ID: 1033361426

View in Genome Browser
Species Human (GRCh38)
Location 7:140640993-140641015
Sequence GTGGCTTAACCCTTCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033361417_1033361426 4 Left 1033361417 7:140640966-140640988 CCCCTCGCCTCTCGGGGTGGGGG 0: 1
1: 0
2: 1
3: 18
4: 152
Right 1033361426 7:140640993-140641015 GTGGCTTAACCCTTCCTGGGAGG No data
1033361420_1033361426 2 Left 1033361420 7:140640968-140640990 CCTCGCCTCTCGGGGTGGGGGAG 0: 1
1: 1
2: 1
3: 21
4: 205
Right 1033361426 7:140640993-140641015 GTGGCTTAACCCTTCCTGGGAGG No data
1033361409_1033361426 14 Left 1033361409 7:140640956-140640978 CCGGACTCGCCCCCTCGCCTCTC 0: 1
1: 0
2: 0
3: 22
4: 297
Right 1033361426 7:140640993-140641015 GTGGCTTAACCCTTCCTGGGAGG No data
1033361415_1033361426 5 Left 1033361415 7:140640965-140640987 CCCCCTCGCCTCTCGGGGTGGGG 0: 1
1: 0
2: 5
3: 13
4: 187
Right 1033361426 7:140640993-140641015 GTGGCTTAACCCTTCCTGGGAGG No data
1033361408_1033361426 21 Left 1033361408 7:140640949-140640971 CCTTCTGCCGGACTCGCCCCCTC 0: 1
1: 0
2: 0
3: 8
4: 175
Right 1033361426 7:140640993-140641015 GTGGCTTAACCCTTCCTGGGAGG No data
1033361422_1033361426 -3 Left 1033361422 7:140640973-140640995 CCTCTCGGGGTGGGGGAGAGGTG 0: 1
1: 0
2: 1
3: 34
4: 317
Right 1033361426 7:140640993-140641015 GTGGCTTAACCCTTCCTGGGAGG No data
1033361419_1033361426 3 Left 1033361419 7:140640967-140640989 CCCTCGCCTCTCGGGGTGGGGGA 0: 1
1: 0
2: 2
3: 8
4: 168
Right 1033361426 7:140640993-140641015 GTGGCTTAACCCTTCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033361426 Original CRISPR GTGGCTTAACCCTTCCTGGG AGG Intronic
No off target data available for this crispr