ID: 1033366813

View in Genome Browser
Species Human (GRCh38)
Location 7:140678340-140678362
Sequence ACACCTGGATGTGGCCCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033366813_1033366823 23 Left 1033366813 7:140678340-140678362 CCCACCGGGCCACATCCAGGTGT 0: 1
1: 0
2: 1
3: 12
4: 81
Right 1033366823 7:140678386-140678408 CTGGCATTGAGGTCTGACCTGGG No data
1033366813_1033366824 24 Left 1033366813 7:140678340-140678362 CCCACCGGGCCACATCCAGGTGT 0: 1
1: 0
2: 1
3: 12
4: 81
Right 1033366824 7:140678387-140678409 TGGCATTGAGGTCTGACCTGGGG 0: 1
1: 0
2: 4
3: 14
4: 161
1033366813_1033366820 4 Left 1033366813 7:140678340-140678362 CCCACCGGGCCACATCCAGGTGT 0: 1
1: 0
2: 1
3: 12
4: 81
Right 1033366820 7:140678367-140678389 GGATATATCACTCTGGAGACTGG No data
1033366813_1033366822 22 Left 1033366813 7:140678340-140678362 CCCACCGGGCCACATCCAGGTGT 0: 1
1: 0
2: 1
3: 12
4: 81
Right 1033366822 7:140678385-140678407 ACTGGCATTGAGGTCTGACCTGG No data
1033366813_1033366821 12 Left 1033366813 7:140678340-140678362 CCCACCGGGCCACATCCAGGTGT 0: 1
1: 0
2: 1
3: 12
4: 81
Right 1033366821 7:140678375-140678397 CACTCTGGAGACTGGCATTGAGG No data
1033366813_1033366819 -3 Left 1033366813 7:140678340-140678362 CCCACCGGGCCACATCCAGGTGT 0: 1
1: 0
2: 1
3: 12
4: 81
Right 1033366819 7:140678360-140678382 TGTCATTGGATATATCACTCTGG 0: 1
1: 0
2: 6
3: 137
4: 1375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033366813 Original CRISPR ACACCTGGATGTGGCCCGGT GGG (reversed) Intronic