ID: 1033387994

View in Genome Browser
Species Human (GRCh38)
Location 7:140897693-140897715
Sequence ATCCTGGCATGGATGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033387994_1033387998 15 Left 1033387994 7:140897693-140897715 CCATGTTTCATCCATGCCAGGAT 0: 1
1: 0
2: 3
3: 12
4: 166
Right 1033387998 7:140897731-140897753 ACCTCATGATCTGCTCACCTTGG 0: 42
1: 1780
2: 9800
3: 27203
4: 51394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033387994 Original CRISPR ATCCTGGCATGGATGAAACA TGG (reversed) Intronic
905142150 1:35855970-35855992 CTCCTGGCATGTATGGAGCAGGG + Exonic
907085676 1:51671579-51671601 TTCCTGGAATGGATGACTCAAGG - Intronic
909074270 1:71034763-71034785 ATCATGGCATGGAGGAAACATGG + Intronic
911245705 1:95514427-95514449 CTCCTGGCATGGCTGACAGAGGG + Intergenic
912243871 1:107940506-107940528 ATCCTGGCAAGGCTGAAACCAGG - Intronic
912253328 1:108033244-108033266 AACCTGGCAAGGGAGAAACAAGG - Intergenic
912262859 1:108126546-108126568 ATCCTGAAATGGATGATTCAAGG + Intergenic
914662528 1:149803609-149803631 ATCCAGGCTTGGATAAACCAAGG + Intronic
915533550 1:156519087-156519109 ATCCTGGCACAGAAGAAAAAGGG - Intergenic
915603668 1:156937908-156937930 ATCGTGGCATGGATGGAAGAGGG - Intronic
915716088 1:157946540-157946562 TTCCTCCCATAGATGAAACATGG - Intergenic
916471987 1:165132924-165132946 ATGCTGGGATGGAAGAAAAAAGG + Intergenic
917831465 1:178894167-178894189 ATCTTGGAATGGATGACCCAAGG - Intronic
920311455 1:205051346-205051368 TTCCCGGCAGGGATGAGACATGG + Intronic
920742346 1:208593263-208593285 ATCCTGGCCTGGATACAAAAGGG - Intergenic
921799401 1:219384793-219384815 AACCTGGCATTGATAAAATAAGG + Intergenic
923348479 1:233080615-233080637 ATCCTCCCATGGAGGAAAAAGGG + Intronic
1065233122 10:23619560-23619582 AACACGGCATGAATGAAACACGG - Intergenic
1065331992 10:24611780-24611802 ATCCAGGCATGCATGGAACCAGG + Intronic
1068325305 10:55477493-55477515 AGCCTGGCAAGGATGGAAAATGG + Intronic
1068374409 10:56159546-56159568 AACATGGCATGTATGAAACATGG - Intergenic
1068753384 10:60622724-60622746 ATCCTGGCAGGGAAGAAAATGGG + Intronic
1069943055 10:71968573-71968595 AGCCTGGCATGGTGGAGACAGGG - Intronic
1069954968 10:72044463-72044485 GTCCTGGCATGGTTGCACCAGGG - Intergenic
1071681475 10:87710293-87710315 GTCCAGGCATGAATGAAACCAGG - Intronic
1072254428 10:93607671-93607693 ATCCTCACATGGAAGAAAGAGGG + Intergenic
1072317736 10:94220100-94220122 ATCCTGGCATGAATGAACCATGG + Intronic
1072661527 10:97366502-97366524 AGCCGGGCATGGCTGAAAGAGGG - Exonic
1074496843 10:113986958-113986980 ATGGTGACATGGATGAAACCTGG - Intergenic
1075520375 10:123140132-123140154 AGCCTGGCACGGAAGAGACAAGG - Intergenic
1079751231 11:24201030-24201052 ATTCTGGCATACATTAAACAAGG + Intergenic
1080610911 11:33902789-33902811 ATCTTGCCATGGAAGAACCAAGG + Intergenic
1082222275 11:49653883-49653905 ATCCTCACATGGAGGAAAGAGGG - Intergenic
1083639263 11:64136569-64136591 TTCCAGGCAAGGATGCAACAAGG + Intronic
1085482572 11:76834919-76834941 ATCCTCACATGGAGGAAACAAGG - Intergenic
1086626766 11:88965316-88965338 ATCCTCACATGGAGGAAAGAGGG + Intronic
1086951094 11:92890800-92890822 ATACTGGCTAGGATGAAACTGGG - Exonic
1089640549 11:119844769-119844791 ATCCTGGCAAGACCGAAACAGGG - Intergenic
1090104952 11:123843029-123843051 ATGCTGCCATGAATGTAACATGG - Intergenic
1091100518 11:132868729-132868751 ATCCTGGCCTGGATGTGTCAAGG - Intronic
1093797232 12:23327010-23327032 ATCATAGCATGGATGAAAATTGG + Intergenic
1095268312 12:40186133-40186155 TTCCTGGGATGGATGAAATGGGG - Intergenic
1096791542 12:54048019-54048041 ATCCTGGGTTGGAGGAATCAAGG - Intronic
1099081176 12:78183539-78183561 ACCCTGGCTTGGATGAATCCAGG + Intronic
1099113762 12:78596917-78596939 ATCTTGGCATGGTTGAAGTATGG - Intergenic
1099631119 12:85146577-85146599 ATCCTGGGAAGCATGAAAGAGGG - Intronic
1101441630 12:104708495-104708517 ATCCTGGTGAGGAGGAAACAAGG + Intronic
1102581967 12:113895071-113895093 ATATTTGCAAGGATGAAACAGGG + Intronic
1103663257 12:122539279-122539301 ATCCTGGCAGGCAAGAGACATGG - Intronic
1104294298 12:127497847-127497869 ATCCTGCCATTTATAAAACATGG + Intergenic
1110486283 13:76048263-76048285 ATCCTCACATGGAGGAAAGAGGG + Intergenic
1112706832 13:102079943-102079965 TGCCTGGCATGTATGAGACATGG + Intronic
1112763591 13:102717880-102717902 ATCCTCACATGGTGGAAACAGGG - Intergenic
1112785946 13:102952051-102952073 ATCGTATCAGGGATGAAACAGGG + Intergenic
1113387591 13:109863394-109863416 ATCATGGCATGGATGCCCCACGG - Intergenic
1116622001 14:47216945-47216967 ATACTGGAGAGGATGAAACAAGG + Intronic
1118195322 14:63620269-63620291 ATCCTGTCATTTGTGAAACAGGG + Intronic
1119143880 14:72292850-72292872 GTCCTGGCATGGATGACACAGGG + Intronic
1119896780 14:78226458-78226480 ATCCTGGCATAGCAGAAAGATGG + Intergenic
1119933576 14:78570245-78570267 ATCCTGACATGGCAGAAAGAGGG - Intronic
1121208461 14:92188544-92188566 TTCCTGGAATGGATGAAATGTGG - Intergenic
1124230413 15:27940448-27940470 ATCTTGGCAAGGAAGAGACAGGG - Intronic
1129330520 15:74824720-74824742 ATCATGGCATTGACGACACAGGG - Intronic
1134020880 16:10920697-10920719 GTCTTGGCATCGATGAAATATGG + Intronic
1135488964 16:22891178-22891200 ATCCTGGCCTGGTTCCAACATGG + Intronic
1135957285 16:26966329-26966351 ACCCTGGCCTGGGAGAAACAAGG + Intergenic
1144704336 17:17357270-17357292 ATCCTGGTGAGGATGAAATAAGG + Intergenic
1146182596 17:30707648-30707670 ATCCTGGCGTAGAGGGAACAGGG - Intergenic
1152418090 17:80175889-80175911 TTCCTGGCAGGGATGAGAGAGGG + Intronic
1158999129 18:62955230-62955252 ACTCTGGCATGGGTGGAACATGG + Intronic
1160156316 18:76436509-76436531 GTCCTGGCTTGGACGCAACACGG - Intronic
1161512101 19:4677546-4677568 ATCCAGGGATGGATTAAAGAAGG - Intronic
1161945912 19:7436669-7436691 ATCCTGGCAGGGCTGACAGATGG - Intronic
1162976224 19:14208155-14208177 ATCCTGGAGTGGAGGGAACAGGG + Intergenic
1163865801 19:19772481-19772503 ACCCTGTCAGGAATGAAACAAGG + Intergenic
1164885913 19:31778489-31778511 GTTCTGGCATGTATGAATCAGGG - Intergenic
1165446597 19:35860203-35860225 CTCCTGGGATGGAGGAACCAGGG + Intronic
1166093488 19:40525282-40525304 ATCCAGGCCTGGATGGAAAAGGG - Intronic
925616281 2:5747258-5747280 ATCCTGGCAGGGAAGAGAGATGG - Intergenic
926895572 2:17683960-17683982 ATCCTGACAGGGAAGGAACAAGG + Intronic
927757013 2:25716844-25716866 CTCCTGACATGGAGGAAAGAAGG - Intergenic
927791349 2:26012190-26012212 TTCCTGGTATGCATGAGACAGGG + Intergenic
930218046 2:48717246-48717268 ATCCTAACATGTATCAAACAAGG - Intronic
930496085 2:52145799-52145821 ATGAAGGCATGGATGAAACCTGG - Intergenic
932900648 2:75695851-75695873 ATCCTGGGCAGGATGAAGCAGGG + Intronic
933221093 2:79689372-79689394 ATTCTGAAATGGCTGAAACATGG + Intronic
935730272 2:106059436-106059458 AGCCTGCCATGGTTGAAGCACGG - Intergenic
937680416 2:124638260-124638282 ATACTGACATTGCTGAAACAAGG - Intronic
937969503 2:127538242-127538264 CGCCTGGCAGGGATGAAATACGG + Intronic
941162784 2:162054073-162054095 ACCCTAGCATGTCTGAAACATGG + Intronic
942170911 2:173288616-173288638 ATCCTCTCATGGAAGAAACAGGG - Intergenic
942494336 2:176523646-176523668 ATCCTTGCATGAAAGAAACGTGG + Intergenic
947061992 2:226177424-226177446 ATTCTGGCATGGGTTAAACATGG + Intergenic
947319740 2:228903827-228903849 ATCCTGGGATGGAAGAGGCAGGG - Intronic
1168990515 20:2091570-2091592 ATCCTGGGATGAATAAGACAGGG - Intergenic
1174206767 20:48846184-48846206 AGCCTGGCCTAGAGGAAACAAGG + Intergenic
1174778194 20:53364820-53364842 ATAGTGGCTTGGATGAAAAAGGG - Intronic
1176015280 20:62927682-62927704 ATGCTTCCATGGATGAACCAGGG + Intronic
1176921890 21:14697665-14697687 ATCCTGACATGGAGGAAATAGGG - Intergenic
1177198924 21:17931749-17931771 ATACAGGCATGAATGAAACTGGG + Intronic
1184951582 22:47846533-47846555 ATCATGGAATTGATGAAATATGG + Intergenic
954835799 3:53466721-53466743 ATACTGGCAGGGATGTAAAATGG - Intergenic
957801360 3:85087164-85087186 ATCCTTGCATGCATGAATCTCGG + Intronic
959371509 3:105532734-105532756 ATTTTGGCATTGATGAAACTGGG + Intronic
959869722 3:111312634-111312656 ATTCTGGTATGGAGAAAACAAGG - Intronic
959966342 3:112359956-112359978 ATCCAGCCATGGAGGAGACAAGG + Intronic
960386656 3:117028617-117028639 ATCCTGGCATGCAGGCAAAAGGG + Intronic
961326406 3:126111890-126111912 ATCATGGCCTGGATGAAGGATGG + Intronic
962399706 3:135047954-135047976 ACCCTGCCATAGATGAAAGATGG + Intronic
963406464 3:144869979-144870001 ATCCTTCCATGCAGGAAACACGG - Intergenic
967071408 3:185965568-185965590 ATCCTAGGAGGGATGAAAAAGGG + Intergenic
968137948 3:196232550-196232572 ATCGTGGGATGGATGAGACGGGG + Intronic
968168409 3:196488041-196488063 ATCCTGGTATGGATTAAATTAGG + Intronic
969287921 4:6218589-6218611 ATCTTGGAATTGATGAAATACGG + Intergenic
970344398 4:15139423-15139445 ATACTGGCATGGATAATAAAGGG + Intergenic
972164010 4:36260543-36260565 ATCCTCACATGGAAGAAAGAGGG - Intergenic
972258256 4:37382250-37382272 ATCCTGGCAAGGTGGAAACCGGG - Intronic
973933854 4:55821698-55821720 ATTCTGTCATGTAAGAAACAAGG + Intergenic
975054706 4:69915652-69915674 ATTCTGGCTTGGATTAATCAGGG - Intergenic
975317508 4:72971712-72971734 ATCCTGGGCAGGATGAAGCAGGG - Intergenic
976349463 4:84044426-84044448 ATCCTGGCATGGAAGGAACTTGG + Intergenic
977084993 4:92583511-92583533 ATCCTTGCAGGCATGAAATAGGG - Intronic
982024986 4:151243479-151243501 ATCCTGACATGTAAGAGACAGGG - Intronic
982641840 4:157971496-157971518 AACATGGCATGGAAGAAAAATGG - Intergenic
983649405 4:170023492-170023514 TCCCTGGCATGGTTGAAAGATGG - Intronic
984399265 4:179240863-179240885 ATCCTCACATGGATGAAAACAGG - Intergenic
984487586 4:180391907-180391929 ATCCTCACATGGCAGAAACAGGG + Intergenic
994672563 5:102780089-102780111 ATCCTGGGTTGGATGGAGCAGGG - Intronic
996039481 5:118794076-118794098 ATCCTTACATAGAAGAAACAGGG + Intergenic
996881518 5:128302299-128302321 TTCCTGGCATGCAGTAAACAAGG + Intronic
997952620 5:138253956-138253978 ATCCTGACATGGGTGGAAGAAGG - Intronic
1003625318 6:7736264-7736286 TGCCTAGCATGGATCAAACAGGG - Intronic
1003711188 6:8592141-8592163 ATCATGGCATTGATGAGATAAGG + Intergenic
1004017869 6:11748825-11748847 AGCCTGGAATGGCTGGAACATGG + Intronic
1005497810 6:26404051-26404073 ATCCAGGCAGGGGTGAAGCATGG + Intronic
1006263525 6:32896144-32896166 CTGCTGGGATGCATGAAACATGG - Intergenic
1007202155 6:40118784-40118806 ATCCTGACATGGCAGAAAGATGG + Intergenic
1007679233 6:43622929-43622951 ATTCTGACTTGGATGTAACAGGG + Intronic
1011581690 6:88874558-88874580 ATGCTGGCTTGGATAAAAAAGGG - Intronic
1011796075 6:90954030-90954052 TTCCTGGGATAAATGAAACATGG + Intergenic
1012644669 6:101664069-101664091 CTCCAGGCATGGTTGAAACAAGG - Intronic
1016361150 6:143268759-143268781 ATCCTGGCATCCACCAAACATGG - Intronic
1018328308 6:162698669-162698691 ATACTGGCATGGAGGAGAAAAGG - Intronic
1019985263 7:4650810-4650832 GGCCTGGCAGGGATGAAACGGGG + Intergenic
1020399232 7:7756388-7756410 ATCCTGGCTTAAATGAAAAAGGG + Intronic
1020488576 7:8749853-8749875 ATCCTGACATGGAAGAATCAAGG - Intronic
1020861777 7:13502535-13502557 ATCCTAACATGGAAGAAAGAGGG - Intergenic
1022120468 7:27303178-27303200 CTCCTGGTAAGGAAGAAACAGGG + Intergenic
1024624516 7:51193578-51193600 ATCATCGCATGGCTGAAAAAAGG + Exonic
1028221349 7:88200832-88200854 CTCCTGGCATGGAAGAACTAAGG + Intronic
1028525048 7:91774815-91774837 TTCCTGGCAGGGAAGAAAGAAGG + Intronic
1032512210 7:132481167-132481189 TTCCTGGGATGGATTAAAGAGGG - Intronic
1032533454 7:132640713-132640735 GTCCTGGATTTGATGAAACATGG - Intronic
1033387994 7:140897693-140897715 ATCCTGGCATGGATGAAACATGG - Intronic
1036601042 8:10260363-10260385 AGCCTGAGATGGATGGAACAGGG + Intronic
1038576473 8:28708271-28708293 AACCTAGCCTGGATGAAAAAAGG - Intronic
1038831337 8:31064415-31064437 AACCTGACATGGAAGAAACGTGG - Exonic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1047920882 8:129633364-129633386 CTCCTGGCATTGAAGAAGCAAGG - Intergenic
1049834489 8:144725847-144725869 ATCCTGTCATATATGTAACAAGG + Intronic
1050642844 9:7686780-7686802 CTCCTGGCAAGGCTGAAACTTGG - Intergenic
1050784124 9:9377718-9377740 ATGTTGGCACAGATGAAACAAGG + Intronic
1051984751 9:23070571-23070593 ATCCTGGCATTGTGGCAACATGG + Intergenic
1053526235 9:38833357-38833379 ATCCACTCAAGGATGAAACAGGG - Intergenic
1054198461 9:62057781-62057803 ATCCACTCAAGGATGAAACAGGG - Intergenic
1054639892 9:67530580-67530602 ATCCACTCAAGGATGAAACAGGG + Intergenic
1056887090 9:90453556-90453578 CTCCTGGCTTGCATGAAAAAGGG + Intergenic
1057538526 9:95941724-95941746 ATTCTGAGATGGATGAAAAATGG - Intronic
1057947493 9:99342292-99342314 ATAATGGCTTTGATGAAACAGGG + Intergenic
1058158840 9:101545196-101545218 ATCTTGGCATGGTTTAATCATGG - Intronic
1062265377 9:135684460-135684482 ATCCTGGCAGGGAAGAGCCATGG + Intergenic
1187575208 X:20546565-20546587 ATGCTGGCATGGATGTAAGGTGG + Intergenic
1189171963 X:38917692-38917714 ATCCAGGCCTGGAAGAAAAATGG + Intergenic
1190582624 X:51903515-51903537 ATCCAGGCCTGGCTGAAAGAGGG - Intergenic
1190929109 X:54933551-54933573 ATCCGGGCCTGGCTGAAAGAGGG - Intronic
1192231267 X:69266710-69266732 ATCCTGACATGGGGGAAAGAGGG - Intergenic
1192423392 X:71053636-71053658 TTCCTGGCAGGGATGGAACAAGG - Intergenic
1195244057 X:102980196-102980218 ATCCTGGGATGGCTGACCCATGG - Intergenic
1195718597 X:107843391-107843413 CTCCAGGGATGGATGGAACATGG + Intronic
1195918102 X:109955772-109955794 ATCCTCACATGGAGGAAAGAGGG + Intergenic
1196154843 X:112417410-112417432 ACCCTTGCATTGAAGAAACAAGG - Intergenic
1196323174 X:114368506-114368528 GTCCTGGCATTGATGAAAGAAGG - Intergenic