ID: 1033380732

View in Genome Browser
Species Human (GRCh38)
Location 7:140815476-140815498
Sequence TCGCACCATTGCACAAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 1, 2: 12, 3: 75, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033380732_1033380737 16 Left 1033380732 7:140815476-140815498 CCCAGGCTTGTGCAATGGTGCGA 0: 1
1: 1
2: 12
3: 75
4: 226
Right 1033380737 7:140815515-140815537 ACTCCACTTCACAGGTTCAAGGG 0: 1
1: 0
2: 63
3: 574
4: 1707
1033380732_1033380735 8 Left 1033380732 7:140815476-140815498 CCCAGGCTTGTGCAATGGTGCGA 0: 1
1: 1
2: 12
3: 75
4: 226
Right 1033380735 7:140815507-140815529 CACTGCAAACTCCACTTCACAGG 0: 1
1: 71
2: 4112
3: 56319
4: 149399
1033380732_1033380736 15 Left 1033380732 7:140815476-140815498 CCCAGGCTTGTGCAATGGTGCGA 0: 1
1: 1
2: 12
3: 75
4: 226
Right 1033380736 7:140815514-140815536 AACTCCACTTCACAGGTTCAAGG 0: 1
1: 0
2: 69
3: 634
4: 1958

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033380732 Original CRISPR TCGCACCATTGCACAAGCCT GGG (reversed) Intronic
900508306 1:3042037-3042059 TCACACCACTGCAACAGCCTGGG - Intergenic
901285956 1:8079187-8079209 TCGTGCCACTGCACCAGCCTGGG + Intergenic
901406398 1:9049656-9049678 TGGCCCCACTGCACCAGCCTGGG + Intronic
901588078 1:10315220-10315242 TTGCACCATTGCTCTAGCCTGGG - Intronic
901810271 1:11763398-11763420 TCACGCCATTGTACCAGCCTGGG + Intronic
901950492 1:12741683-12741705 TCGCACCACAGCTCCAGCCTAGG - Intergenic
902294119 1:15454679-15454701 TCTCACCTTTGCACCATCCTAGG + Intergenic
902296933 1:15474076-15474098 TCTCACCTTTGCACCATCCTAGG + Intronic
903067418 1:20708336-20708358 TCGCACCACTGCACTACCCAGGG - Intronic
903492661 1:23741468-23741490 TCGCACCACTGCTCCAGCCTGGG - Intergenic
903704764 1:25277717-25277739 TCGCACCACTGCACTCCCCTGGG - Intronic
903722468 1:25415605-25415627 TCGCACCACTGCACTCCCCTGGG + Intronic
903967323 1:27099021-27099043 TCTGACTATTGCACAATCCTGGG + Exonic
904544845 1:31261304-31261326 TTGCACCATTGCTCCAACCTGGG + Intronic
905215379 1:36402956-36402978 TCACACCACTGCACTAGCCTGGG - Intergenic
905435171 1:37950871-37950893 TCGCGCCACTGCATAAGCCTGGG + Intergenic
906133936 1:43482019-43482041 TCACGCCATTGCTCCAGCCTGGG - Intergenic
906617870 1:47247211-47247233 TCGCGCCACTGCACGCGCCTGGG - Intergenic
907404609 1:54246242-54246264 CCGCAGCATTGCAGAAGCTTGGG + Intronic
911112576 1:94206849-94206871 TCACACCACTGCACCAGCCCAGG + Intronic
912521747 1:110250460-110250482 TGGCACCACTGCACAAGCCTGGG + Intronic
913381466 1:118215938-118215960 TCGCGCCACTGCACTAGCCTGGG - Intergenic
914682734 1:149950834-149950856 TCGCGCCACTGCTCCAGCCTGGG - Intronic
914855378 1:151346749-151346771 CCTCACCATTGCATATGCCTGGG + Intronic
915224086 1:154399201-154399223 TGGCGCCACTGCACCAGCCTGGG + Intergenic
915484977 1:156213954-156213976 TCGCGCCACTGCTCCAGCCTGGG - Intronic
916535638 1:165700638-165700660 TGGCACCACTGCTCCAGCCTGGG + Intergenic
916573079 1:166044166-166044188 TCGCACCACTGCACCAGGCTGGG - Intergenic
916949192 1:169761633-169761655 TTGCATCACTGCACCAGCCTGGG - Intronic
917336635 1:173930234-173930256 TCGCACCACTACACCAGCCTGGG - Intergenic
920926875 1:210349693-210349715 TGGTACCATTGCTCTAGCCTGGG - Intronic
921654401 1:217717564-217717586 TCACACCACTGCCCTAGCCTGGG + Intronic
922020293 1:221697719-221697741 TTGCACCACTGCACCAGCCTGGG - Intergenic
923720100 1:236459655-236459677 TGGCACCATTGCTCCAGGCTGGG - Intronic
924232006 1:241970232-241970254 TTGCACCACTGCACCAGCCTGGG - Intergenic
1063157161 10:3390643-3390665 TCTTACCATTGCACAAGCAGTGG + Intergenic
1063533030 10:6854090-6854112 TCGCACCACTGCTCCAGCTTGGG + Intergenic
1066303646 10:34118387-34118409 TCACACCACTGCACTTGCCTGGG - Intronic
1069934950 10:71908889-71908911 TTGCACCACTGCACCAGCCTGGG + Intergenic
1070436784 10:76401595-76401617 TCCCACCATGGCAGAGGCCTGGG + Intronic
1070718763 10:78741925-78741947 TTGCACAATTGCACAGGCCTCGG + Intergenic
1072276102 10:93824932-93824954 TCACGCCACTGCACAAGCCTGGG + Intergenic
1073378785 10:103061346-103061368 TCGCGCCACTGCTCCAGCCTGGG + Intronic
1074757043 10:116631805-116631827 TAGCACCACTGCACCAGCCTGGG + Intronic
1075339822 10:121637804-121637826 TTGCACCACTGCACCAGCCCGGG - Intergenic
1075592341 10:123702084-123702106 TCACGCCATTGCTCCAGCCTTGG - Intergenic
1075995262 10:126871858-126871880 TCGCGCCACTGCACTCGCCTGGG + Intergenic
1078336347 11:10466215-10466237 TCGCACCATTGCACTGAGCTTGG + Intronic
1078956848 11:16207548-16207570 TCGCACCACTGCACCCACCTTGG + Intronic
1080502349 11:32882772-32882794 TCACACCACTGCACCAGCCTGGG + Intergenic
1082016926 11:47496399-47496421 TGGCACCATAGCAAAAGCTTGGG - Intronic
1083655673 11:64228225-64228247 TGCCACCACTGCACTAGCCTGGG - Intronic
1083820233 11:65166450-65166472 TCGCGCCACTGCTCCAGCCTGGG - Intergenic
1086156471 11:83672227-83672249 TGGCACCATTGCAGTAGCCTGGG - Intronic
1086385740 11:86305429-86305451 TCGCGCCATTGCACCAGCCTGGG - Intronic
1087776368 11:102260492-102260514 TCTCACCAATGTACAAACCTTGG - Intergenic
1091383664 12:78345-78367 TCGCACCATCACACTAGCCCCGG - Intronic
1091860204 12:3774440-3774462 TCGTGCCACTGCACCAGCCTGGG + Intergenic
1092023067 12:5218165-5218187 TCGCACCTTTCCACAACCCCTGG + Intergenic
1092269328 12:7010457-7010479 TCACATCACTGCACCAGCCTGGG - Intronic
1093454679 12:19353502-19353524 TCGCACCATTGCACCAGCGTGGG - Intronic
1093925687 12:24906143-24906165 TCACACCACTGCACTTGCCTGGG + Intronic
1093932131 12:24964852-24964874 TTGTACCACTGCACAAGCCTGGG - Intergenic
1096285319 12:50294977-50294999 TCGTGCCATTGCACCAGCCTGGG - Intergenic
1097443853 12:59645552-59645574 ACTCACCATTGCACAGGGCTGGG - Intronic
1097984689 12:65770826-65770848 TCGCACCACTGCACTTCCCTGGG + Intergenic
1098228206 12:68346506-68346528 TCGTGCCATTGCACCAGCCTGGG - Intergenic
1098241609 12:68472990-68473012 TCACACCACTGCACCAGCCTGGG - Intergenic
1098893746 12:76034180-76034202 TCGCACCACTATACAAGCCTGGG + Intergenic
1099850956 12:88096906-88096928 TCACACTATTGAACAAGCCTGGG - Exonic
1100616590 12:96235870-96235892 TCTCACCACTGCATCAGCCTGGG - Intronic
1101014712 12:100488043-100488065 TTGCACCACTGCACTAACCTGGG - Intronic
1102979862 12:117232910-117232932 TCGCACCACTGCACTCGCCTGGG - Intronic
1103048602 12:117760062-117760084 TCCCACCACTGCTCCAGCCTGGG + Intronic
1103765312 12:123275320-123275342 TGGCACCATTGCTCCAGCCTGGG + Intergenic
1103776035 12:123366987-123367009 TCGTGCCACTGCACCAGCCTGGG + Intergenic
1103800990 12:123537058-123537080 TCGCACCACTGCACTACCTTGGG - Intergenic
1105558637 13:21469792-21469814 TCGTGCCATTGCACTCGCCTGGG - Intergenic
1105682538 13:22744037-22744059 TCGCGCCACTGCACTGGCCTGGG + Intergenic
1105686340 13:22785965-22785987 TCGCACCACTGCACCAGCCTGGG + Intergenic
1106836046 13:33636095-33636117 TCATACCATTGCACTAGCCTGGG + Intergenic
1107468593 13:40670009-40670031 TCACACCACTGCTCCAGCCTAGG + Intergenic
1108120325 13:47178853-47178875 TAGGCCCATTGCACAAGCCCTGG + Intergenic
1109313375 13:60721235-60721257 TTGCAGCATTGCACAACCCCAGG - Intergenic
1109454642 13:62568411-62568433 TCACATCATCGCACTAGCCTTGG - Intergenic
1111666991 13:91281982-91282004 TCACACCACTGCACCAGCTTGGG + Intergenic
1111954361 13:94740749-94740771 TCATGCCATTGCACTAGCCTGGG - Intergenic
1114445608 14:22785681-22785703 TCTCGCCATTGCACCAGCCTAGG + Intronic
1115657193 14:35455098-35455120 TCGCACCACTCCTCCAGCCTGGG - Intergenic
1116050558 14:39797657-39797679 TTGCACCACAGCACCAGCCTGGG - Intergenic
1118565453 14:67135883-67135905 TTGCACTTTTGCACAATCCTTGG + Intronic
1119007983 14:70951417-70951439 TCGCACCACTGCACTCGTCTGGG - Intronic
1119563798 14:75611691-75611713 TCGCACCACTGCACTAGCCTGGG + Intronic
1126593775 15:50365875-50365897 TCACACCACTGCACCAGCCTGGG + Intergenic
1127107006 15:55627366-55627388 TTGCGCCACTGCACTAGCCTGGG - Intronic
1127220563 15:56876000-56876022 TCACACCACTGCACCAACCTGGG + Intronic
1127898181 15:63321280-63321302 TCACTCCATTGCACAACCCAGGG - Intergenic
1128040019 15:64563729-64563751 TCGCGCCATTGTTCCAGCCTGGG + Intronic
1128406781 15:67349561-67349583 TTGCGCCATTGCTCCAGCCTGGG + Intronic
1128461784 15:67874735-67874757 TTGCACCAGTGCACTAACCTGGG - Intergenic
1128738192 15:70065494-70065516 TCTCACCAATGCAGAAACCTGGG - Intronic
1131852175 15:96554993-96555015 ACACACCATTGCACAGGGCTTGG + Intergenic
1134127011 16:11623006-11623028 TCACGCCACTGCACCAGCCTGGG - Intronic
1136575898 16:31124982-31125004 TTGCACCATTGCTCCAGCCTGGG + Intronic
1136672702 16:31872968-31872990 CTGCACCACTGCACCAGCCTGGG + Intergenic
1137413337 16:48248164-48248186 TGGCACCACTGCACCAGCATGGG - Intronic
1138049360 16:53760290-53760312 TCGCACCACTGCACCAGCCTGGG - Intronic
1139584775 16:67894966-67894988 TCGCGCCATTGCTCCAGCCTGGG - Intronic
1139718580 16:68834291-68834313 TCGCTCCATCGCCCAGGCCTGGG + Exonic
1139773433 16:69297571-69297593 TCACGCCACTGCACCAGCCTGGG + Intronic
1141912836 16:87071744-87071766 TCGTACCACTGCACCAGCCTGGG - Intergenic
1143060819 17:4199232-4199254 TCGTGCCAGTGCACCAGCCTGGG - Intronic
1143704742 17:8688850-8688872 TGGCACCAGTGCACCAGCCTGGG - Intergenic
1144611037 17:16715857-16715879 TCGCTCCAATCCACAAGCCTGGG - Intronic
1144901700 17:18599506-18599528 TCGCTCCAATCCACAAGCCTGGG + Intergenic
1144929372 17:18846554-18846576 TCGCTCCAATCCACAAGCCTGGG - Intronic
1144997168 17:19278027-19278049 TCACACCACTGCACCAGCCTGGG + Intronic
1145130804 17:20346561-20346583 TCACTCCAATCCACAAGCCTGGG - Intergenic
1146224980 17:31057852-31057874 TTGCGCCATTGCACCATCCTGGG + Intergenic
1146777753 17:35637227-35637249 TCGCACCACTGCACTCACCTGGG - Intronic
1147417755 17:40305942-40305964 TCGCGCCACTGCTCCAGCCTGGG - Intergenic
1147940471 17:44043588-44043610 TTGCACCACTGCACCAGCCTGGG - Intronic
1148600298 17:48889248-48889270 TTGCACCACTGCACTGGCCTGGG - Intergenic
1149894685 17:60420620-60420642 TCACGCCATTGCTCCAGCCTGGG + Intronic
1150355301 17:64478850-64478872 TCACGCCATTGCACCAGCCCGGG + Intronic
1150383721 17:64740912-64740934 TCGCACCATTGCACCCAGCTTGG + Intergenic
1150456335 17:65309575-65309597 TCATGCCATTGCACTAGCCTGGG - Intergenic
1152578982 17:81157707-81157729 TCCCACCCTTGGACCAGCCTTGG - Intronic
1152977258 18:233539-233561 TCGCGCCACTGCACTCGCCTGGG + Intronic
1153039369 18:796711-796733 TGGCACCACTGCACTGGCCTGGG + Intronic
1155150273 18:23117488-23117510 TCACGCCACTGCACTAGCCTGGG - Intergenic
1156155760 18:34300367-34300389 TTGCACCCTTCCACAAGCCCAGG + Intergenic
1156332914 18:36141733-36141755 TCTCACCACTGCACCAGCCTAGG - Intronic
1158240341 18:55370359-55370381 TTGCACCACTGCTCCAGCCTGGG + Intronic
1158568543 18:58576327-58576349 TCGTACCATTGCTCCAGCCCAGG + Intronic
1158669438 18:59461775-59461797 TCACACCATTGCACTTGGCTTGG - Intronic
1159352399 18:67293054-67293076 ATGCACCACTGCACCAGCCTGGG - Intergenic
1160734339 19:655283-655305 TCCCACCACTGCGCTAGCCTGGG + Intronic
1160933465 19:1581810-1581832 TCGCACCACTGCACTCTCCTGGG - Intronic
1161416274 19:4148847-4148869 CTGCACCACTGCACCAGCCTGGG - Intergenic
1162295884 19:9813026-9813048 TCGTGCCGTTGCACCAGCCTGGG + Intronic
1162618167 19:11818592-11818614 TCGCACCACTGCTCCAGCCTGGG - Intronic
1162622086 19:11851700-11851722 TGGCACCACTGCTCCAGCCTGGG - Intronic
1162626918 19:11892020-11892042 TCGCACCACTGCTCCAGCCTGGG - Intronic
1162631149 19:11928038-11928060 TCGCACCACTGCTCTAGGCTGGG - Intronic
1162636059 19:11968294-11968316 TCGCACCACTGCTCCAGCCTGGG - Intronic
1162814110 19:13182917-13182939 TCGTGCCACTGCACTAGCCTGGG + Intergenic
1165672710 19:37692959-37692981 TCGCACCACTGCACTCGCCGGGG + Intronic
1166574358 19:43823532-43823554 TCGTGCCATTGCTCCAGCCTGGG + Intronic
1166992420 19:46700585-46700607 CTGCACCACTGCACCAGCCTGGG + Intronic
1167154886 19:47732162-47732184 CCGTGCCATTGCACCAGCCTGGG - Intronic
1168234335 19:55052497-55052519 TCCCGTCATTGCACCAGCCTGGG + Intronic
1168547534 19:57266063-57266085 TCGCACCACTGCTCCAGCCTGGG - Intergenic
1168720549 19:58552408-58552430 TCGCATCATGGCAAAAGACTTGG - Exonic
927704558 2:25289145-25289167 TCGCGCCACTGCACTCGCCTGGG - Intronic
929132271 2:38588502-38588524 TCGCGCCACTGCACCAGCTTGGG + Intronic
929529440 2:42738215-42738237 TTGCACCACTGGACAAGGCTGGG + Intronic
929540077 2:42812134-42812156 TGGCACCACTGCTCCAGCCTGGG + Intergenic
932041529 2:68304663-68304685 TCGCACCACTGCTCCGGCCTGGG - Intronic
932131858 2:69194806-69194828 TCGCACCACTGCTCCAGCCTGGG + Intronic
933140318 2:78784153-78784175 TATCACCATTGCACAGGCATGGG - Intergenic
933441805 2:82324030-82324052 TCGCACCGTTGGAAAAGCATGGG + Intergenic
935042612 2:99447762-99447784 TGGCGCCACTGCACCAGCCTGGG - Intronic
935366523 2:102297128-102297150 TCGCGCCACTGCACTAGCCTGGG + Intergenic
935805100 2:106737784-106737806 TCTCACCTTTTCCCAAGCCTTGG + Intergenic
937180141 2:119987938-119987960 TGGCACCACTGCACTAGCTTAGG + Intergenic
938638456 2:133254009-133254031 TTGCTCCACTGCAAAAGCCTGGG + Intronic
939445833 2:142309582-142309604 TCTCACCATTACACATGGCTAGG + Intergenic
943450927 2:188040709-188040731 ACTCACCATTCCACATGCCTTGG - Intergenic
943560673 2:189457966-189457988 ACACACCATTGCACCAGCCTGGG - Intronic
945238889 2:207658689-207658711 TCGCACCATTGCACCAGCCTGGG + Intergenic
946199672 2:218064484-218064506 TCGCTCCATCCCACAACCCTGGG + Intronic
947121189 2:226816849-226816871 TAGCACCACTGCGCCAGCCTTGG + Intergenic
947570496 2:231230309-231230331 TCGCACCACTGCACTAGTCTAGG + Intronic
947613017 2:231535588-231535610 TCGCACCACTGCACCAGCCTGGG - Intergenic
948000630 2:234563895-234563917 TCGCACCACTGCTCCAGGCTGGG + Intergenic
1168766227 20:383008-383030 TCGCACCAATGCCCATACCTGGG + Intronic
1169877237 20:10311568-10311590 ACCCACCATTACACAATCCTTGG + Intergenic
1170180838 20:13528176-13528198 TCGCACCACTGCTCCAGCATGGG + Intronic
1170621679 20:18001667-18001689 ACACAGCATTTCACAAGCCTCGG + Intronic
1171322131 20:24255611-24255633 TTGTACCACTGCACTAGCCTGGG + Intergenic
1171573353 20:26274792-26274814 TTGCACCAGTCCTCAAGCCTGGG + Intergenic
1171837510 20:30170617-30170639 TTGCACCAGTCCTCAAGCCTGGG - Intergenic
1172244535 20:33436919-33436941 TCGCGCCACTGCTCCAGCCTGGG + Intronic
1172677205 20:36681740-36681762 TAGCATCACTGCACCAGCCTGGG - Intronic
1173118107 20:40265308-40265330 TTCCACCACTGCACAAGGCTAGG + Intergenic
1174433668 20:50489936-50489958 TCGCACCACTGCTCCAGCCTGGG - Intergenic
1174716631 20:52766023-52766045 TTGCACCACTGCTCCAGCCTGGG - Intergenic
1174742872 20:53032855-53032877 TCCCATCATTGCACAATACTGGG + Intronic
1174803501 20:53585498-53585520 TCGCACCACTGGTCCAGCCTGGG + Intronic
1174852781 20:54011812-54011834 TGGCACCACTGCACTTGCCTGGG + Intronic
1175184652 20:57172002-57172024 TCGCATCATTTCACAATCCCTGG + Intronic
1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG + Intergenic
1176414161 21:6465590-6465612 TCGCACCACTGCTCCAGCCTGGG - Intergenic
1177006559 21:15679735-15679757 TCACACCACCGCACTAGCCTGGG + Intergenic
1177739682 21:25138996-25139018 TCGCGCCACTGCAGTAGCCTGGG - Intergenic
1178628013 21:34234330-34234352 TCACACCACTGCACCAGCCTGGG - Intergenic
1179689659 21:43073912-43073934 TCGCACCACTGCTCCAGCCTGGG - Intronic
1181933397 22:26421439-26421461 TCATGTCATTGCACAAGCCTGGG - Intergenic
1182818198 22:33187877-33187899 TCGCACCACTGCACTCTCCTGGG + Intronic
1183891867 22:40936239-40936261 TCGCGCCACTGCACTCGCCTGGG + Intergenic
1184558561 22:45247500-45247522 TCACGCCATTGCACCAGCCTGGG + Intergenic
950536213 3:13580404-13580426 TCTCACCATTGCAGGAGCCGGGG + Intronic
952530055 3:34254190-34254212 TTGCACCATTGCACCAGCGTGGG + Intergenic
952842588 3:37660881-37660903 TGGAACCAGTGGACAAGCCTGGG + Intronic
952923524 3:38305538-38305560 CCTCACCACTGCACCAGCCTTGG + Intronic
953295409 3:41710747-41710769 TCGCTCCGCTGCACAAGCCTGGG + Intronic
953964757 3:47295610-47295632 TTGCACCACTGCACCAGCCTGGG - Intronic
959183613 3:103013714-103013736 TTACACCACTGCACTAGCCTTGG + Intergenic
961248336 3:125476524-125476546 TCACATCATTGCATCAGCCTGGG + Intronic
963186519 3:142424136-142424158 TCGCGCCACTGCTCCAGCCTGGG - Intronic
963611831 3:147478043-147478065 TCACACCATTGCTCCAGCCTGGG + Intronic
963793795 3:149611107-149611129 TTGCACCACTGCTCCAGCCTGGG + Intronic
966089859 3:176119833-176119855 TCGCGCCATTGCATTCGCCTGGG + Intergenic
967123629 3:186405758-186405780 TTACACCACTGCACCAGCCTGGG - Intergenic
967159833 3:186725973-186725995 TCGCGCCACTGCTCCAGCCTAGG - Intronic
968642666 4:1722145-1722167 TAGCACCAAAGCACCAGCCTGGG + Intronic
969112788 4:4854068-4854090 TCGCTCCACTGCTCCAGCCTAGG - Intergenic
969975345 4:11094598-11094620 TCGCACTGTTGCCCAAGCCGGGG - Intergenic
971608359 4:28687531-28687553 TTGCGCCATTGCACCAGCCTAGG + Intergenic
972375062 4:38461915-38461937 TCACGCCACTGCACCAGCCTGGG + Intergenic
972576431 4:40356268-40356290 TTGCACCACTACACTAGCCTAGG + Intergenic
972581406 4:40398716-40398738 TCGTGCCACTGCACCAGCCTGGG - Intergenic
972667568 4:41181899-41181921 TCACGCCATTGCACCAGCCTGGG + Intronic
972751839 4:41996697-41996719 TTGCACCACTGCCCCAGCCTGGG + Intronic
973983072 4:56322982-56323004 TTGCACCACTGCTCCAGCCTGGG + Intronic
974603342 4:64118418-64118440 TCACGCCACTACACAAGCCTGGG - Intergenic
977394207 4:96451094-96451116 TAGCACCATTGCACCTCCCTGGG - Intergenic
979479671 4:121201609-121201631 TCCCATCATGACACAAGCCTGGG - Intronic
982178091 4:152725565-152725587 TTGCACCATTGCACTAAGCTTGG - Intronic
984631337 4:182064536-182064558 TCGCACCACTGCTCCAGCCTGGG + Intergenic
984764566 4:183389887-183389909 TCGCACCGCTGAACCAGCCTGGG + Intergenic
985215945 4:187654197-187654219 TCTCCCCATTTCACCAGCCTTGG - Intergenic
986470880 5:8073155-8073177 ACTCACCATTGCACATGGCTGGG + Intergenic
988263409 5:28920645-28920667 ACTCACCATTCCACAAGGCTGGG - Intergenic
989222051 5:38977638-38977660 TCACACCACTGCACTATCCTGGG - Intronic
989571359 5:42948925-42948947 TCACACCACTGCACCCGCCTGGG + Intergenic
989571873 5:42952907-42952929 TCACGCCACTGCACCAGCCTGGG - Intergenic
989582218 5:43043467-43043489 TGACACCACTGCACCAGCCTAGG - Intergenic
991274176 5:64824588-64824610 TCACACCAGTGCAGAAGGCTTGG - Intronic
991302079 5:65138807-65138829 TTGCACCATTGTTCCAGCCTGGG - Intergenic
994161011 5:96556552-96556574 TGTGACCAATGCACAAGCCTCGG + Intronic
995053347 5:107731443-107731465 TTGCACCACTGCTCCAGCCTGGG - Intergenic
995602889 5:113817578-113817600 TCACGCCACTGCACCAGCCTGGG - Intergenic
997556776 5:134806166-134806188 TCACGCTATTGCACAAGCCTGGG + Intronic
1003099184 6:3164127-3164149 TCGAGCCATTGTACCAGCCTGGG - Intergenic
1005643220 6:27816310-27816332 TCGCGCCACTGCACTAACCTGGG + Intergenic
1006758526 6:36439041-36439063 TCGCACCACTGCTCCAACCTGGG - Intronic
1007670494 6:43549104-43549126 TCACGCCATTGCTCCAGCCTGGG - Intronic
1010372183 6:75123333-75123355 TCCCACCATTCCACCAGCCCGGG - Exonic
1011427748 6:87249217-87249239 TGACAGCATTGCTCAAGCCTGGG - Intronic
1011491227 6:87895461-87895483 TCACTGCATTGCACAAACCTTGG + Intergenic
1012405307 6:98889634-98889656 TCACACCACTGCTCTAGCCTGGG + Intronic
1013252463 6:108348121-108348143 TCGCGCCACCGCACCAGCCTGGG - Intronic
1013516387 6:110890528-110890550 TCACACCACTGCACCAGCATGGG - Intronic
1014087936 6:117369527-117369549 TCGCGCCACTGCACCAGCCTGGG + Intronic
1014816709 6:125943536-125943558 TCGCACCATTGCACTTGGGTAGG + Intergenic
1015646034 6:135389264-135389286 TCGTGCCACTGCACCAGCCTGGG + Intronic
1015946412 6:138505608-138505630 TTGCGCCACTGCACCAGCCTGGG + Intronic
1016390659 6:143571447-143571469 TTGCACCACTGCACCAGCCTGGG - Intronic
1017154683 6:151312431-151312453 TTGCACCACTGTACCAGCCTGGG + Intronic
1017714091 6:157196014-157196036 TCACACCACTGCATTAGCCTGGG + Intronic
1018626146 6:165780884-165780906 CCACACCATAGCACCAGCCTGGG - Intronic
1020160510 7:5767641-5767663 TCGCACCATTACTTCAGCCTGGG - Intronic
1021345646 7:19525029-19525051 TCGTACCATTGCACCAGCCTGGG - Intergenic
1022997141 7:35768666-35768688 TCGCGCTATTGCACCAGCCTGGG - Intergenic
1025286020 7:57662097-57662119 TTGCACCAGTCCTCAAGCCTGGG - Intergenic
1025910155 7:65821980-65822002 TCACGCCATTGCACCAGCCTGGG - Intergenic
1025962176 7:66232245-66232267 TCACACCATAGCTCCAGCCTGGG - Intronic
1026005028 7:66593733-66593755 TCACACCACTGCGCTAGCCTGGG - Intergenic
1026196496 7:68178036-68178058 TTGCACCACTGCACCAGCCTGGG - Intergenic
1026486833 7:70829244-70829266 TCACACCATCGCCCAAGCCTTGG - Intergenic
1026811937 7:73474728-73474750 TCACGCCACTGCACTAGCCTGGG + Intronic
1026964921 7:74433498-74433520 TCGCGCCACTGTACCAGCCTGGG - Intergenic
1027023910 7:74836923-74836945 TCGTGCCATTGCACCAGCCTGGG - Intronic
1027064020 7:75108398-75108420 TCGTGCCATTGCACCAGCCTGGG + Intronic
1027260033 7:76458315-76458337 TTGCACCATTGCACTAGCCTGGG - Intergenic
1027282438 7:76618574-76618596 TTGCACCATTGCACTAGCCTGGG + Intronic
1027311408 7:76956419-76956441 TTGCACCATTGCACTAGCCTGGG - Intergenic
1027868459 7:83675742-83675764 TCGCGCCACTGCTCCAGCCTGGG + Intergenic
1029292215 7:99510783-99510805 TTGCACCAATGCTCCAGCCTGGG - Intronic
1029542621 7:101193137-101193159 TTGCACCACAGCACCAGCCTGGG - Intergenic
1029615714 7:101655948-101655970 TCACACTATTGAACAAGCCTGGG - Intergenic
1030342948 7:108401193-108401215 TGGCGCCACTGCACCAGCCTGGG + Intronic
1031021216 7:116629915-116629937 TCACACCATGGCAACAGCCTGGG + Intergenic
1031902438 7:127426434-127426456 TCGCACCACTGCTCCAGCCTAGG - Intronic
1033328587 7:140399092-140399114 TTGCTCCACTGCACCAGCCTGGG + Intronic
1033380732 7:140815476-140815498 TCGCACCATTGCACAAGCCTGGG - Intronic
1034657334 7:152740043-152740065 TTGCACCCTTGCACTAGCCTGGG + Intergenic
1034671624 7:152863128-152863150 TCACGCCACTGCACCAGCCTGGG - Intergenic
1035444029 7:158927594-158927616 TCACACCACTGCAGCAGCCTGGG - Intronic
1038563486 8:28600295-28600317 TCGCGCCACTGCACCAACCTGGG + Intergenic
1038567062 8:28628485-28628507 TTGCACCACTGCTCCAGCCTGGG + Intronic
1039091104 8:33830646-33830668 TCACACCACTGCTCCAGCCTGGG + Intergenic
1039629107 8:39089202-39089224 TCGTGCCATTGCACTAGCCTGGG + Intronic
1040507452 8:48062543-48062565 GCGCACCACTGCTCCAGCCTGGG + Exonic
1042161331 8:65898934-65898956 TTGCACCACTGCACCAGCCTGGG - Intergenic
1042530267 8:69807746-69807768 TCGCACCACTGCTCCAGCCTGGG - Intronic
1044075129 8:87811667-87811689 ACTCACCATTCCACATGCCTGGG + Intergenic
1050351436 9:4743981-4744003 TCTCGCCACTGCACCAGCCTGGG - Intergenic
1053869640 9:42477299-42477321 TCGCGCCACTGCACCAGCCTGGG + Intergenic
1056153488 9:83812390-83812412 TCACACCACTGCTCCAGCCTTGG - Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056357001 9:85810700-85810722 TCACACCACTGCTCCAGCCTTGG + Intergenic
1056859256 9:90164565-90164587 TCACACCACTGCACCAGCCTGGG - Intergenic
1057314552 9:93960140-93960162 TTGCCCCACTGCACAAGCCTGGG + Intergenic
1058859201 9:109097874-109097896 TGGCACCACTGCACTAGCCTGGG + Intronic
1061194267 9:129099017-129099039 TCGTTCCATTGCTCCAGCCTGGG - Intronic
1186560415 X:10606774-10606796 TGGCACCACTGCACTCGCCTGGG - Intronic
1187154795 X:16712580-16712602 TTGGACCATTGCACAAACCCGGG - Intronic
1190307103 X:49090580-49090602 TCGTGCCATTGCTCCAGCCTGGG - Intronic
1191774619 X:64800359-64800381 TCCCACCACTGTACCAGCCTGGG - Intergenic
1192411136 X:70933627-70933649 TCGCACCACTGCACCAGCCTGGG - Intergenic
1197058802 X:122152921-122152943 ACTCACCATTCCACAAGGCTGGG - Intergenic
1200155679 X:153973636-153973658 TCGCGCCACTGCTCCAGCCTGGG + Intronic