ID: 1033369762

View in Genome Browser
Species Human (GRCh38)
Location 7:140697227-140697249
Sequence GCCTAGGGAGGGCGCGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033369753_1033369762 9 Left 1033369753 7:140697195-140697217 CCTGGAGCGAGGCGGGGGGCGGC 0: 1
1: 0
2: 16
3: 385
4: 2163
Right 1033369762 7:140697227-140697249 GCCTAGGGAGGGCGCGGTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033369762 Original CRISPR GCCTAGGGAGGGCGCGGTCC AGG Intronic
900464556 1:2818946-2818968 GCCTAGGAATGGCGCTGTCCAGG - Intergenic
901138058 1:7010282-7010304 GCCGAGTGAGGGGGCGGCCCAGG - Intronic
901238365 1:7679506-7679528 GCCTGGGGTGGCCGAGGTCCCGG - Intronic
901875961 1:12167243-12167265 GCCCCGGGAGAGCGCGGCCCGGG - Intronic
902690629 1:18108255-18108277 GCCGGGGGAGGGCGCTGGCCGGG + Intronic
903237060 1:21956952-21956974 GCCGGGGGAGGGCCAGGTCCAGG - Intergenic
904591453 1:31617744-31617766 GCCTAGGGAGGGGGCTGCCCCGG + Exonic
910935688 1:92483656-92483678 GCGGAGGGAGAGCGCGGGCCAGG + Intronic
915466591 1:156102065-156102087 GACTAGGGAAGGCGAGGGCCTGG - Intronic
920653099 1:207853199-207853221 GCCTAGGGAGGGTGGAGTCCCGG - Intergenic
922539384 1:226407707-226407729 GCCCAGGGAGCGAGCGGGCCCGG - Intronic
1067565147 10:47331054-47331076 GCCTAGGGAGGGGAGAGTCCAGG - Intergenic
1069604697 10:69731917-69731939 GCCTGTGGAGGGGGCGGGCCAGG - Intergenic
1069607953 10:69752050-69752072 GCCAAGGGATGGTGCGGCCCAGG - Intergenic
1070257580 10:74825377-74825399 GACTGGGGCGGGCGGGGTCCGGG + Intergenic
1071328763 10:84540989-84541011 GGAGAGGGAGGGCGCGGTGCGGG + Intergenic
1071618298 10:87095289-87095311 GCCCAGGGAGGTCGGGGTCGGGG + Intronic
1076209950 10:128632402-128632424 GCCCAGGGAGGGTGCGGAGCAGG + Intergenic
1076882676 10:133247300-133247322 GTCTGGGGAGGACGTGGTCCAGG - Intergenic
1077307857 11:1875942-1875964 CCCCAGGGAGGGGGCAGTCCAGG - Intronic
1080836538 11:35945041-35945063 GCCAAGGGCGGGCCCAGTCCAGG - Intronic
1081866157 11:46361797-46361819 GCCTAGGGATGGTGGGGCCCGGG - Intronic
1083747056 11:64742551-64742573 GCGAAGGGAGGGCCGGGTCCCGG - Intronic
1083843516 11:65317487-65317509 GCCTGGGGAGGGAGTGGTACAGG + Intronic
1087077950 11:94142857-94142879 CCCTGGGGAGGGCGTGCTCCTGG + Intronic
1091996032 12:4994800-4994822 GCCTAGGCAGGGTGAAGTCCTGG - Intergenic
1092062597 12:5563612-5563634 GCCTGGGGAGGTGGCGGCCCTGG + Intronic
1092617821 12:10231689-10231711 GCATAGGGAGGGGGCGGTGGGGG - Intergenic
1098828893 12:75334628-75334650 GCCAAGGGAGAGCGTGGTGCGGG + Intronic
1098973564 12:76879248-76879270 CCTTTGGGAGGGAGCGGTCCCGG - Intergenic
1102011486 12:109621902-109621924 GCCCAAGGTGGGCGGGGTCCAGG + Intergenic
1102253895 12:111405502-111405524 GCCTAGGGCGGGCAGGGTCGAGG - Intergenic
1105011956 12:132761955-132761977 GCCCGGCGAGGGCGCGGCCCCGG + Intergenic
1113294812 13:108947348-108947370 GCCTAGGGAGGGTTCTGTACAGG - Intronic
1116865052 14:50025130-50025152 GCCTGGGGAGAGGGCGCTCCTGG - Intergenic
1118728839 14:68652420-68652442 GGCTGGGGAGGGGGCCGTCCAGG - Intronic
1119194778 14:72709259-72709281 GCCTTGAGAGGGCCCGCTCCTGG + Intronic
1122445158 14:101762187-101762209 GTGGAGGGAGGGCGCGGCCCGGG + Intronic
1122734905 14:103832730-103832752 GCCAAGGGGGGGCGGGGTGCAGG + Intronic
1123031895 14:105455898-105455920 GCCTGGGGAGGCCGCTGTGCTGG + Intronic
1125723712 15:41857380-41857402 GCCTGGGGTGGGCGAGCTCCTGG - Exonic
1128770231 15:70276568-70276590 GCCCAGGGATGGTGAGGTCCTGG - Intergenic
1131053621 15:89363119-89363141 GGCTAGGGAGAGGGCGATCCTGG - Intergenic
1132669455 16:1096667-1096689 GCCTGGGGAGGCTGCGCTCCTGG - Intergenic
1133242862 16:4425968-4425990 GCCCAGGGAGGGCGTGGTGGGGG + Exonic
1133738256 16:8631940-8631962 CCCTGGGCCGGGCGCGGTCCAGG - Intronic
1135040541 16:19114218-19114240 GCCGGGGCAGGGCGCGGCCCGGG + Intronic
1135517790 16:23149624-23149646 GTCTAGTGTGGGCGCCGTCCCGG + Intergenic
1137600305 16:49751951-49751973 GCCCAGGGAGGGCAAGGTCTTGG + Intronic
1137673528 16:50292619-50292641 GCCTCGGGAGGGCATGGGCCAGG + Intronic
1139740592 16:69032014-69032036 ACCTAGGGAGGGAGCATTCCAGG + Intronic
1147686353 17:42288793-42288815 GGCCAGGGAGGGCGCCGTCCTGG + Intronic
1148339151 17:46863107-46863129 GGCTAGGGAGGGCGTGGCACAGG + Intronic
1148868586 17:50642334-50642356 TCCTAGGGAGGGCCCTGCCCAGG + Intronic
1151557736 17:74855022-74855044 GCCTGGGCAGGGCTGGGTCCGGG - Exonic
1152768086 17:82151734-82151756 GCCTATGGAGGCCGAGGACCAGG - Intronic
1153810842 18:8750396-8750418 GCCTGGAGAGAGCCCGGTCCTGG + Intronic
1154207639 18:12351336-12351358 GCCTAAGCAGCGCGGGGTCCAGG + Exonic
1156476393 18:37408490-37408512 GCCGGGGGGGGGCGCGGTGCAGG + Intronic
1156501857 18:37565231-37565253 GCCTCGGGCGGGCGCGGTGGAGG - Intronic
1157862620 18:51154363-51154385 GCCTAAGGAAGGCTCAGTCCAGG - Intergenic
1160516047 18:79479842-79479864 GCCTGGGGAAGGCCCGGTCCCGG + Intronic
1160540310 18:79617333-79617355 TCCCGGGGAGGGCGGGGTCCCGG - Intergenic
1160540349 18:79617398-79617420 TCCCGGGGAGGGCGGGGTCCCGG - Intergenic
1160540389 18:79617464-79617486 TCCCGGGGAGGGCGGGGTCCCGG - Intergenic
1160566167 18:79788000-79788022 GCCCCGGGAGAGCGGGGTCCCGG + Intergenic
1160607082 18:80059330-80059352 GCCTCGGGAGGGTGGGGTGCAGG - Intronic
1160765304 19:804953-804975 GGCCAGGGCGGGCGCCGTCCCGG - Intronic
1160951884 19:1671823-1671845 GCCGGGGGAGGGCGCGGTGGGGG - Intergenic
1161323784 19:3653272-3653294 GCCTGGTGAGGGCTCGGCCCCGG - Exonic
1161744608 19:6048053-6048075 GCTTGGGGAGGGGGCGCTCCTGG - Intronic
1161864316 19:6822351-6822373 GCCTGGGGAGGGCGTGGGCGGGG + Intronic
1162100303 19:8334971-8334993 GCGCAGCGAGGGCGCGCTCCAGG - Exonic
1163666648 19:18606731-18606753 GGCGCGGGAGGGCGCGGGCCAGG + Exonic
1164575849 19:29404888-29404910 GCCTGGGGAGGGGGCGGTGCCGG + Intergenic
1166393694 19:42424001-42424023 GCCTGGGGTGGGGGCGGGCCAGG + Intronic
1167646496 19:50708496-50708518 GCCTGGGGAGGGCGAGGGCGGGG - Intronic
1168654633 19:58118255-58118277 GCCTAGTGAGGGTGGGGTCAAGG - Intronic
925781356 2:7384966-7384988 GGCTGGGGTGGGCGCGGTGCCGG + Intergenic
926140680 2:10366082-10366104 GCCCAGGGAATGGGCGGTCCAGG - Intronic
926141040 2:10368648-10368670 GCCTGGGGAATGGGCGGTCCAGG - Intronic
928949610 2:36803095-36803117 GCACAGGGAGGGCGTGGTTCTGG - Intronic
930185750 2:48410741-48410763 ACCTGGGGAGGGCGCTGGCCTGG + Intergenic
935984789 2:108662059-108662081 GCCTTAGGAGAGCTCGGTCCAGG + Intronic
936137224 2:109905710-109905732 GCCTTAGGAGAGCTCGGTCCAGG + Intergenic
936207473 2:110465775-110465797 GCCTTAGGAGAGCTCGGTCCAGG - Intronic
944383312 2:199136913-199136935 GCCTAAGGAGGGAGCAGACCTGG - Intergenic
947841238 2:233209120-233209142 GCCTAGGGAGAAAGTGGTCCGGG - Intergenic
947860738 2:233355257-233355279 GCCAAGCGGGTGCGCGGTCCCGG - Intronic
947873279 2:233451416-233451438 GCGCAGGGAGGGTGAGGTCCTGG + Intronic
948209005 2:236178718-236178740 GCCTAGGGAAGGCGGAGTCTGGG + Intergenic
948862010 2:240757210-240757232 GCCCTGGGAGGGCCCGGGCCAGG + Intronic
1172229353 20:33326550-33326572 GGCTAGAGAGGGCGGGGCCCTGG + Intergenic
1173939079 20:46894788-46894810 GCAGAGGGAGGGCCCGGCCCAGG + Exonic
1174353690 20:49984674-49984696 GGCTAGGGAGGGGGCGGACCCGG - Intronic
1175216411 20:57393648-57393670 GCCTAGGGTGGGCCTGGTGCAGG + Intronic
1175340989 20:58228755-58228777 GCGTCTGGAGGGGGCGGTCCTGG - Intergenic
1176261380 20:64182660-64182682 GGCCAGGGAGGGCTGGGTCCAGG - Intronic
1179918837 21:44496138-44496160 GCATAGGGAGGTCGGGGGCCTGG + Intergenic
1180722598 22:17920516-17920538 GCCAGGGGAGGGCGGGTTCCAGG - Intronic
1180939042 22:19644932-19644954 CCCTGGGGAGGGAGAGGTCCAGG - Intergenic
1181270638 22:21656767-21656789 GACAAGGGAGGACGCAGTCCAGG + Intronic
1185222464 22:49635943-49635965 GCCTGGGGAGGGGAGGGTCCAGG + Intronic
1185254924 22:49826966-49826988 GCCCGGGGAGGCCGCGGTGCCGG + Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
954735853 3:52706038-52706060 GCCTAGCGATGGCGCGGGGCGGG + Exonic
961649470 3:128410262-128410284 GGCTGGGGAGGGAGCGGTCAGGG - Intergenic
967888006 3:194346259-194346281 GCCCACGGAGGCCGGGGTCCTGG + Intronic
967924193 3:194633420-194633442 GGGTGGGGAGCGCGCGGTCCCGG - Exonic
968427202 4:531964-531986 GACCAGGGAGGGCTGGGTCCTGG - Intronic
969422111 4:7103470-7103492 GCCAAGGAAGGGCGGGGTTCGGG - Intergenic
970397217 4:15681321-15681343 GGCTGGGGCGGGCGCGGGCCGGG + Intronic
974029415 4:56762726-56762748 GCAAAGGCAGGGCGCAGTCCAGG + Intergenic
976431220 4:84965949-84965971 TCCTGGGGAGGGCGCCGTCGCGG - Intronic
985532582 5:442922-442944 CCCCAGGGCGGGCGCAGTCCTGG - Exonic
987074492 5:14368034-14368056 GCCAAGGGAGGGTGTGGTCAGGG - Intronic
993646827 5:90473573-90473595 GGCTAGGGAGGGGGTGGTGCCGG + Intronic
1002316896 5:178349511-178349533 GCCTAGGGAGGGCCAGGTGTGGG - Intronic
1005854568 6:29851230-29851252 GCCTAGGCAGGGAGGGGACCAGG + Intergenic
1006836012 6:36999244-36999266 CCCTAGTGAGGGCGCTGTCTGGG - Intergenic
1007635635 6:43298189-43298211 GGCTGGGGAGGGCCCAGTCCTGG + Intronic
1017132022 6:151115610-151115632 GCTGAGGGAGGGCACGGTGCTGG - Intergenic
1018368817 6:163149270-163149292 GCCTGGGGAGGGCCGGGGCCTGG - Intronic
1018774077 6:166998442-166998464 TCCAAGGCAGGGCTCGGTCCGGG + Intergenic
1020224840 7:6272271-6272293 GCCGAGGGAGGGGGCGGGCCGGG - Intronic
1024453842 7:49580295-49580317 TTCTAGGAAGGGCGCAGTCCCGG + Intergenic
1026508510 7:71007359-71007381 GCCTGGGGAAGGCTCTGTCCTGG + Intergenic
1027232641 7:76281664-76281686 GCCCCGGGGGGGCGCGGGCCGGG - Exonic
1033369762 7:140697227-140697249 GCCTAGGGAGGGCGCGGTCCAGG + Intronic
1034073842 7:148213436-148213458 GCCTAGGGAGGGAAGGGTCTGGG - Intronic
1035417935 7:158705087-158705109 GCGGAGGGAGTGCGCGGTCCAGG + Intergenic
1037121306 8:15290485-15290507 GCCCAAGGAGGGCACTGTCCTGG + Intergenic
1038253000 8:25923716-25923738 GCCTAGTGAGGGCCAGGTCATGG + Intronic
1039417848 8:37410721-37410743 GCCTAGGGAGGCTGGGGTCACGG + Intergenic
1039958226 8:42223489-42223511 GGCAAGGGAGGGCGCTGGCCTGG - Intergenic
1042127919 8:65557613-65557635 GCTGAGGGAGGCCGCGATCCAGG - Intergenic
1049218275 8:141417624-141417646 TTCTAGGGAGGGCGCGCACCGGG + Intronic
1049470789 8:142774220-142774242 GCCTGGGGCCGGCGCGGGCCTGG - Intronic
1053280767 9:36818675-36818697 GCCGCTGGAGGGGGCGGTCCAGG - Intergenic
1057412071 9:94825546-94825568 GCCTAGGGAGGGCGCTCCCCTGG - Intronic
1060152830 9:121299742-121299764 CCCCAGGGAGGGCGCGGGGCGGG - Intronic
1061633357 9:131888429-131888451 GCTTAGGGAGCGCGCAGCCCCGG - Intronic
1062656360 9:137606037-137606059 GCCGAGGGGCGGCGGGGTCCCGG + Intronic
1062733075 9:138120248-138120270 GGCTAGGGGGTGGGCGGTCCGGG - Exonic
1203792696 EBV:160173-160195 CCCAGAGGAGGGCGCGGTCCCGG - Intergenic
1189310403 X:40013964-40013986 GCCCGGGGAGGGGGCGCTCCGGG + Intergenic
1190119975 X:47651322-47651344 GACTAGGGAGAGCGGGATCCAGG + Intergenic
1190265921 X:48827100-48827122 GCGCAGGGAGGCCGCGGCCCTGG - Intergenic