ID: 1033358683

View in Genome Browser
Species Human (GRCh38)
Location 7:140622504-140622526
Sequence TTTAACAAGTCTGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033358683_1033358688 -8 Left 1033358683 7:140622504-140622526 CCCTCCTCCTCAGACTTGTTAAA 0: 1
1: 0
2: 1
3: 26
4: 248
Right 1033358688 7:140622519-140622541 TTGTTAAAATGCTCTTTCGGAGG 0: 1
1: 0
2: 0
3: 14
4: 193
1033358683_1033358689 25 Left 1033358683 7:140622504-140622526 CCCTCCTCCTCAGACTTGTTAAA 0: 1
1: 0
2: 1
3: 26
4: 248
Right 1033358689 7:140622552-140622574 ATGAGTGCTATCCAGCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033358683 Original CRISPR TTTAACAAGTCTGAGGAGGA GGG (reversed) Intronic
901622050 1:10596511-10596533 TTTAACAAGTCTGAAGACCTAGG + Intronic
901715398 1:11149587-11149609 ATTATCAAACCTGAGGAGGAGGG + Intronic
903442070 1:23395580-23395602 TTTTACGAGGCTGAGGAGGGAGG + Intronic
903807323 1:26014843-26014865 TTTAATAAGTCTGAGAACTATGG - Intergenic
904617703 1:31758796-31758818 TTTTTCAGCTCTGAGGAGGAGGG - Intronic
904895923 1:33818190-33818212 ATTATCAAGTCTGAGGACCAAGG - Intronic
905509829 1:38510363-38510385 TTTAACAAGCCTTAGAGGGAAGG - Intergenic
905909836 1:41646213-41646235 TTAAACAAGGCTGATGAAGAAGG - Intronic
906704767 1:47886918-47886940 TTTACCAAGTGTGATGATGATGG - Intronic
907419576 1:54337789-54337811 TTCAAAAAGTTTGAGGAGGCCGG - Intronic
907776131 1:57517268-57517290 TTAAACAAGTCTGAGAAAGGAGG - Intronic
908688785 1:66753453-66753475 TTTAACAAGTATTAGTAGGAAGG + Intronic
908739668 1:67314210-67314232 CTTAAAAAGTCAGGGGAGGAAGG - Intronic
909267539 1:73579794-73579816 TTCCAAAAATCTGAGGAGGAGGG + Intergenic
909706258 1:78588160-78588182 TTTAAAAAAGCAGAGGAGGAAGG + Intergenic
910575921 1:88763639-88763661 TTCTTTAAGTCTGAGGAGGATGG - Intronic
915441247 1:155946809-155946831 TCTGCCAATTCTGAGGAGGATGG - Intergenic
915638215 1:157200993-157201015 TTTAACAATTCTAGGGAGAAAGG - Intergenic
916712512 1:167424591-167424613 TTTAACATGACTGAGGAGGGAGG - Exonic
918432524 1:184476879-184476901 ATGTACCAGTCTGAGGAGGATGG + Intronic
919543521 1:198881305-198881327 ATAAATAAGTGTGAGGAGGAAGG - Intergenic
919553835 1:199027003-199027025 TTTAAGAAATAAGAGGAGGAAGG - Intergenic
920696398 1:208184305-208184327 TTTAACTTGCCTGGGGAGGAAGG + Intronic
922990595 1:229907483-229907505 TTAAGCAAGTTTGATGAGGAGGG - Intergenic
923201726 1:231718892-231718914 TTTTAGAAGGCTGAGGTGGAAGG + Intronic
923324212 1:232866495-232866517 TTAAACAAGGCTGACCAGGATGG - Intergenic
923895708 1:238267541-238267563 TTCCAAAACTCTGAGGAGGAGGG + Intergenic
1064501673 10:15980276-15980298 TCTTACAAGTCTCAGGAGGAGGG + Intergenic
1066144138 10:32539019-32539041 TTCAAAAAAACTGAGGAGGAGGG - Intronic
1066479521 10:35782072-35782094 ATTAACAAGTCTGATGAAGATGG + Intergenic
1068507123 10:57915173-57915195 ATTAAGTAGACTGAGGAGGAGGG + Intergenic
1068875644 10:61993093-61993115 TTTAACAGCTTTGATGAGGAAGG + Intronic
1070228393 10:74536674-74536696 GTTACCAAGGGTGAGGAGGAAGG - Intronic
1070753058 10:78975168-78975190 AATAACAAGTCTGAGGAAGCTGG - Intergenic
1078102322 11:8337221-8337243 TTTCCCCAGTCTGAAGAGGACGG - Intergenic
1079739782 11:24043640-24043662 CTTAAGAAGTATGTGGAGGAGGG + Intergenic
1080471350 11:32548632-32548654 TTTAAAATGTCTGATGAGGCCGG - Intergenic
1083447221 11:62716098-62716120 TTTAAAAAGTCTGAGGGGGGAGG + Intronic
1084629125 11:70334241-70334263 TTTAACAAGTAGGTGGAGAAAGG + Intronic
1085386738 11:76162000-76162022 CTCAACACGACTGAGGAGGAGGG - Intergenic
1088019451 11:105101649-105101671 TTGAACAAGTCAGGGTAGGAGGG + Intergenic
1088297890 11:108320756-108320778 TTTCAAATGTGTGAGGAGGAGGG - Intronic
1088987450 11:114922180-114922202 TTTAAAAAGTCTCAAGAGAAGGG - Intergenic
1089044028 11:115483659-115483681 TTTAACTAGTGAGAGGAGGTTGG - Intronic
1089421609 11:118336063-118336085 TTTTAGGAGGCTGAGGAGGAAGG + Intergenic
1090105316 11:123848539-123848561 TTTCAAAAAACTGAGGAGGAGGG - Intergenic
1091209158 11:133842037-133842059 TCTCAGCAGTCTGAGGAGGAGGG + Exonic
1092942466 12:13423003-13423025 TTTAACTAGTCTTTGAAGGATGG + Intergenic
1093386114 12:18556428-18556450 TGTAAGAAGTCTGAAGATGAAGG - Intronic
1094609166 12:31976773-31976795 CTTAACTAGGCGGAGGAGGAGGG + Intronic
1097474882 12:60041456-60041478 TTTTACAAGTCAGTGGAAGATGG - Intergenic
1097558950 12:61177180-61177202 TTTCAAAAAACTGAGGAGGAGGG - Intergenic
1098419120 12:70272780-70272802 TGTTACAGGTCTGAGGAGGGAGG - Intronic
1100507924 12:95238663-95238685 AGCAACAAATCTGAGGAGGAAGG - Intronic
1100773160 12:97946036-97946058 TTTAACAAGACTGAGTATGCAGG - Intergenic
1100974617 12:100109518-100109540 TTTTAGGAGTCTGAGGAGGGCGG + Intronic
1101007247 12:100412919-100412941 TTCAACAAGTCCCAGGAAGAAGG + Intronic
1101886727 12:108670362-108670384 TTTAAAAGGTCTGAAGAGGCAGG + Intronic
1102735221 12:115153325-115153347 TGTACCAAGTCTGGGGAAGAGGG + Intergenic
1104226859 12:126843475-126843497 TTGAACAAGTTAAAGGAGGAAGG - Intergenic
1107513970 13:41111112-41111134 TATATCAAGTGTGAGGATGAAGG + Intergenic
1107718820 13:43227106-43227128 TAGAACAAGTCAGAGGAGGATGG + Intronic
1108097516 13:46919296-46919318 TTTAAAAAAATTGAGGAGGAGGG - Intergenic
1108491727 13:50988847-50988869 ATTAAAAAATCTGAAGAGGATGG - Intergenic
1109679344 13:65728812-65728834 TTTAAGAATTCTGAGGATTATGG + Intergenic
1111257549 13:85691929-85691951 TTTAACATTTCTGGGAAGGATGG + Intergenic
1114904869 14:27114869-27114891 TTTCAAAAGACTGAGAAGGAGGG - Intergenic
1115194676 14:30783650-30783672 TTTAACCAGTGTGAGGAAGGAGG + Intergenic
1116841629 14:49824246-49824268 CTTTAAAAGTCTGAGGAGGCGGG + Intronic
1117893199 14:60449272-60449294 TTTACCAAATCTTAGGAGGAAGG - Intronic
1120022628 14:79547929-79547951 TTTAACAATGCAGGGGAGGAGGG + Intronic
1120060323 14:79975209-79975231 TCTAATAAGTCAAAGGAGGAAGG - Intergenic
1120720897 14:87888854-87888876 ATTAACTAGTTTGAGGAGAAAGG - Intronic
1120933212 14:89869244-89869266 TTTTTAAAGTGTGAGGAGGAGGG - Intronic
1121523555 14:94602767-94602789 TTTAAGAATTCTTAGGAGGCTGG - Intronic
1122455120 14:101844256-101844278 TTTGACAAGTTCGAGGAGGCTGG + Intronic
1124222519 15:27862769-27862791 CTTAAAATGTCTGAGGAGGCTGG - Intronic
1126336182 15:47588476-47588498 TTTACGGAGTCTGAGGAGCATGG - Intronic
1127222442 15:56893813-56893835 TTTAACAAGTCTGTTGAAAAGGG - Intronic
1127834468 15:62779540-62779562 TTTAACTAGTCTGAGGACAATGG - Intronic
1130185824 15:81680805-81680827 TTTCAAAAAACTGAGGAGGAGGG + Intergenic
1131103588 15:89714186-89714208 TTTTACCTGTCTGGGGAGGAGGG - Intronic
1132151118 15:99460112-99460134 TTTATCCAGTCTGAGGTTGATGG + Intergenic
1133283714 16:4680997-4681019 ATCAACAAGGCTGAGGAAGAAGG - Intronic
1134125303 16:11612326-11612348 TTTCACAAGAATGATGAGGACGG - Intronic
1135992030 16:27224171-27224193 CTTAACAAGTGTGAGGATGGAGG + Intergenic
1138375604 16:56561823-56561845 TTTAACAGGGCTGAGGACGGTGG - Intergenic
1139663382 16:68437851-68437873 TCTAACCAGCCTAAGGAGGATGG + Intronic
1139737025 16:68999177-68999199 TTATACAAGTCTGAGAAGGCTGG - Intronic
1141260613 16:82450252-82450274 TATAACAAGTCTCATGAGGTCGG + Intergenic
1144287240 17:13788610-13788632 GTTAACAAGGGTGAGGAGGAAGG - Intergenic
1148135993 17:45292266-45292288 CTTAAGAAGTCTGAGGGGGCCGG + Intronic
1148894346 17:50831370-50831392 TTAAACATGTTTGGGGAGGAGGG - Intergenic
1149326323 17:55533974-55533996 TTTAATTAGTCTAAGCAGGAAGG + Intergenic
1150090655 17:62322307-62322329 ATTAAAAAGTTTGAGGAGGAGGG + Intergenic
1151238577 17:72739703-72739725 TTTAACAGCTCTGAGGCTGAAGG + Intronic
1152707298 17:81851224-81851246 TTTAAGAAGTTTGAGGAGGCCGG - Intronic
1156706962 18:39894517-39894539 TGTAACATGACTGATGAGGAAGG - Intergenic
1156867110 18:41901193-41901215 TTGAACCAGACTGAGGAGTAAGG + Intergenic
1159302640 18:66595772-66595794 TTTCAAAAATTTGAGGAGGATGG + Intronic
1159498634 18:69239069-69239091 AGTAAGAAGTCTGGGGAGGAGGG + Intergenic
1161222988 19:3126585-3126607 TTTAAAAATTCCGAGGAGGCCGG + Intergenic
1161442573 19:4300680-4300702 TATAACCAGTGTGAGAAGGAAGG + Intronic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1165880084 19:39036287-39036309 TTTAAAAAGTTTGAGTAGGTTGG + Intergenic
928311238 2:30211809-30211831 ATTACAAAGTCAGAGGAGGATGG - Intergenic
929003684 2:37373833-37373855 TTTAAGAAATGTGAGGAGGCTGG - Intergenic
929660614 2:43780559-43780581 TTTAACAAGGCTGCAGAGGAAGG + Intronic
930226325 2:48797883-48797905 TGTCACAAGTCTGAGAAGGCAGG - Intergenic
930529072 2:52569346-52569368 TTTCACAACATTGAGGAGGAGGG - Intergenic
931919826 2:67002651-67002673 GTTTACTAATCTGAGGAGGATGG - Intergenic
932474356 2:71992406-71992428 TTTATATAGTCTGATGAGGAGGG - Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
934865708 2:97808515-97808537 TGAAACAAGTATGGGGAGGAGGG - Intronic
934987896 2:98900501-98900523 TTTGAAAAGCCAGAGGAGGAGGG - Intronic
935250903 2:101259626-101259648 TTTATGAAGTCTAAGAAGGATGG - Intronic
937341797 2:121095984-121096006 TTCAACAGGTCTGAGAAGCAAGG - Intergenic
939190301 2:138909628-138909650 CTTAACGAGTCTGAGGAGAATGG + Intergenic
939532663 2:143384009-143384031 TTTCTCTTGTCTGAGGAGGATGG - Intronic
940499471 2:154476312-154476334 TTTAACAAGTCCTAGAAGCAAGG + Intergenic
940880861 2:158945427-158945449 TTTAAAAAGTCAGAGGAGGCTGG - Intergenic
941342363 2:164323159-164323181 TTTTAGAAGGCTGAGGAGGAAGG - Intergenic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942599960 2:177630569-177630591 TTTTACAGGTCAGAGGAGCATGG + Intronic
942739879 2:179163784-179163806 TTCAACAAGTTTGAAGAGAAAGG + Intronic
944505543 2:200406955-200406977 CTTAGCAAGTCTGTGGAGGTAGG + Intronic
947266440 2:228287455-228287477 TTCAAAAATTTTGAGGAGGAGGG - Intergenic
947408007 2:229801201-229801223 TTTGACCAGTCTGAGGAGATTGG - Intronic
947438246 2:230091836-230091858 TTCAAAAACACTGAGGAGGAGGG + Intergenic
947476868 2:230457955-230457977 TTTAACAGGTATGAGATGGAAGG + Intronic
947790153 2:232861595-232861617 TTAAACAGGGCTGAGTAGGAAGG - Intronic
1169329079 20:4702559-4702581 TTGAGGAAGGCTGAGGAGGAAGG + Intergenic
1169678347 20:8180488-8180510 TTCTAAAAATCTGAGGAGGAGGG - Intronic
1170155122 20:13262215-13262237 TCTAACAGGGCTGAAGAGGAGGG + Intronic
1172326143 20:34036565-34036587 TTTCAGAAATCAGAGGAGGAGGG - Intronic
1173524366 20:43720705-43720727 TTCAACAAGTCTGAAGTTGAAGG - Intergenic
1175713030 20:61236268-61236290 CTTGACAAGTGTCAGGAGGATGG - Intergenic
1176708122 21:10129933-10129955 TTTACCATGTGGGAGGAGGAGGG + Intergenic
1178399167 21:32268982-32269004 TTTAACAAATAAGGGGAGGAAGG + Exonic
1178811216 21:35883232-35883254 TTTAACAAGGTTCAGGTGGAGGG + Intronic
1179534629 21:42043579-42043601 TTTAAGAAGTCAGAACAGGAGGG + Intergenic
1179831659 21:44000753-44000775 GGAAACAAGTCTGAGGACGAGGG - Intergenic
1180702521 22:17789375-17789397 TTTAACATATGTGCGGAGGAAGG + Exonic
1180754674 22:18152706-18152728 CTTAAAAGGTCTAAGGAGGATGG - Intronic
1181378016 22:22475954-22475976 TTTTAGGAGGCTGAGGAGGAAGG - Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1183178832 22:36244926-36244948 TGTTAGAAGTCTGAGGAAGATGG - Intergenic
1184578557 22:45395612-45395634 CTTTGCAAGGCTGAGGAGGATGG + Intronic
949908128 3:8876116-8876138 TTTAAGATCTCTGAGGAGAATGG - Intronic
949945268 3:9185003-9185025 TTGAACTAGTCTGGGGAGGGAGG - Intronic
950484435 3:13264698-13264720 TTCAACAAGCGGGAGGAGGACGG + Intergenic
952370215 3:32715312-32715334 TTTGACAAGTCAGACAAGGAGGG + Intronic
952696717 3:36273303-36273325 TTTAAAAAGTCTGCTGAAGATGG - Intergenic
954090209 3:48278268-48278290 TTTAAAAAGTTTGAAGAGAAAGG + Intronic
960663718 3:120089316-120089338 TTTAACAACTCTGGGGAAGTCGG + Intronic
962035933 3:131651557-131651579 TTTAGGAAGTCTTAGGAGAAAGG + Intronic
962475145 3:135748751-135748773 TTCAAAAATTCTGAAGAGGATGG + Intergenic
963420819 3:145058994-145059016 TTTTAAAAGACTGAGGAAGAGGG + Intergenic
964392825 3:156215127-156215149 TATAACAATTCTGAGAAGTAGGG + Intronic
964825735 3:160825965-160825987 ATTCAAAAGTCTGAGCAGGAAGG - Intronic
965202680 3:165680093-165680115 TTTAACAAGTTTATGGAAGAGGG - Intergenic
965468153 3:169058272-169058294 TTTAACATTTGTGTGGAGGAGGG - Intergenic
965935828 3:174110119-174110141 TTTAACAAGTCTTGGGAAGTAGG - Intronic
967156608 3:186698186-186698208 GTCTGCAAGTCTGAGGAGGAAGG + Intergenic
968789675 4:2650901-2650923 ACTAACAAGACTGTGGAGGAGGG - Intronic
969040851 4:4294846-4294868 TTTAACAGGTCTGTGGAGGAGGG + Intronic
969839946 4:9873929-9873951 TTTAAAAAGTCTGCAGAGGAGGG - Intronic
970512231 4:16792801-16792823 TTTAACAAGAGGAAGGAGGAAGG + Intronic
972901315 4:43687625-43687647 TTTAAAAAGTCTGAGAAACAGGG - Intergenic
974628144 4:64450326-64450348 TTTAACAAGGCAGAGGAAAATGG + Intergenic
975797417 4:78022750-78022772 TTTAACATGTCAAAGAAGGAAGG - Intergenic
976159338 4:82182131-82182153 TTAAAGAAGTTAGAGGAGGAGGG + Intergenic
977039070 4:91991672-91991694 ATTATCCAGTCTGAGGAGCAGGG + Intergenic
978149336 4:105415020-105415042 TTTAACCAGACTCGGGAGGACGG - Intronic
978320370 4:107487021-107487043 TTTAAAAATTTTGAGGAAGAAGG + Intergenic
978574834 4:110179259-110179281 TTTAAGGAGGCTGAGGTGGATGG + Intronic
979370225 4:119876829-119876851 GTTAGCAAGTGTTAGGAGGAAGG + Intergenic
980329027 4:131387114-131387136 TGCACCAAGTCTGATGAGGAGGG + Intergenic
980623163 4:135336532-135336554 TTTAACAAGTATGTGGAAAATGG - Intergenic
980997394 4:139793058-139793080 TTTAAGAATGCTGATGAGGATGG + Intronic
981136665 4:141218771-141218793 TTTAATAAGTCCTAGGTGGAAGG - Intergenic
982955162 4:161755607-161755629 TTTATAAAGTATGTGGAGGAAGG + Intronic
983586883 4:169365094-169365116 TGTAAAAATTCTGAGGAGCATGG - Intergenic
984023089 4:174509997-174510019 TTTTAAAAGTCTGAGCTGGAAGG - Intronic
986734347 5:10657038-10657060 TTTAAGAAGTTTGAGGAGGTAGG + Intergenic
986911400 5:12562921-12562943 TTTAATAAATCTTAGGATGATGG - Intergenic
987024357 5:13909123-13909145 TTTAAGAAGGCTGAGTAGAATGG + Intronic
988137618 5:27194484-27194506 TTTAACAAGTCTGATAATGATGG - Intergenic
991920564 5:71652708-71652730 ATTAAGAAGTTTGAAGAGGAAGG + Exonic
994236906 5:97373497-97373519 TTTCAAAAATTTGAGGAGGAGGG + Intergenic
994287780 5:97991294-97991316 TTTAAAAAGCTTGAGAAGGAGGG + Intergenic
994540190 5:101085693-101085715 TTTGACAAGTATGAGGGGCATGG - Intergenic
995300108 5:110570047-110570069 TTTTACAAGTAATAGGAGGAAGG + Intronic
997299773 5:132794255-132794277 TTTAAGATGTCTGAGGAGGCTGG - Intronic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
1001879638 5:175232143-175232165 TTTGCCAAGTCTGGGGTGGAAGG + Intergenic
1002767185 6:252167-252189 CTGAACAATTCTAAGGAGGAAGG - Intergenic
1003151588 6:3556282-3556304 TTTAAAAGGTCTCATGAGGATGG - Intergenic
1004117643 6:12786709-12786731 TTTACCAAGGCTGATGATGATGG - Intronic
1004201785 6:13555271-13555293 TTTAAAAAGACTGGAGAGGAAGG + Intergenic
1005651300 6:27887530-27887552 TTCAACACTTCTGGGGAGGAAGG + Intergenic
1005912743 6:30325867-30325889 TGTGAAAAGGCTGAGGAGGAGGG - Intergenic
1007689130 6:43687451-43687473 CTTCACAAGGCGGAGGAGGACGG - Intronic
1009531188 6:64818149-64818171 TTTGATAAGACTTAGGAGGATGG - Intronic
1009639522 6:66314859-66314881 TTTAAAAGATCTGAGGAGGCCGG - Intergenic
1010429650 6:75764347-75764369 TTGAACAAGACTAAGGAGAAAGG - Intronic
1010638372 6:78288416-78288438 TTTAAAAAAACTGAAGAGGAGGG - Intergenic
1010979446 6:82354358-82354380 TTTCACTGGTCTTAGGAGGAAGG + Intergenic
1013751000 6:113406134-113406156 TTTCACAATTCTGAGCAGCATGG - Intergenic
1015067036 6:129042336-129042358 TTTAACATGTTTGAGTAGGGAGG + Intronic
1017297646 6:152817474-152817496 TTTGAGAAGACTGAGGGGGAAGG + Intergenic
1017750481 6:157486754-157486776 TTTAACCAGGCAGAGAAGGAAGG + Intronic
1018132345 6:160744194-160744216 TTCAAAAAAACTGAGGAGGAGGG - Intronic
1018213931 6:161508626-161508648 TTTATGAAGTCTGAGGAAAAGGG - Intronic
1020884126 7:13801662-13801684 TTTAACAAAGCTGTGGAGAAGGG + Intergenic
1021073818 7:16275498-16275520 TTTATCTAGTTTTAGGAGGAAGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1026234245 7:68512168-68512190 TTTAAAAAGACTGGCGAGGACGG + Intergenic
1026564610 7:71479703-71479725 TTTCTTATGTCTGAGGAGGAAGG - Intronic
1027453872 7:78363195-78363217 GTTAATAATTCTGAGGAGGCCGG + Intronic
1028387283 7:90270510-90270532 TTTAAAAAGTAAGAAGAGGAAGG - Intronic
1030520100 7:110588100-110588122 TTTTACAAATGAGAGGAGGAAGG - Intergenic
1030718733 7:112843749-112843771 TTCCAAAAGACTGAGGAGGAGGG + Intronic
1031004154 7:116453244-116453266 TTGGAAAGGTCTGAGGAGGAAGG - Intronic
1031338646 7:120570756-120570778 TTTAAGAAATCTGAAGATGAAGG - Intronic
1031421342 7:121555739-121555761 TATAATAGGCCTGAGGAGGATGG - Intergenic
1032775307 7:135106748-135106770 TTTCAAAAAGCTGAGGAGGAGGG - Intronic
1033358683 7:140622504-140622526 TTTAACAAGTCTGAGGAGGAGGG - Intronic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1037335474 8:17787346-17787368 TTTAGCATCTCAGAGGAGGAGGG - Intronic
1037554425 8:20008421-20008443 TTTAACAAGTATGAGCAGGGTGG + Intergenic
1038406341 8:27325511-27325533 GTTAACAACTCAGAGGAGGAGGG + Intronic
1038526856 8:28281937-28281959 TTTAAAAAGGCTGAGTAAGAGGG + Intergenic
1041966578 8:63685480-63685502 TTTACCAAGTCCTAGGAGGAAGG + Intergenic
1042348173 8:67748915-67748937 TTTAGCAAATGGGAGGAGGAGGG + Intergenic
1042376129 8:68055163-68055185 TTTAACCAGTGGGAGGAGAAAGG - Intronic
1042426556 8:68655817-68655839 TTTATCAATTATAAGGAGGATGG + Intronic
1043943907 8:86228544-86228566 TTTAAGAAATCTGAGGAGGTGGG + Intronic
1044352792 8:91186072-91186094 TTTACCAAGTCTGGAGAAGAAGG + Intronic
1044359133 8:91260785-91260807 TGTAGCAAGTCACAGGAGGAAGG + Intronic
1044707377 8:95021795-95021817 ATTATCAAACCTGAGGAGGAAGG + Intronic
1045412729 8:101934895-101934917 TTGCCTAAGTCTGAGGAGGATGG - Intronic
1045660452 8:104432085-104432107 TTCAACAACTCTTAGGAGAAAGG + Intronic
1045762813 8:105630336-105630358 ATTACCAAGTGTGAGAAGGAAGG - Intronic
1046088041 8:109463386-109463408 TGTAACATATCTCAGGAGGAGGG - Intronic
1046223332 8:111243580-111243602 TTTATAAAGTCTGAGGAAAATGG - Intergenic
1046906730 8:119581684-119581706 TTTACCAAGGCTGAGCAGGGTGG - Intronic
1047177381 8:122554578-122554600 TTTAACAACTTTGATGATGAAGG + Intergenic
1047213927 8:122862065-122862087 TTTGACAAAACTGAGGAGGAGGG + Intronic
1047924905 8:129673358-129673380 TTTTAAAAGTGTGAAGAGGAAGG - Intergenic
1050675662 9:8049968-8049990 TTTGAAAAAACTGAGGAGGAGGG - Intergenic
1053347956 9:37391930-37391952 CATAACAAGGCTGAGGATGATGG + Intergenic
1053588620 9:39487096-39487118 TTTAGGAAGGCTGAGGAGGGCGG - Intergenic
1053645084 9:40115447-40115469 TTTACCATGTGGGAGGAGGAGGG + Intergenic
1053760634 9:41348081-41348103 TTTACCATGTGGGAGGAGGAGGG - Intergenic
1054326107 9:63713345-63713367 TTTACCATGTGGGAGGAGGAGGG + Intergenic
1054539489 9:66260524-66260546 TTTACCATGTGGGAGGAGGAGGG - Intergenic
1054577684 9:66878198-66878220 TTTAGGAAGGCTGAGGAGGGCGG + Intronic
1054858448 9:69925836-69925858 TTAAAAAGGTCTGAAGAGGAAGG - Intergenic
1055737753 9:79350545-79350567 TTAAACAAGCTTGGGGAGGAAGG - Intergenic
1059548659 9:115205167-115205189 TTTAATAACTCTGTGGAAGATGG + Intronic
1059960279 9:119558023-119558045 TTTATCAAGTCTCTGGAGGATGG - Intergenic
1060164721 9:121401627-121401649 TTCAAAAAATTTGAGGAGGAAGG + Intergenic
1062207702 9:135346480-135346502 ATTAACATGTCTGAGGACTAAGG + Exonic
1202792885 9_KI270719v1_random:98902-98924 TTTACCATGTGGGAGGAGGAGGG + Intergenic
1186430151 X:9498267-9498289 TTTTATAAGTCAGAGAAGGAAGG + Intronic
1188456255 X:30369914-30369936 TTTTGCGAGTCTGAGGTGGAAGG - Intergenic
1190846461 X:54196812-54196834 TTTATCCAGTTTTAGGAGGAGGG - Exonic
1191601091 X:63008381-63008403 TTCAAGAAATCTGAGGATGAGGG - Intergenic
1193649430 X:84111504-84111526 TTTAACAAGCCAGAAGAGAATGG + Intronic
1194766512 X:97848716-97848738 TTTATCAAGGGTGAGGAGGCTGG - Intergenic
1195567540 X:106360071-106360093 TTCAAAAAATTTGAGGAGGAGGG - Intergenic
1199196983 X:145042838-145042860 TTTATCAAGATTCAGGAGGAAGG + Intergenic
1199507782 X:148585541-148585563 TTTAAGAAGACTGAGTAGGCCGG + Intronic
1199757701 X:150880714-150880736 TTTAACATGTGGGAGGAGAAAGG + Intronic
1200244734 X:154516855-154516877 TTGAGCAGCTCTGAGGAGGAGGG - Intergenic