ID: 1033387839

View in Genome Browser
Species Human (GRCh38)
Location 7:140896200-140896222
Sequence CTGTAAGACCCAAAACTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 253}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033387839_1033387849 30 Left 1033387839 7:140896200-140896222 CCTTGTAGTTTTGGGTCTTACAG 0: 1
1: 0
2: 0
3: 13
4: 253
Right 1033387849 7:140896253-140896275 TTGTATAGGGTGAGAGGTGGGGG 0: 6
1: 27
2: 164
3: 814
4: 2271
1033387839_1033387843 16 Left 1033387839 7:140896200-140896222 CCTTGTAGTTTTGGGTCTTACAG 0: 1
1: 0
2: 0
3: 13
4: 253
Right 1033387843 7:140896239-140896261 TTTTGAGTTGATTTTTGTATAGG 0: 34
1: 142
2: 287
3: 522
4: 1194
1033387839_1033387847 28 Left 1033387839 7:140896200-140896222 CCTTGTAGTTTTGGGTCTTACAG 0: 1
1: 0
2: 0
3: 13
4: 253
Right 1033387847 7:140896251-140896273 TTTTGTATAGGGTGAGAGGTGGG No data
1033387839_1033387845 24 Left 1033387839 7:140896200-140896222 CCTTGTAGTTTTGGGTCTTACAG 0: 1
1: 0
2: 0
3: 13
4: 253
Right 1033387845 7:140896247-140896269 TGATTTTTGTATAGGGTGAGAGG 0: 16
1: 124
2: 451
3: 5808
4: 13075
1033387839_1033387844 17 Left 1033387839 7:140896200-140896222 CCTTGTAGTTTTGGGTCTTACAG 0: 1
1: 0
2: 0
3: 13
4: 253
Right 1033387844 7:140896240-140896262 TTTGAGTTGATTTTTGTATAGGG 0: 357
1: 3527
2: 12687
3: 15763
4: 8280
1033387839_1033387846 27 Left 1033387839 7:140896200-140896222 CCTTGTAGTTTTGGGTCTTACAG 0: 1
1: 0
2: 0
3: 13
4: 253
Right 1033387846 7:140896250-140896272 TTTTTGTATAGGGTGAGAGGTGG 0: 9
1: 47
2: 201
3: 447
4: 858
1033387839_1033387848 29 Left 1033387839 7:140896200-140896222 CCTTGTAGTTTTGGGTCTTACAG 0: 1
1: 0
2: 0
3: 13
4: 253
Right 1033387848 7:140896252-140896274 TTTGTATAGGGTGAGAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033387839 Original CRISPR CTGTAAGACCCAAAACTACA AGG (reversed) Intronic
901590427 1:10336815-10336837 CTGTAAAACTGAAAAATACAGGG + Intronic
903394025 1:22985597-22985619 CTGTAATAGCCAAATCTCCATGG - Intergenic
906605823 1:47170664-47170686 CTGTAATAACCAAAACAGCATGG + Intergenic
906817946 1:48898671-48898693 CTCTAATACCTAAAACAACATGG - Intronic
908163334 1:61433568-61433590 ATTTAAGACCCAAAACCATAAGG - Intronic
908815015 1:68022842-68022864 CTATAAGACTTAGAACTACAAGG - Intergenic
910458308 1:87421805-87421827 CTGTAAGCCCTAAAACAACATGG + Intergenic
912191255 1:107343530-107343552 CTGTAAAAGCCAAAAGTAGAAGG - Intronic
912328378 1:108791854-108791876 CTGGAAAAGGCAAAACTACAGGG - Intronic
914315603 1:146508590-146508612 CTATAAGCCCTAAAACAACATGG + Intergenic
914498752 1:148224771-148224793 CTATAAGCCCTAAAACAACATGG - Intergenic
914733865 1:150397519-150397541 CTGGAAGAGTCAAAACTATAAGG - Intronic
917061269 1:171043357-171043379 CTATAATAACCAAAACAACATGG - Intronic
917431289 1:174972252-174972274 CTGTTAGACCAGAAGCTACATGG + Intronic
917938173 1:179890285-179890307 CTTTAAGAGCCAAAAAAACAAGG - Intronic
918270351 1:182892636-182892658 CTATAGGAACCAAAACAACATGG + Intergenic
919287971 1:195589720-195589742 CTGTAGCAACCAAAACAACATGG + Intergenic
919477759 1:198050382-198050404 CTATAATAACCAAAACAACATGG - Intergenic
919800239 1:201349671-201349693 CTGTAAGATCCAAGAGTTCAGGG - Intergenic
921071564 1:211662756-211662778 ATGCAAGACACATAACTACAGGG + Exonic
922863729 1:228841001-228841023 CTATAAAACCCCAAAGTACAGGG + Intergenic
923204736 1:231747642-231747664 CTGTAGTAACCAAAACAACATGG - Intronic
923264002 1:232295274-232295296 ATGTAAGACCTCAAACTATAAGG - Intergenic
924929845 1:248720618-248720640 CTGTAGTAACCAAAACAACATGG + Intronic
1063393327 10:5664267-5664289 CTGGAAGACCCAAGGCTGCAGGG + Intronic
1064742760 10:18450110-18450132 CTGTAAAGCCCAAAACTATCCGG + Intronic
1064823609 10:19368498-19368520 CTGTAGTAACCAAAACAACATGG - Intronic
1065217218 10:23460670-23460692 CTGTAGGACCAAACAATACATGG - Intergenic
1066043010 10:31570143-31570165 CTGGAAAATCCAAAATTACATGG + Intergenic
1068536913 10:58250065-58250087 CTGTAATATCCAAAACACCATGG - Intronic
1069466637 10:68645550-68645572 CTCCAAGACCCAAACTTACAGGG + Exonic
1071002487 10:80845863-80845885 CTGTAGTAACCAAAACAACATGG + Intergenic
1071064846 10:81619186-81619208 CTGTAGCAACCAAAACAACATGG + Intergenic
1076944364 10:133635104-133635126 CTGTAGTAACCAAAACAACATGG + Intergenic
1079145881 11:17851449-17851471 CTGTAAGACACATGAGTACAAGG + Intronic
1079342729 11:19626408-19626430 CTGTAGCAACCAAAACCACATGG - Intronic
1079757687 11:24285762-24285784 CTGTAATATCCAAAACAGCATGG + Intergenic
1079907411 11:26266364-26266386 CTGTGAGAGCTAAAATTACATGG - Intergenic
1081406737 11:42707218-42707240 CTGTAGGACCGAAAGCAACATGG + Intergenic
1082223613 11:49673507-49673529 ATGTAAGACCTCAAACTATAAGG - Intergenic
1084915469 11:72425921-72425943 CTGTGAGACAGGAAACTACAGGG - Intronic
1085686346 11:78625320-78625342 CTGTAGTAACCAAAACCACATGG - Intergenic
1086528790 11:87759774-87759796 CTGTAATAACCAAAACAGCATGG - Intergenic
1086625446 11:88945757-88945779 ATGTAAGACCTCAAACTATAAGG + Intronic
1087232555 11:95682645-95682667 CTGTAAGGTCCAAAAGTTCATGG - Intergenic
1087694307 11:101358494-101358516 CTATAGTAACCAAAACTACATGG + Intergenic
1089218191 11:116848603-116848625 GTTTAATAACCAAAACTACAGGG + Intronic
1090148089 11:124349575-124349597 CTGTAGGAACCAAAACAGCATGG + Intergenic
1090726580 11:129532527-129532549 CTGTAAGCGGCAAAACTAAAGGG + Intergenic
1091015691 11:132049295-132049317 CTGTGAGACTCACATCTACAGGG + Intronic
1093002220 12:14010061-14010083 CGGCAAGTCCCAAATCTACAGGG - Intergenic
1093963333 12:25299573-25299595 CTGGAAAAGGCAAAACTACAGGG - Intergenic
1095108035 12:38259140-38259162 CTGCAAGACCCAAAGATCCAGGG - Intergenic
1095672285 12:44875849-44875871 CAGTAAGACCCGAGACTCCATGG + Exonic
1096986548 12:55762675-55762697 CTGGGTGTCCCAAAACTACAAGG + Intronic
1099509769 12:83519288-83519310 CTGCCAGACCTAAAACTCCAGGG - Intergenic
1099524062 12:83697215-83697237 CTGAAAACCACAAAACTACATGG + Intergenic
1099568147 12:84278833-84278855 CTGGCATACCCAAAACCACATGG + Intergenic
1099802300 12:87472856-87472878 CTGTAAAACCCCAAAATGCAAGG - Intergenic
1100584432 12:95966667-95966689 CTGACAGACCCTAAACAACAGGG + Intronic
1102391947 12:112556447-112556469 CTGTGAGCCCCAAAACTGTAGGG - Intergenic
1105430042 13:20328136-20328158 CTGAAAACCACAAAACTACATGG + Intergenic
1105692568 13:22856615-22856637 CTGTGAGAGGCCAAACTACATGG - Intergenic
1106842414 13:33698309-33698331 CTTTTAAACACAAAACTACAGGG - Intergenic
1106943938 13:34804630-34804652 CTGCAAGAGCTAAACCTACATGG - Intergenic
1107431766 13:40346642-40346664 ATGTAAGTCCCCAAACCACAGGG + Intergenic
1109817532 13:67604988-67605010 CTATAGTACCCAAAACAACATGG - Intergenic
1110064940 13:71092247-71092269 ATGTAATTCCCAAAAGTACAGGG + Intergenic
1115777812 14:36735623-36735645 CTGTACCACCCAAACCAACACGG + Intronic
1116102342 14:40456158-40456180 CTGTAGTAACCAAAACAACATGG - Intergenic
1116468783 14:45263735-45263757 CTGTAATAACCAAAACAGCATGG - Intergenic
1117292379 14:54345894-54345916 CTGGAAGTCCCAAATTTACAGGG - Intergenic
1117367418 14:55043079-55043101 ATGTAAGGCCCAAAACTAGTCGG + Exonic
1117824276 14:59685931-59685953 CTATAGGAACCAAAACTGCATGG + Intronic
1120464979 14:84844981-84845003 AAGGAAGACCCAAAGCTACAGGG + Intergenic
1124105478 15:26734000-26734022 ATGTAAGCCCTAAAACTATAGGG + Intronic
1124353008 15:28972328-28972350 AATTAAGACCCAAATCTACATGG + Intronic
1124967981 15:34452564-34452586 CTAGAAAACACAAAACTACAAGG - Intergenic
1124988037 15:34642203-34642225 CTGTAAGACACTAAAGCACAAGG + Intergenic
1125052204 15:35312900-35312922 CTGTAGTAACCAAATCTACATGG - Intronic
1125126308 15:36226116-36226138 ATGTAAGACCTCAAACTATATGG + Intergenic
1126654521 15:50962369-50962391 CTGTAGTAACCAAAACAACATGG + Intronic
1126714364 15:51498603-51498625 CTGTATCAGCCAAAGCTACAAGG + Exonic
1129481161 15:75827650-75827672 CTTTAAGACCCCGAACTGCATGG + Intergenic
1132242162 15:100266322-100266344 CTGGAAAACCCACAACTGCAGGG + Intronic
1135093601 16:19542732-19542754 TTGGAAGAGCCAAAACTAGATGG + Exonic
1137452372 16:48588877-48588899 CTGTAAAAACCAAAACAAAAAGG + Intronic
1138216946 16:55212780-55212802 CATTAAGACCCAAAAGGACAGGG - Intergenic
1140444891 16:75018226-75018248 CAGTAAGGACCAAAACTATAGGG - Intronic
1141156790 16:81602626-81602648 CTGAAATAAACAAAACTACAGGG - Intronic
1141350878 16:83294991-83295013 CTGTAACAACCAAAACAGCATGG + Intronic
1141990310 16:87605556-87605578 CCGTCAGATCCTAAACTACACGG - Intronic
1143247562 17:5499686-5499708 CTGTGAGACCCAAGACAAAAGGG - Intronic
1147631186 17:41932959-41932981 CAGGAAGTCTCAAAACTACAGGG - Intronic
1149000773 17:51755231-51755253 ATCTAAGACCCAAAACAATAGGG - Intronic
1149142015 17:53442576-53442598 CTATAATAACCAAAACAACAAGG + Intergenic
1150169939 17:62982842-62982864 CTGTAATAACCAAAACAGCATGG - Intergenic
1153702913 18:7714216-7714238 CTGAAAGTCGCACAACTACATGG + Intronic
1154144694 18:11857383-11857405 CTGAGAGGCCAAAAACTACAGGG + Intronic
1155335368 18:24758486-24758508 CTGGAAAAGACAAAACTACAGGG - Intergenic
1155833272 18:30544906-30544928 CTGAAAGAGCCAAAAATAAATGG + Intergenic
1156026247 18:32658044-32658066 CTGAAAAACACACAACTACATGG + Intergenic
1156639986 18:39081850-39081872 CTGTAAAAGGCAAAACTATAGGG + Intergenic
1157398348 18:47363473-47363495 CTGTAATAACCAAAACAGCATGG - Intergenic
1160381871 18:78464286-78464308 CTGTAAGAACCCAAACAGCATGG - Intergenic
1162225906 19:9222198-9222220 CTGTAATATCCAAAACAGCATGG - Intergenic
1164422755 19:28111057-28111079 CTGTAATTACCAAAACAACATGG + Intergenic
1165188659 19:34043590-34043612 CTCTAAGTCCCACAACCACAAGG + Intergenic
925110981 2:1336836-1336858 CTGTAACAACCAAAACAGCATGG - Intronic
926587911 2:14708953-14708975 CTCTAAGACCCATGTCTACAGGG - Intergenic
926929769 2:18024960-18024982 CAGGAAGCCCCAAAACCACATGG - Intronic
928018027 2:27677272-27677294 CTGTAACACCCAAATCAACAGGG - Intronic
929785770 2:44990056-44990078 CAGTATGAGCCAAACCTACATGG + Intergenic
930291277 2:49496207-49496229 CTGTAGTAACCAAAACAACATGG + Intergenic
930408220 2:50989504-50989526 CTGGAAAACACAAAACTACAGGG - Intronic
930412903 2:51049159-51049181 CTGTAGTAACCAAAACAACATGG - Intergenic
931121065 2:59220337-59220359 CTGTCAGACTCCAATCTACATGG + Intergenic
931593113 2:63908351-63908373 CTGGAAAAGGCAAAACTACATGG + Intronic
931919520 2:66998242-66998264 CTGTAGGAACCAAAACAGCATGG - Intergenic
932717669 2:74114064-74114086 CTGTAATAACCAAAACAGCATGG + Intergenic
932862151 2:75305361-75305383 GTGTAAGACCAAAAGCTTCAGGG + Intergenic
934996782 2:98969528-98969550 ATGTAAGACCGGAAACTACTAGG - Intergenic
937233766 2:120418209-120418231 CTGTAACAGCCAAAACTTTACGG - Intergenic
937938141 2:127262778-127262800 ATGTAAGACCTCAAACTATAAGG - Intronic
938165623 2:129023443-129023465 ATGTAAGACCTTAAACTAGAAGG - Intergenic
940455986 2:153901207-153901229 CTGTAGTAACCAAAACTGCAAGG - Intronic
940577574 2:155530417-155530439 ATGTAAAGCCCAAAACTATAAGG + Intergenic
940935557 2:159490488-159490510 CTCTAAAACCCAAAACGTCAAGG - Intronic
942033219 2:171984632-171984654 CAGTAAGAACTTAAACTACAAGG - Intronic
943220549 2:185098717-185098739 CTCTATGACCCAAAACAACATGG - Intergenic
943866280 2:192928460-192928482 CTGAAAACCACAAAACTACATGG - Intergenic
944300713 2:198121686-198121708 CTGTAATAACCAAAACTGGATGG - Intronic
945149932 2:206779782-206779804 CTGTAAGACAGAAAACAAAATGG - Intronic
945945490 2:215991240-215991262 CTGAAAACCACAAAACTACATGG + Intronic
1169970503 20:11264942-11264964 CTGTAAGTCCTATAACCACAAGG - Intergenic
1170125824 20:12963137-12963159 CTTTATGACCCACAACTAAAAGG - Intergenic
1177260888 21:18728076-18728098 CTGTAATAACCAAAACATCAAGG + Intergenic
1177964275 21:27707509-27707531 CTATAATAACCAAAACAACATGG - Intergenic
1180398475 22:12382675-12382697 TTGTAAAACAGAAAACTACACGG + Intergenic
1180571620 22:16727654-16727676 CTGGAAAACCCAAACCAACATGG - Intergenic
1182188894 22:28438343-28438365 TTCTAAGACACAAATCTACAGGG + Intronic
1183479393 22:38054975-38054997 CTGTAAGCCCCAAATTTAAAGGG + Intergenic
949140361 3:625997-626019 TTGTAGGATACAAAACTACAGGG - Intergenic
950022150 3:9794818-9794840 CTGAAAAAGGCAAAACTACAGGG - Intronic
950179667 3:10902216-10902238 CCGTCAGACCCAACAGTACATGG - Intronic
953832840 3:46316620-46316642 TGGTAAGGCCCAGAACTACATGG - Intergenic
954348127 3:50018226-50018248 CTGCAAAAGGCAAAACTACACGG - Intronic
954585340 3:51730494-51730516 CTGGAAAACCCAAAAGTACCTGG - Intergenic
956235611 3:67067895-67067917 CTGAAAAACGCAAAACTATAGGG + Intergenic
956543425 3:70370935-70370957 ACTTAAGACCCAAAACTATATGG - Intergenic
957083786 3:75661261-75661283 CTGTAGTAACCAAAACAACATGG - Intergenic
958040399 3:88220091-88220113 ATGTAACCCCCAGAACTACAGGG + Intergenic
958982015 3:100732435-100732457 CAGTAAGGCCTAAAAGTACAAGG - Intronic
959843152 3:111001455-111001477 CTCTAAACCACAAAACTACAGGG + Intergenic
962689089 3:137875464-137875486 CTGTAGTAACCAAAACAACATGG + Intergenic
963048238 3:141120208-141120230 CTCAAAACCCCAAAACTACATGG - Intronic
963818446 3:149860380-149860402 CTGTAAGAACCAAAACAGTATGG + Intronic
964180019 3:153872559-153872581 CTATAATAACCAAAACAACACGG + Intergenic
964283504 3:155092789-155092811 CTATAAGAAGCAAAACTATAGGG + Intronic
964501213 3:157350129-157350151 CTGTAGTAACCAAAACAACATGG + Intronic
964881689 3:161430434-161430456 CTGTAAGACCAATAACTATTTGG - Intergenic
965292921 3:166907184-166907206 CTCAAAAACCCAGAACTACATGG - Intergenic
967210551 3:187164471-187164493 CTGTAATACCCCGAACAACAAGG - Intronic
967736129 3:192954575-192954597 ATGTAAGACCTCAAACTATAAGG - Intergenic
969216876 4:5730183-5730205 GTGTAACACCCAAAACAACTGGG - Intronic
972488455 4:39564244-39564266 GTATAGGACCAAAAACTACAGGG - Intronic
973156592 4:46962718-46962740 CTGTAATAATCAAAACAACATGG + Intronic
973544839 4:51970860-51970882 CTGAAAAACACACAACTACATGG - Intergenic
974997267 4:69176840-69176862 CTGTAGTAACCAAAACAACATGG + Intronic
975793893 4:77984910-77984932 CTGTAAGAACTAAAATAACAAGG + Intergenic
976211192 4:82671905-82671927 CTGGAAAACCCCAAAATACATGG + Intronic
976350971 4:84059583-84059605 CTGCAAGACCCCAAATTACTGGG + Intergenic
977023695 4:91789321-91789343 CTGAAAGACGCTCAACTACATGG - Intergenic
977895407 4:102359013-102359035 CTGTAAGTTCCAAAAAGACAGGG + Intronic
979060319 4:116051019-116051041 ATGTAAGTCCAAAAACCACAAGG - Intergenic
979127718 4:116997582-116997604 CTGTAAAAGGCAAAACTACAGGG - Intergenic
979542136 4:121896903-121896925 CTGTAGAAACCAAAACTACACGG + Intronic
981780642 4:148425636-148425658 CTGTAAGACACTAAATTACCAGG - Intronic
983458882 4:168002399-168002421 CTGTCAAACCAAAAAATACATGG + Intergenic
983588403 4:169381086-169381108 CTGTAACAACCAAAACAGCATGG + Intergenic
984534232 4:180953445-180953467 CTCTAGGACCAAAAACTTCATGG - Intergenic
986503166 5:8422629-8422651 CTGCAAGAATCAAAACTATAGGG + Intergenic
987135014 5:14892199-14892221 CTCTAAGACCCCTGACTACAGGG - Intergenic
987362005 5:17115833-17115855 CTTTAAGACAGAAAACTAAAAGG + Intronic
987609076 5:20178744-20178766 TTGTATGACTCAAATCTACATGG - Intronic
988795444 5:34649152-34649174 GTCTAAGACAAAAAACTACATGG + Intergenic
989147432 5:38262557-38262579 CTGGAAGAGGCAAAACTACAGGG - Intronic
989231304 5:39089974-39089996 CTGTAATAACCAAAACAGCATGG + Intergenic
990023133 5:51153349-51153371 CTGTAACAACCAAAATGACATGG + Intergenic
990534843 5:56710955-56710977 ATGTAAGACCTCAAACTATAAGG + Intergenic
993209943 5:84935694-84935716 CTGTAAGACACAAAGCAAAAAGG - Intergenic
993618329 5:90138723-90138745 ATGACAGACCCAAAATTACATGG + Intergenic
993765831 5:91857217-91857239 CTGTTAGACGCAAAAACACACGG - Intergenic
993849450 5:92988611-92988633 CTGTAAGACCAAAGACAAAAGGG + Intergenic
994696362 5:103077362-103077384 CTGAAAACCACAAAACTACATGG - Intergenic
998337619 5:141387530-141387552 CTGAAAGAACAAAAACTACGTGG - Intronic
999919824 5:156305751-156305773 CTGTATGCTCCAAAACCACAGGG + Intronic
999946450 5:156601515-156601537 CTATAATAACCAAAACAACATGG - Intronic
1000348970 5:160337928-160337950 CTGAAAGTCCCAAAATTAAACGG - Intronic
1002406917 5:179041670-179041692 CTGTAAAAGGCAAAACTACAGGG - Intergenic
1003699724 6:8448399-8448421 CTGCTAGACCCAAATCTAAAGGG + Intergenic
1003751150 6:9057683-9057705 TTGTAATACAAAAAACTACAAGG - Intergenic
1005150203 6:22740406-22740428 CTGCAACTCCCAAAACAACATGG - Intergenic
1008100561 6:47386001-47386023 CTGTAGTAACCAAAACAACATGG - Intergenic
1008937397 6:57006838-57006860 CTGTAATAGCCAAAGCTGCATGG + Intronic
1008938060 6:57013802-57013824 CTGTAAGCTCCAAAACGACATGG + Intronic
1012107630 6:95184303-95184325 CTGTGAGATACAAAAATACAGGG - Intergenic
1012782064 6:103573662-103573684 ATGTAAGATACTAAACTACATGG - Intergenic
1013070519 6:106724919-106724941 CTCTCAGTCCCATAACTACAAGG + Intergenic
1013281207 6:108638767-108638789 CAATAAGACCCAACACAACAAGG + Intronic
1014160486 6:118162311-118162333 CTGGAAAACACAAAACTATAAGG + Intronic
1014838762 6:126191824-126191846 CTGTAATAACCAAAACAGCATGG - Intergenic
1017385311 6:153876091-153876113 CTGGAGGACCCACATCTACAAGG + Intergenic
1018042760 6:159939831-159939853 CTTTAATACCCAAGACTTCATGG + Intergenic
1020547069 7:9545766-9545788 CTATAATAACCAAAACCACATGG + Intergenic
1020716309 7:11678043-11678065 CTCAAAAACGCAAAACTACATGG + Intronic
1020836357 7:13156884-13156906 ATGTAAAACCCAACAGTACAGGG + Intergenic
1020987110 7:15149693-15149715 CTGTAATAACCAAAACAGCATGG - Intergenic
1020998456 7:15295949-15295971 CTGCAAGACCTATAAATACATGG + Intronic
1021996604 7:26184118-26184140 CTCTAAGCGCTAAAACTACAAGG - Intronic
1022867884 7:34441757-34441779 CTTTATGAAACAAAACTACAGGG + Intergenic
1023607070 7:41940835-41940857 GTGTAAGACCCAAAACACCTAGG + Intergenic
1023912838 7:44567642-44567664 CTGTAAGGCCTAAACCGACAAGG - Intronic
1024597405 7:50951155-50951177 CTGTAATAACCAAAACAGCATGG + Intergenic
1025195888 7:56932724-56932746 CTGAAAGACACTAAACTAAACGG - Intergenic
1025676060 7:63644211-63644233 CTGAAAGACACTAAACTAAACGG + Intergenic
1026070004 7:67110324-67110346 CAGTAAGAACCAAAAGCACAGGG - Intronic
1029408754 7:100394858-100394880 ATGTAAGACCCCAAACCATAGGG + Intronic
1029674138 7:102055092-102055114 CTGAAAGACACTAAACTAAATGG - Intronic
1031394506 7:121256193-121256215 CTGCAATAACCAAAACAACATGG + Intronic
1031761792 7:125722373-125722395 CTGTAAAAGGCAAAACTACAGGG + Intergenic
1033387839 7:140896200-140896222 CTGTAAGACCCAAAACTACAAGG - Intronic
1033985275 7:147218533-147218555 CTGGAAGATCCTAAAATACATGG - Intronic
1034093756 7:148387736-148387758 TTTTAAAACCCAAAACTACCTGG + Intronic
1037400732 8:18493036-18493058 CTGGAAAAGACAAAACTACAGGG + Intergenic
1040510935 8:48093926-48093948 CTATAATAACCAAAACAACATGG - Intergenic
1041742511 8:61171424-61171446 CTGTAAGACCAAGATTTACAAGG - Intronic
1044542960 8:93428510-93428532 CTGGAAGGCCCACAAGTACAGGG + Intergenic
1046166318 8:110441167-110441189 ATGTAAAACCCAAAACTATTAGG + Intergenic
1050037505 9:1452873-1452895 CTGGAAAAGACAAAACTACAGGG + Intergenic
1050617898 9:7421644-7421666 ATGTAAGACCTCAAACTATAAGG - Intergenic
1053874504 9:42529593-42529615 CTGTATGATGCAAAGCTACAGGG - Intergenic
1054267831 9:62937162-62937184 CTGTATGATGCAAAGCTACAGGG + Intergenic
1059852492 9:118359937-118359959 CTGGAAAACTCAAAATTACATGG + Intergenic
1061464879 9:130769892-130769914 CTGGAAAAGGCAAAACTACAGGG - Intronic
1203379702 Un_KI270435v1:21711-21733 TTGTAAAACAGAAAACTACAAGG + Intergenic
1188080401 X:25832048-25832070 CTGTAATAGCCAAAACAGCATGG - Intergenic
1188615972 X:32159625-32159647 ATGTCAAACCTAAAACTACATGG + Intronic
1189116341 X:38346733-38346755 CTGGAAGAGGCAAAACTATAAGG + Intronic
1189899780 X:45694246-45694268 CCGTAAGACCAAAAACAAAAGGG + Intergenic
1191818915 X:65281129-65281151 CTGTAATAACCAAAACAACATGG + Intergenic
1194779828 X:98010861-98010883 CTAGCAGACCCAAAACCACATGG - Intergenic
1194930665 X:99883365-99883387 CTCAAAAACACAAAACTACATGG + Intergenic
1195982881 X:110598945-110598967 CTGTAATAACCAAAACAACATGG - Intergenic
1196568606 X:117238535-117238557 CTGCACGAAGCAAAACTACAGGG - Intergenic
1197028575 X:121785610-121785632 CTGGAAAAAACAAAACTACAGGG + Intergenic
1198021962 X:132667706-132667728 CTGTCACACCAAAAACCACAGGG - Intronic
1198378073 X:136059028-136059050 CTGGAAAAAGCAAAACTACAGGG - Intergenic
1198945554 X:142009396-142009418 CTGCAATAACCAAAACTACATGG - Intergenic
1199308424 X:146294250-146294272 CTATAATAACCAAAACAACATGG - Intergenic
1199443929 X:147899532-147899554 CTGTAAGTCTCAAAACATCAAGG + Intergenic
1199945072 X:152658712-152658734 CTGAAAGACACACAACTCCATGG + Intergenic
1200963990 Y:9019848-9019870 CTGTCATACCCAGAACTAAATGG - Intergenic
1200980664 Y:9260684-9260706 CTGTCATACCCAGAACTAAATGG + Intergenic
1202149127 Y:21828931-21828953 CTGTCATACCCAGAACTAAATGG + Intergenic
1202373869 Y:24215912-24215934 ATGTATGACTCTAAACTACACGG - Intergenic
1202496912 Y:25454208-25454230 ATGTATGACTCTAAACTACACGG + Intergenic