAAGGTGATGGTGGG - Intronic
1020699217 7:11457256-11457278 TTTATATTTGAGGCCATGGCAGG - Intronic
1021499838 7:21320335-21320357 TTGACATTGAAGGCCATTCTGGG + Intergenic
1021527031 7:21599411-21599433 TTTATACGGAAGGCCCTGGAAGG + Intronic
1021860217 7:24898549-24898571 TGGATTGTGAAGGCCATGGATGG - Intronic
1023087391 7:36585063-36585085 TTGGTATTGAAGGACATGATAGG + Intronic
1023263660 7:38382499-38382521 TTGAAAATGAAGGAGATGGAGGG - Intergenic
1027520585 7:79201434-79201456 TTGATATTGAAGGACATCAGAGG - Intronic
1030148124 7:106376967-106376989 TTGACATTTAAGGCCAGGCACGG - Intergenic
1030490972 7:110234074-110234096 TTGATATTGAAGACCATTTTAGG + Intergenic
1031109840 7:117595591-117595613 TTGAAATTAAAGGCCAGGCATGG + Intronic
1031180572 7:118409660-118409682 TTGCCATAGAAGGCCATAGAAGG + Intergenic
1033358113 7:140617301-140617323 TTGATATTGAAGGCCATGGAGGG - Intronic
1034372635 7:150613339-150613361 TTGATAATTAAAGCCAGGGAAGG - Intergenic
1034857215 7:154563111-154563133 TAGCTATTGAAGGACATGGAAGG + Intronic
1035134574 7:156688726-156688748 TTAGTATAGAAGGCCATGGAAGG - Intronic
1037405786 8:18541058-18541080 TAGATTTTGATGGCCAGGGAAGG - Intronic
1038260842 8:25992606-25992628 TTCATATTTAAGGCCAGGCATGG + Intronic
1039051147 8:33495015-33495037 TTGATAGTGAAAGTCATAGAGGG - Intronic
1039441362 8:37597641-37597663 TGGAAATTGAAGCCCAGGGAAGG - Intergenic
1039441930 8:37601172-37601194 TTGATCTTTAAGACCATGGAAGG + Intergenic
1039867267 8:41516438-41516460 TTAATATTTAATGACATGGAGGG + Intergenic
1042376982 8:68062847-68062869 TTTTTATTGGAGGCCAGGGAAGG - Intronic
1043477047 8:80615410-80615432 TTGGAATGGAAGGCCATGCAAGG + Intergenic
1043562854 8:81515030-81515052 TAGATATTGAAGGCTGGGGAAGG - Intergenic
1043799075 8:84584312-84584334 TTGATATTTAAGGCCAGGCGTGG + Intronic
1044721424 8:95152777-95152799 TTTATAATGAAGGCCAAGAAGGG + Intronic
1045286803 8:100798640-100798662 TACATATTGAAATCCATGGATGG - Intergenic
1046757132 8:117983594-117983616 TTGTTGTTGAAGGCCAGGGAGGG - Intronic
1047472771 8:125195175-125195197 TTGATATTGACGCCTAGGGATGG - Intronic
1049595065 8:143479553-143479575 TGGATAATGAAGGCCAGGGAGGG + Intronic
1052384547 9:27808058-27808080 TTGAGATTGGAAGCCATGGTGGG + Intergenic
1053111887 9:35468061-35468083 TTGAGAGAGAAGGGCATGGAGGG - Intergenic
1053397239 9:37786072-37786094 CTGATATTCCAGGCCATGTAGGG - Intronic
1056577059 9:87863526-87863548 TTGAAAAAGAAGGTCATGGAAGG - Intergenic
1059941933 9:119368002-119368024 ATGATATGGAAGGAGATGGATGG - Intronic
1185916061 X:4036792-4036814 TGAATATTGAAGGTCATGGTGGG - Intergenic
1187423267 X:19154999-19155021 GAGATATTGAAGGCCAGGCATGG + Intergenic
1188171134 X:26928104-26928126 TTGATATTGAATACCAGTGAAGG - Intergenic
1188233480 X:27696355-27696377 TTGAAATGGAAGGCATTGGATGG + Intronic
1192186394 X:68949556-68949578 TTTACATAGAAGGCCCTGGATGG - Intergenic
1200395555 X:155984713-155984735 TTGATAATTAAAGCCAGGGAAGG - Intergenic