ID: 1033363455

View in Genome Browser
Species Human (GRCh38)
Location 7:140654143-140654165
Sequence CTGAATACGCAAAGGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 1, 2: 12, 3: 36, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033363455 Original CRISPR CTGAATACGCAAAGGGACAA TGG (reversed) Intronic
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
902764825 1:18607123-18607145 CTGCAGGAGCAAAGGGACAAAGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG + Intronic
903986524 1:27233292-27233314 CTGAATACTCCCAGAGACAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
912321633 1:108719363-108719385 CTGAACCCAGAAAGGGACAAGGG - Intronic
915921742 1:159980968-159980990 CTGCATACACTAAGGGACCAGGG + Intergenic
916803161 1:168233114-168233136 CTGGATAGGGAATGGGACAACGG - Intronic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918366169 1:183810141-183810163 ATGAATACTCAAAGGGACAGAGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919126061 1:193395304-193395326 CTGAATATGGAAACAGACAATGG + Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
922369371 1:224893858-224893880 CTGAATAGGAAAATAGACAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1065131763 10:22628892-22628914 CTGAATTCCAAAAGGGAAAATGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066760897 10:38751691-38751713 CTGAATAAGGAAAGGCCCAAAGG - Intergenic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1074553241 10:114464501-114464523 CTTATTACCCAAATGGACAAAGG + Intronic
1074658816 10:115627082-115627104 GTGAATACACAAAGTGACACCGG - Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1076409843 10:130239758-130239780 CTACATATGCAAAGGGTCAAAGG - Intergenic
1079131741 11:17750696-17750718 CGGAATAAGCAAAGGCAGAAGGG - Intronic
1080371835 11:31656752-31656774 CTAAATATGCAAAGGGGAAAAGG + Intronic
1081170531 11:39864565-39864587 CTAAATAACCAAAGGGTCAAAGG - Intergenic
1083177499 11:60960401-60960423 GTGAATACCCAAAGAGACGAGGG + Intergenic
1084025450 11:66445629-66445651 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1084025850 11:66448879-66448901 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1085444416 11:76590830-76590852 CTGAAGAAGAAAAGGGTCAAGGG + Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1089016020 11:115166282-115166304 CTGAATATTCAAAGGCACAGAGG + Intergenic
1089531398 11:119132116-119132138 CTGAATCAGCAAAGAGACTATGG - Intronic
1090730618 11:129570500-129570522 ATGAAGATGCAAAGGTACAAGGG - Intergenic
1091115616 11:133010011-133010033 CTGGATATGAAAAGGGACTAGGG - Intronic
1091938272 12:4450756-4450778 CTGAATCTGCAAAGGGGCAGAGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098371120 12:69760780-69760802 CCTAATACGCAGAGGAACAAAGG - Intronic
1100790245 12:98122299-98122321 CTGTATAGGCAAAGGAATAAGGG + Intergenic
1101713042 12:107286504-107286526 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104167527 12:126248397-126248419 CTGAAAAAGCAAAAGAACAATGG + Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104570112 12:129917716-129917738 CTGATTAAGCAATGGGACTATGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1111033068 13:82632776-82632798 ATGAATAAGAAAAGGGAAAAAGG - Intergenic
1111338248 13:86849432-86849454 CTAAATACGAAAAGGAAAAATGG + Intergenic
1112944351 13:104908514-104908536 CTGAATAACCAATGGGTCAATGG - Intergenic
1112989460 13:105494586-105494608 CATAATACACAAAGGGACACAGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115303461 14:31910896-31910918 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1117243940 14:53864658-53864680 TTGAAGACTCAAAGGGAGAAGGG - Intergenic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1118395130 14:65329754-65329776 CTGAATACTCAAAGAGAGGAAGG + Intergenic
1118680822 14:68239790-68239812 ATGTATACTTAAAGGGACAATGG - Intronic
1121665586 14:95669725-95669747 CAGCATACGCAAAGGCAGAAAGG - Intergenic
1121961895 14:98267819-98267841 CTGAACAAGCAAAGGAAGAAGGG - Intergenic
1122294900 14:100699917-100699939 CTAAATATCCAAAGGGACAGTGG - Intergenic
1122364193 14:101184538-101184560 CTCAATAGGAAAATGGACAAAGG - Intergenic
1202921255 14_KI270723v1_random:32005-32027 CTGGATCTGCAAAGGGACTAGGG + Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1126166072 15:45654982-45655004 CTGACAAAGCAAAGGGAAAATGG + Intronic
1126338378 15:47612199-47612221 CCAAACATGCAAAGGGACAATGG - Intronic
1127523813 15:59772130-59772152 TTGACTACGCTAAGGAACAATGG + Intergenic
1127839277 15:62816720-62816742 ATGAATAAGCAAAGGGTTAAAGG - Intronic
1128869777 15:71145619-71145641 CTGAATACAGAAAGGAAGAAAGG + Intronic
1129488960 15:75904468-75904490 CTGAGGACGCAAACGCACAAAGG - Intronic
1129834632 15:78694401-78694423 TAGAATCCGCAAAGGGAAAAGGG - Intronic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1134811767 16:17173575-17173597 CTCAATGCACACAGGGACAAAGG + Intronic
1135089236 16:19499757-19499779 CTGAAGAAGCACAGGGACTAAGG + Intergenic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1138027293 16:53532050-53532072 CTGAATATCCCAAGGGACACAGG + Intergenic
1138537938 16:57669679-57669701 ATGAATGCGCAAATGGAGAATGG - Intronic
1138600472 16:58051246-58051268 CTGAATTCCAAAAGGGAAAAGGG + Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1141346031 16:83246932-83246954 ATGGATACGCAAAGGCACCAAGG - Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144060662 17:11581123-11581145 CTGAATATGCAAGCAGACAATGG + Intergenic
1151920187 17:77148719-77148741 GTGAGTGCGCAAAGGAACAAGGG - Intronic
1152435040 17:80271350-80271372 CTGAGTACTCAAAGGGAAAAAGG + Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155864344 18:30945797-30945819 CTGAATCCACAAAGGGATAGTGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157427321 18:47595093-47595115 GTGAATCCGGAAAGGGAGAAGGG + Intergenic
1158098076 18:53797786-53797808 TTGAATAAGTAAAGGGGCAAAGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158894754 18:61902334-61902356 CTGCATAAGGAAAGGTACAAAGG - Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1167983393 19:53295156-53295178 CTAAATAGGTAAAGGCACAATGG + Intergenic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
931928091 2:67097080-67097102 CTGCATATGCAAAGGGTCAGAGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
936481198 2:112886375-112886397 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
940158961 2:150691441-150691463 GTGAAAAAGCAAAGTGACAATGG - Intergenic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945592457 2:211750708-211750730 CAGAACACGAAAAGGGAAAAAGG + Intronic
946026389 2:216674202-216674224 CTCAAGATGCAAAGGGAGAATGG + Exonic
1169548945 20:6681486-6681508 ATGAATAAGCAAAGAGAGAAAGG - Intergenic
1170056575 20:12211495-12211517 CTGAACAAGCAAAGGGAAACAGG + Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1170823772 20:19776206-19776228 CTGAATTCCCAAAGGGAGGAGGG - Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1173039597 20:39449841-39449863 CTGAAGACGCACAGGGTTAATGG + Intergenic
1173650072 20:44657823-44657845 CTGAATAAGAAAGAGGACAAGGG + Intergenic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1182559872 22:31151293-31151315 ATGAACACTTAAAGGGACAAAGG - Intergenic
1183096067 22:35553047-35553069 CTGAATTTGCTAGGGGACAAAGG - Exonic
949216390 3:1574201-1574223 CAGTATATGCAAAGGCACAAAGG - Intergenic
950938153 3:16864355-16864377 CTGGAAACGAAAAGGGAAAATGG - Intronic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953575461 3:44109849-44109871 CTGAATACGCTAAGTGAAAAGGG - Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956396416 3:68831325-68831347 CTAAACATGGAAAGGGACAACGG - Intronic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
960553276 3:119000705-119000727 TTGAAGACTCAAAGGGAGAAGGG + Intronic
961957441 3:130818564-130818586 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
962973941 3:140429839-140429861 CTCCATAGGCAAAGGGACAAAGG + Intronic
965370173 3:167852334-167852356 CTGAGTACACAAAGGGAAATAGG + Intergenic
965540867 3:169870291-169870313 ATGAATATGCAAAGAGAAAAAGG - Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
972055960 4:34804134-34804156 CTGAATACCAAAAGGAACTAAGG - Intergenic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
973832944 4:54780161-54780183 CTGAGTATGGAAAAGGACAATGG - Intergenic
974631103 4:64490117-64490139 ATGAATATGAAGAGGGACAATGG - Intergenic
975004142 4:69266665-69266687 CTGAATGCGCAAAAGCTCAAAGG + Intergenic
975012549 4:69375630-69375652 CTGAATGCGCAAAAGCTCAAAGG + Intronic
975599258 4:76082297-76082319 CTGAATATGCCAAGGTAAAATGG - Exonic
975755548 4:77568103-77568125 CTGGTAACACAAAGGGACAATGG + Intronic
980492023 4:133540737-133540759 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
984549425 4:181142913-181142935 CTAAAGGCGCAAAGGGACAGTGG - Intergenic
986461354 5:7975691-7975713 TTGAATACACCAAGGGACAATGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987048645 5:14130720-14130742 CTGAAAGAGAAAAGGGACAATGG + Intergenic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
992688735 5:79222805-79222827 GTGAATTAGCAAAGGGAGAAAGG + Intronic
995594347 5:113731725-113731747 CTGAATTCTAAAAGGGAGAAGGG + Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997575122 5:134969474-134969496 CTGAATACCCCAAGAGAAAATGG - Exonic
999004039 5:147956321-147956343 CTGAATGAGAAAAGGAACAAGGG + Intergenic
1000898143 5:166881116-166881138 CTGAAAATGGAAAAGGACAAAGG - Intergenic
1002360887 5:178669907-178669929 CGGAATAGACTAAGGGACAAAGG + Intergenic
1004045526 6:12019241-12019263 CTGAGTAAGCAAAGGGACAGAGG + Intronic
1004091420 6:12506296-12506318 GTGAATATGCATAGCGACAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004831161 6:19477864-19477886 ATGAATACCCAAAGGTACAGAGG - Intergenic
1008193692 6:48492002-48492024 CTGAAAACACAAAGAAACAAGGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011954470 6:93008964-93008986 CTGAATATGCAAAGAAGCAATGG + Intergenic
1012205797 6:96458911-96458933 CTGAATTCCAAAAGGGACGAGGG + Intergenic
1012207187 6:96476242-96476264 CTAAATATGGAAAGGAACAATGG - Intergenic
1012569457 6:100704447-100704469 CTTTATAGGCAAAGGGCCAATGG + Intronic
1012875178 6:104717848-104717870 CTCGATAGGCAAATGGACAAAGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014297345 6:119636201-119636223 ATGCATACTCAAAGGGACACTGG - Intergenic
1014593453 6:123302398-123302420 CTGAATATGCAAAGGATCAATGG - Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015207947 6:130662085-130662107 CTGAATGTGCAACGGAACAAAGG + Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017615124 6:156238874-156238896 CTTAATACGCAAACTGACATTGG + Intergenic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018091472 6:160349359-160349381 CTCAAAATGCAAGGGGACAAAGG + Intronic
1019073305 6:169367209-169367231 CTGGGTACGCAGAGGCACAAAGG - Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1021596387 7:22321687-22321709 CAGAATAGGAAAAGGGACAGTGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025962897 7:66239352-66239374 GGAAATACGCAAAGGGACAATGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029087320 7:98021774-98021796 CTGAAAACGGAGGGGGACAATGG - Intergenic
1029343912 7:99965122-99965144 ATGAATACCCAAAGCGACATTGG + Intergenic
1032283319 7:130523614-130523636 CTGAAAAGGCAATGGGACCACGG + Intronic
1032284061 7:130527839-130527861 CTGAAAAGGCAATGGGACCACGG + Intronic
1032375183 7:131407721-131407743 CAGCATACACAAAGGCACAAAGG - Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035556242 8:569297-569319 CCGAATATGCAAACAGACAAGGG - Intergenic
1036575912 8:10027551-10027573 CTGAAGACCCAGAGGTACAAGGG + Intergenic
1037421906 8:18711141-18711163 CTGAATATGGAAAGGGAAAATGG + Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1041185398 8:55294922-55294944 CTTAATGTGCAAAGGGACACTGG - Intronic
1042209462 8:66365130-66365152 CTGAATACAGAGAGGAACAAAGG - Intergenic
1042568163 8:70133559-70133581 CTGAATACTAAAAGGGAAAATGG + Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044511313 8:93082859-93082881 CAGATTACTCAAAGGGATAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044821636 8:96159542-96159564 CTTAATACACAAAGGTACATGGG - Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1047819105 8:128499040-128499062 CTGGAGACCAAAAGGGACAATGG + Intergenic
1047848856 8:128834323-128834345 CTGAATAAGAAAAGGGGTAAAGG + Intergenic
1047981526 8:130188184-130188206 CTGAAAAAGCAAAGGGAAGATGG + Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049713436 8:144078094-144078116 CTGCATCCTCAAAGGGAAAAGGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051205164 9:14680994-14681016 CAGAATAAGCAAAGGCATAAAGG + Intronic
1052029270 9:23609977-23609999 CTGAGCAAGCAAAGGGGCAAAGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1055641924 9:78325496-78325518 CTGCATCTGCAAAGGCACAAAGG - Intronic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1189188081 X:39071140-39071162 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1189799051 X:44675260-44675282 CTCAATCAGCAAAGGGAGAAAGG - Intergenic
1191753333 X:64567370-64567392 CAGCATAAGCAAAGGCACAAAGG - Intergenic
1192383493 X:70640772-70640794 CTGAACATGGAAAGGAACAACGG + Intronic
1192808573 X:74530668-74530690 CTGAGTAAGCAAAAGGCCAAGGG + Intronic
1193517328 X:82483270-82483292 CAGAATATGCTAAGTGACAAGGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194127250 X:90035165-90035187 CTGAATAATCAATGGGTCAAAGG - Intergenic
1194270574 X:91809370-91809392 CTAAATAGGCTAAGTGACAAAGG - Intronic
1200587807 Y:5030803-5030825 CTAAATAGGCTAAGTGACAAAGG - Intronic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1202024870 Y:20510940-20510962 CTGTATCCTCAAAGGGCCAATGG - Intergenic