ID: 1033362518

View in Genome Browser
Species Human (GRCh38)
Location 7:140647850-140647872
Sequence CAGAGTCAGGAGAAGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033362513_1033362518 8 Left 1033362513 7:140647819-140647841 CCTACTTTCTGGCCCAACGAGGC 0: 1
1: 0
2: 1
3: 5
4: 71
Right 1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG No data
1033362514_1033362518 -4 Left 1033362514 7:140647831-140647853 CCCAACGAGGCAATCTCTTCAGA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG No data
1033362515_1033362518 -5 Left 1033362515 7:140647832-140647854 CCAACGAGGCAATCTCTTCAGAG 0: 1
1: 0
2: 1
3: 5
4: 71
Right 1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG No data
1033362510_1033362518 13 Left 1033362510 7:140647814-140647836 CCCTGCCTACTTTCTGGCCCAAC 0: 1
1: 0
2: 0
3: 14
4: 190
Right 1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG No data
1033362511_1033362518 12 Left 1033362511 7:140647815-140647837 CCTGCCTACTTTCTGGCCCAACG 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033362518 Original CRISPR CAGAGTCAGGAGAAGGAGTG AGG Intronic
No off target data available for this crispr