ID: 1033389430

View in Genome Browser
Species Human (GRCh38)
Location 7:140912453-140912475
Sequence CTGTCTTAGAAGAGGTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033389430_1033389436 28 Left 1033389430 7:140912453-140912475 CCCTCTTACCTCTTCTAAGACAG 0: 1
1: 0
2: 0
3: 29
4: 287
Right 1033389436 7:140912504-140912526 TGAAACGTTTTACTCTCTAATGG 0: 1
1: 0
2: 0
3: 16
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033389430 Original CRISPR CTGTCTTAGAAGAGGTAAGA GGG (reversed) Intronic
900961234 1:5922133-5922155 CTGCCTTTGAAGATGGAAGAAGG + Intronic
901461610 1:9395250-9395272 CTGGCTTTGAAGAGGGAGGATGG - Intergenic
902310548 1:15578593-15578615 CTGGCTTAGAAGAGGGGAGGAGG - Intronic
903688746 1:25153931-25153953 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
905413662 1:37790083-37790105 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
905580480 1:39080556-39080578 CTGTCCTAGGAGAGGATAGAAGG + Intergenic
906789748 1:48648444-48648466 CTCTCTTGGAAGAGGGAAGTGGG - Intronic
907548661 1:55285531-55285553 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
907809442 1:57853817-57853839 CTGTGTTACAAGAGGTGAGAAGG + Intronic
909677124 1:78250997-78251019 CTGCTTTAGAACAGGTTAGAGGG + Intergenic
910891055 1:92020735-92020757 CCGTCTCAGAAGAGGTGAGGGGG + Intergenic
911820658 1:102415680-102415702 TTGTCTTACAAGAGGAAAGAAGG + Intergenic
912046405 1:105464622-105464644 CTGTCTTAGAAGAGTTGAGGAGG + Intergenic
915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG + Intronic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
916896187 1:169164656-169164678 GTTTCTTAGAGGAGGTAAGGTGG + Intronic
917349409 1:174061708-174061730 CTGTCTAAAAAGAAGAAAGAAGG - Intergenic
918405116 1:184204478-184204500 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
919442440 1:197653648-197653670 CTTTCTGAGAAGAGGAAATAGGG - Intronic
919500863 1:198336768-198336790 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
921227596 1:213035605-213035627 CTGTTTTATAAGAGGTACTATGG - Intergenic
921681767 1:218041912-218041934 GTGGCATTGAAGAGGTAAGATGG + Intergenic
921952976 1:220951984-220952006 CTGAGTTAGAAGAAGTAAGAAGG + Intergenic
922432572 1:225570477-225570499 CTGTCTTAGGAAGGGTAAGGTGG - Intronic
922723674 1:227912273-227912295 CTGTCTCAAAAAAGGGAAGAAGG - Intergenic
923699695 1:236288159-236288181 CTGACAAAGAAGAGGGAAGATGG - Intergenic
924166624 1:241289844-241289866 CTGAGTGAGAAGAGGAAAGATGG + Intronic
1062886088 10:1017186-1017208 CTGTCTGGGAAGAGGAAAGCTGG + Exonic
1064764211 10:18654314-18654336 CTGTCATAGAAGAAATAAAAAGG - Intronic
1067133413 10:43586778-43586800 CTGTGTTAGCAGAGACAAGAAGG - Intergenic
1068105955 10:52616622-52616644 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1068988698 10:63130067-63130089 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1069506555 10:69003559-69003581 CTGTTTTGGAAGACGTAAGAGGG + Intronic
1070629453 10:78074568-78074590 CTGGCTTTGAAGATGGAAGAGGG + Intergenic
1071167525 10:82823717-82823739 TTGTCTGAGATGAGGGAAGAGGG - Intronic
1071326494 10:84523793-84523815 CTGCCTTAGAGCAGGCAAGATGG + Intergenic
1071575927 10:86726278-86726300 CTTTCTGAGAAGAGGCAGGAGGG + Intronic
1071805616 10:89117279-89117301 CTGACTTTGAAGATGGAAGAAGG + Intergenic
1071868354 10:89763448-89763470 CTGTATTGGAAGAGAAAAGAGGG + Intronic
1072339014 10:94428202-94428224 CTGTCTTGGAAGTGGTAGGTTGG + Intronic
1072419659 10:95279426-95279448 CTGTATTAGAAGAGTCAAGAAGG - Intronic
1073040310 10:100599683-100599705 CTGGTTAAGAAAAGGTAAGAAGG - Intergenic
1075273549 10:121074157-121074179 CTGTTTTGGAAAAGGCAAGAAGG - Intergenic
1075489655 10:122855764-122855786 TTGCCTTAGAAGTGGTGAGATGG - Exonic
1077705872 11:4484970-4484992 CTGAGTTAGAATAGATAAGAGGG - Intergenic
1077746295 11:4910209-4910231 CTGGCTTTGAAGATGAAAGAGGG - Intronic
1078381936 11:10850485-10850507 TTGTCTTAGAAAAGTTCAGAAGG + Intronic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1078930565 11:15909319-15909341 CTGGCTTTGAAGAGGAATGAAGG + Intergenic
1080228397 11:29987009-29987031 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1080496198 11:32822742-32822764 ATGACTTAGAAGAAATAAGAGGG + Intergenic
1080963723 11:37190002-37190024 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1082812211 11:57485175-57485197 CGGTAATAGAAGAGGTAGGAAGG + Exonic
1085092599 11:73731203-73731225 TAGTCTTAGAAGGGGTATGAGGG + Intronic
1085386170 11:76159591-76159613 CTGTTTTCTAAGAGGTTAGAGGG + Intergenic
1086197429 11:84157621-84157643 CTGGCTTATGAGAGGTGAGAGGG - Intronic
1086305653 11:85479288-85479310 CTGTCTTCTAAGAAGTAAGCGGG - Intronic
1089524833 11:119090054-119090076 CTGCCAGAGAAGAGGTAAGTGGG + Exonic
1089900117 11:121973232-121973254 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1090886930 11:130885513-130885535 CTGTCTTAGAAAAGAAATGAAGG - Intronic
1093159003 12:15722785-15722807 GTGCCTTAAAAGAGGTGAGAAGG - Intronic
1093786619 12:23199217-23199239 ATGACTTTGAAGAGGGAAGAAGG + Intergenic
1094681864 12:32674355-32674377 CTGGCTTTGAAGAGGTTGGAAGG + Intergenic
1095326265 12:40897007-40897029 CTGACTTAGAAGTTGGAAGATGG + Intronic
1095552406 12:43458563-43458585 CTGTCTTAAAGGAGATGAGAGGG - Intronic
1096520289 12:52181102-52181124 GTGTCATAGAAGATGCAAGAGGG - Intronic
1097532074 12:60814553-60814575 CTGTTTTATAAGAGGTATGAAGG - Intergenic
1099030474 12:77520145-77520167 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1100108347 12:91206015-91206037 CTGGCTTTGAAGAAGTACGAGGG - Intergenic
1100333793 12:93610635-93610657 CTCTCGTAGAAGAGGTAGAAGGG + Intergenic
1104063961 12:125291135-125291157 CTTTATGAGAAGAGGTTAGAAGG + Intronic
1104518761 12:129453249-129453271 CTGTTTTAGATGATCTAAGAAGG + Intronic
1106186545 13:27414828-27414850 CTGTCTTGAAAGAGGGGAGAAGG + Intergenic
1106219437 13:27733435-27733457 TTGTCTTAGCAGGGGTAAAAGGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106873280 13:34044619-34044641 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1107260871 13:38489543-38489565 CTGGCTTTGAAGAGGAGAGAAGG + Intergenic
1107676654 13:42804665-42804687 CCTTCTTAGAGGATGTAAGAAGG + Intergenic
1107691775 13:42960775-42960797 CTGGCTTTGAAGATGTAGGAAGG - Intronic
1108181182 13:47841469-47841491 GTGTCATAGAAGAAGAAAGAAGG - Intergenic
1109349114 13:61154085-61154107 TTGTCTTAGAAGATGGAGGAAGG + Intergenic
1109494580 13:63151226-63151248 CTGGCTGAGAAGATGTAAGGGGG + Intergenic
1109588901 13:64448973-64448995 TTATCTGAGAAGAGGTAAGATGG + Intergenic
1109615185 13:64825619-64825641 CTGTTATAGAAGAGATAAAAAGG - Intergenic
1110177545 13:72574709-72574731 CTATCTTAGATTAGGTAAGCAGG - Intergenic
1110326805 13:74225838-74225860 CAGTCTAAGAAGAGGAAAGAGGG + Intergenic
1112392890 13:99001497-99001519 GTGTGTTAGAAGAGGTAGCAGGG + Intronic
1112726103 13:102306557-102306579 CTGGCTTTGACAAGGTAAGAGGG + Intronic
1112769172 13:102776775-102776797 CTGGCTGAGAAGATGGAAGAGGG + Intergenic
1113015173 13:105821083-105821105 CTGCCTTAGCAGAGGCAAGCAGG + Intergenic
1114498216 14:23148694-23148716 CTGGCTTTGAAGATGAAAGATGG + Intronic
1114794559 14:25698315-25698337 TTATCTTTGATGAGGTAAGAGGG - Intergenic
1115983154 14:39076347-39076369 CTGTCTGAGATGAGTTAAGCAGG - Intronic
1119616344 14:76101358-76101380 CTGTCTTGGAAGTGGAGAGATGG + Intergenic
1122029360 14:98901341-98901363 CAGACATAGAAGAGGGAAGAGGG + Intergenic
1123453032 15:20385359-20385381 CTGGCTTAGAAAATGGAAGAGGG + Intergenic
1124934453 15:34157041-34157063 CAGTCTGAGAAGAGCTAGGAAGG + Intronic
1125159014 15:36622340-36622362 CTGGCATAGAAGTGGTAGGAAGG + Intronic
1125249478 15:37683106-37683128 CTGTCTTTGAGGAGGTGACATGG + Intergenic
1125315335 15:38425510-38425532 CTGGCTCTGAAGATGTAAGAAGG + Intergenic
1127032634 15:54880779-54880801 CTGTCTTAGTAGAGGTAAACCGG - Intergenic
1127866059 15:63034009-63034031 CTTCCTTTGAAGAGGTAGGAGGG - Intergenic
1128248368 15:66148445-66148467 CTGGCTGAGATGAGGAAAGAGGG + Intronic
1129554298 15:76489021-76489043 CTTTCTTATAAAAGGCAAGATGG - Intronic
1129941152 15:79497656-79497678 CTGCTTTAGAAAAGGTAGGAGGG + Intergenic
1130369117 15:83268605-83268627 CTGTCTTGGAACAAGTAAAAGGG + Intronic
1130677541 15:85966824-85966846 TTCTCTAAGAAGAGGCAAGATGG - Intergenic
1130763492 15:86845953-86845975 CTTTCTTTCAAGAGGGAAGAAGG - Intronic
1130847130 15:87758078-87758100 CTGTCTTAAAAGATGAAGGAAGG + Intergenic
1130893841 15:88155296-88155318 CTGGCTTTGAAGATGGAAGAGGG + Intronic
1131236561 15:90702007-90702029 CTGTCTTAGCTGACCTAAGAAGG + Intergenic
1131987866 15:98063467-98063489 CTGTCTGAAAATAGCTAAGATGG - Intergenic
1133472612 16:6090110-6090132 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1140058469 16:71546410-71546432 ATGTGATAGAAGAGGAAAGACGG - Intronic
1140706969 16:77639851-77639873 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1140952899 16:79836179-79836201 CTGGCCAAGAAGAGGTAACATGG + Intergenic
1140987915 16:80176724-80176746 CTGGCTTTGAAGATGAAAGAGGG + Intergenic
1141510866 16:84511252-84511274 CTGCCTTGGACGAGTTAAGATGG + Intronic
1143860305 17:9885640-9885662 CCATCTTAGAGGAAGTAAGATGG - Intronic
1145360357 17:22207101-22207123 CTGTCTTAGGGAAGGTAAAAGGG - Intergenic
1147485129 17:40805444-40805466 CTGTCTTTGAAGATGAAGGATGG + Intergenic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1152095711 17:78270464-78270486 CTGTCTTCTAAGAGGCAAGATGG + Intergenic
1153164208 18:2243570-2243592 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1154200213 18:12294428-12294450 CCATCTTAGAAGAGGTGAAATGG + Intergenic
1155358448 18:24977107-24977129 CTTTCTGAGAGGAGGTGAGAGGG - Intergenic
1156161891 18:34369605-34369627 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1157108175 18:44794183-44794205 CTATTTTAGAAGAGCTAAAAGGG - Intronic
1157131494 18:45011810-45011832 CAGTCTCAGAAGATGAAAGATGG + Intronic
1159647409 18:70935604-70935626 CTGGCTTTGAAGATGTCAGAGGG + Intergenic
1159823409 18:73175324-73175346 CTGTCTTAGAAGGGGAGAGTTGG - Intronic
1161806368 19:6445489-6445511 CTGGCTTTGAAGATGGAAGAAGG + Intronic
1161915298 19:7223903-7223925 GTGGCTTAGAGGAGGGAAGATGG - Intronic
1161998094 19:7726794-7726816 CTGCCTTTGAAGATGGAAGAAGG + Intergenic
1163037911 19:14582112-14582134 CTGGCTTTGAAGATGCAAGAAGG - Intergenic
1165004244 19:32791575-32791597 CAGTCTTAGAAGATGAAAGCAGG + Intronic
1165719956 19:38072110-38072132 CTGTCTGACTTGAGGTAAGAAGG + Intronic
1166605902 19:44142192-44142214 CTGCCTAAAAAGAGGTCAGAAGG - Intronic
1167402627 19:49283058-49283080 CGGCCTTAGAAGAACTAAGAAGG - Intergenic
925537423 2:4932600-4932622 CTTTTTTAGAAGAGTAAAGAAGG - Intergenic
925642670 2:6001360-6001382 CTGTCTGAAAATAGATAAGAAGG - Intergenic
926443108 2:12910648-12910670 CTGGCTTTGAAGATGAAAGAAGG - Intergenic
926482279 2:13414065-13414087 CTGGCTTAGAAAATGGAAGAGGG - Intergenic
926550871 2:14299529-14299551 CTGCCTTAGCAGAGGTATGAGGG - Intergenic
926848606 2:17169833-17169855 CTGTCCTAGAGGACGTAAGAAGG - Intergenic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
928615911 2:33039446-33039468 ATGTAGTATAAGAGGTAAGAAGG - Intronic
930175356 2:48295924-48295946 GAGACTTAGAAGAGATAAGAGGG + Intergenic
930275712 2:49308797-49308819 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
930450302 2:51527501-51527523 CTGACTTGGAAGATGTAAGGAGG - Intergenic
930725532 2:54677789-54677811 ATTTCTCAGAAGAGGAAAGAGGG + Intergenic
934926675 2:98386768-98386790 CTGGCTTTGAAGATGTAGGAAGG + Intronic
936497070 2:113031638-113031660 TTGTCTTTGATGAGGTCAGATGG + Intronic
938265566 2:129925681-129925703 ATGTCATAGAGGAGGTAACAGGG - Intergenic
939057247 2:137380574-137380596 CTGGCTTTGAAGAGGGAGGAAGG + Intronic
939880415 2:147624535-147624557 CTCTCTTAGAAGAGTCAATAAGG - Intergenic
941080963 2:161060050-161060072 CTGCCTTAGAAGAGGAGAAAGGG - Intergenic
941551928 2:166927524-166927546 CTGGCTTTGAAGATGGAAGAAGG - Intronic
941584764 2:167343828-167343850 CTGTATTAGAAGGGGAAAGATGG + Intergenic
942856042 2:180549837-180549859 CTGGCTTTGAAGAAGGAAGATGG - Intergenic
944630852 2:201622558-201622580 CTGGCTTTGAAGATGGAAGAGGG - Exonic
945030068 2:205655112-205655134 TTCTCTCAGAAGAGGCAAGACGG - Intergenic
945057274 2:205880027-205880049 CTATCTTCGAAAAGTTAAGAAGG + Intergenic
945322016 2:208435556-208435578 CTGACTTCGAAGATGGAAGAAGG + Intronic
945654486 2:212606466-212606488 ATCTCTTGGAAGAGGGAAGAGGG + Intergenic
945741061 2:213661906-213661928 CAGTCTTTGAGGAGGAAAGATGG - Intronic
945932299 2:215867084-215867106 CTGTGGCAGAAGAGGTGAGAGGG - Intergenic
946665097 2:222041252-222041274 CAGTCTTAGAAGATGTAACTTGG - Intergenic
947960867 2:234236165-234236187 ATGGCTTAGAAGACGGAAGAAGG + Intergenic
948026582 2:234782814-234782836 CTGGCTTAGAAGATGAAGGATGG + Intergenic
948056229 2:235010959-235010981 TTCTCCTAGAAGAGGGAAGAAGG - Intronic
1169216936 20:3799630-3799652 CTGCCTTAGAAGAGGCCAGCAGG - Intronic
1169961072 20:11160832-11160854 ATGTCTTAGAAATAGTAAGATGG - Intergenic
1174116617 20:48230783-48230805 CTAGCTGGGAAGAGGTAAGATGG - Intergenic
1174628764 20:51938161-51938183 TTGTCTCTGAAGAGGGAAGATGG - Intergenic
1175474762 20:59263979-59264001 CTTTCCTAGAAGTGGAAAGAAGG + Intergenic
1179366773 21:40765981-40766003 CTGTGATAGCAGGGGTAAGAGGG - Intronic
1179553460 21:42157813-42157835 CTGCCTTTGAAGAGGGAGGAGGG - Intergenic
1180115472 21:45700844-45700866 CTGCCTAAGAAGATGTAAAATGG - Intronic
1183170234 22:36182497-36182519 CTGACTTTGAAGAGGAAGGAAGG - Intergenic
1183927954 22:41219237-41219259 CTGTCCTTGAAGAGCTAAGCCGG - Intronic
1185086303 22:48742771-48742793 GTGTATTAGAAGAGGAGAGATGG + Intronic
950875336 3:16266157-16266179 CTTTCTTAGAAGAGGAAATAAGG - Intronic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
952711890 3:36439940-36439962 CTGTCAAAGAAGGGGGAAGAAGG - Intronic
955303322 3:57805532-57805554 CAGTGTTAGAAGTAGTAAGAGGG - Intronic
955698703 3:61662104-61662126 TTGTCTTGGAAGGGGTTAGAAGG + Intronic
956425420 3:69129478-69129500 CTGTTTTAGAAAAAGTAAAATGG - Intergenic
957128996 3:76199252-76199274 CTGGCTTTGAAGATGTAGGAAGG + Intronic
957661703 3:83164131-83164153 CTGTCTCCGAAGAAGTAAGCTGG - Intergenic
957814391 3:85274395-85274417 ATGTCTTAGAAGAGATGAGAAGG + Intronic
959029522 3:101281818-101281840 CTGTCTTTGAAGATGGAAGTGGG + Intronic
960262169 3:115580423-115580445 CTGCCTTAGAAGATGTACAATGG - Intergenic
960623506 3:119658958-119658980 ATGTGATAGAAAAGGTAAGATGG - Intronic
960636948 3:119793551-119793573 CTGGCTTTGAAGATGGAAGAAGG - Intronic
960743981 3:120865957-120865979 CTGGCTTTGAAGATGCAAGAAGG + Intergenic
964158649 3:153618508-153618530 CTGTCTTGGGAGAGCAAAGAAGG - Intergenic
964357910 3:155867388-155867410 CTGTCAAAGAGGAGGTAACAGGG + Intergenic
965382484 3:168007069-168007091 CAGTATTAGAAGGGATAAGATGG + Intergenic
966120401 3:176513562-176513584 CTGTCTTAAAGATGGTAAGAAGG + Intergenic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
971391808 4:26193024-26193046 CTGGCTTTGAAGATGGAAGAAGG + Intronic
972955075 4:44378981-44379003 CTGGCTTTGAAGATGAAAGATGG - Intronic
973611330 4:52638283-52638305 CTGGCCTTGAAGAGGGAAGAAGG + Intronic
975628851 4:76379401-76379423 CTCTCTAAGAAGAGTTTAGAAGG + Exonic
976208237 4:82641944-82641966 CTGTCTTGGACACGGTAAGAGGG + Intronic
977015344 4:91685319-91685341 CTGTGTTAGTAGAGAAAAGAAGG - Intergenic
978312844 4:107404702-107404724 CTGTCTAGGAAGAGGAAAAATGG - Intergenic
979970822 4:127132676-127132698 CTGACTTAGAAGTGGTAACCTGG + Intergenic
980383749 4:132060525-132060547 CTGCCTTTGAAGAGGGAAGAAGG + Intergenic
981089533 4:140718496-140718518 CTGTCTGGGAAGAGCTAAGGAGG - Intronic
981291598 4:143082728-143082750 CTGACTTTGAAGATGGAAGAAGG + Intergenic
981792746 4:148558142-148558164 CTGTCTTGGAAGTGCTCAGAGGG - Intergenic
983194235 4:164787599-164787621 CTGTCATGGAAGAGAGAAGACGG - Intergenic
984088489 4:175341411-175341433 ATGTCTTAGAAGAGGTCATATGG + Intergenic
984105683 4:175542165-175542187 CTGGCTTAGAAGATGTAGGAAGG + Intergenic
985003918 4:185513672-185513694 CTGGCTTAGCTGAGGTCAGAAGG + Intronic
986799757 5:11246865-11246887 ATGTCAGACAAGAGGTAAGAAGG + Intronic
987736279 5:21847525-21847547 CTGCCTTAGAGGAAGGAAGAAGG - Intronic
989171292 5:38472266-38472288 CTGTTGTCAAAGAGGTAAGAAGG + Intergenic
989799514 5:45519722-45519744 CTGTCTTGGAAAATCTAAGAGGG + Intronic
990568901 5:57057688-57057710 CTGGCTTTGAAGAGGAAAGGAGG + Intergenic
990781718 5:59372007-59372029 CTGTCTTCTAAGAGGTTTGATGG - Intronic
991772304 5:70051406-70051428 ATGTCCTAGAGTAGGTAAGAAGG + Intronic
991851597 5:70926824-70926846 ATGTCCTAGAGTAGGTAAGAAGG + Intronic
992278217 5:75143465-75143487 CTGTCTGTTAAGAGGTAGGAAGG - Intronic
992308703 5:75471458-75471480 CTGGCTTAGAAGTGGTATGCTGG + Intronic
992754616 5:79892575-79892597 CTGGCTTAGAAGATGAAGGAAGG + Intergenic
993010064 5:82470807-82470829 CTGACTTAGAAGTGGGAAGTGGG + Intergenic
994154982 5:96493400-96493422 CTCTCTGTGAAGAGGCAAGATGG - Intergenic
994207200 5:97048365-97048387 CTGTCTTGGAAGATGGAGGAAGG + Intergenic
995437788 5:112157590-112157612 CTGGCTTTGAAGATGTAGGAAGG - Intronic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
997422664 5:133781441-133781463 TTGTCTTAGAAGGGGTAGGAAGG + Intergenic
997546804 5:134715148-134715170 ATCTCTCAGATGAGGTAAGATGG + Exonic
1000379927 5:160619927-160619949 GTGACTTACAAGAGGTAACATGG - Intronic
1000427693 5:161112030-161112052 CTGTATGAGTAGGGGTAAGAAGG - Intergenic
1000720925 5:164705601-164705623 CTGTGTTGGTAGAGGTAGGATGG + Intergenic
1001153716 5:169254614-169254636 CTAGCTTAGAAGAGGCAATAGGG + Intronic
1001200909 5:169715766-169715788 CTGGCTGAGAAGGGGTATGAGGG - Intronic
1004215579 6:13701104-13701126 CTGTCCTGGAAGAGGAAAAAGGG - Intronic
1004538961 6:16530947-16530969 CTGTCTTTGAAGAGTTTATATGG - Intronic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1004888302 6:20072719-20072741 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1004923727 6:20400416-20400438 CTGTTTCAGAAAAGGTAACAAGG + Intergenic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1007298609 6:40848536-40848558 CCGTCTAAGAAGAGGAAATAAGG - Intergenic
1007530199 6:42535352-42535374 AGGTCTGAGAAGAGGAAAGAAGG - Intergenic
1009524005 6:64720199-64720221 CTGGCTTTGAAGAGGGAGGAAGG - Intronic
1009764605 6:68055790-68055812 CTACCTTAGAAGAGGCAATAAGG - Intergenic
1010784030 6:79979030-79979052 CTGTGCTAGATGAGGGAAGATGG - Intergenic
1011418536 6:87148568-87148590 CTGTATCAGAAGAGGTATGCAGG - Intergenic
1013442889 6:110189632-110189654 TTGCCCTAGAAGAGGTAGGAGGG - Intronic
1014602478 6:123430914-123430936 CTGTTTTAGAGAAAGTAAGATGG - Intronic
1015067279 6:129046025-129046047 CTGTCTTTGAAGGGGGCAGATGG + Intronic
1015293316 6:131562162-131562184 CTCTCTTAGGTGAGGAAAGAAGG + Intergenic
1015868086 6:137747970-137747992 TTTTCTTAGAAGAGGGAAGCAGG + Intergenic
1018195954 6:161356296-161356318 CTGACTGAGAAGAGGTCAGCTGG + Intronic
1019490052 7:1308415-1308437 CTATCTCAGAGGAGATAAGATGG + Intergenic
1020500877 7:8918616-8918638 ACGTGTTAGAAGAGGTAAAAAGG - Intergenic
1021149208 7:17128891-17128913 ATCTCATAGAAGAGGTAAAATGG + Intergenic
1021823951 7:24529027-24529049 CTTCTTTAAAAGAGGTAAGAAGG + Intergenic
1023310458 7:38881274-38881296 CTAGCTTTGAAGAGGGAAGAAGG - Intronic
1024127703 7:46317558-46317580 CATTCTTAGAAGAGGCGAGAGGG - Intergenic
1025071567 7:55904159-55904181 CTGTCTTGGAAGAAGTAATGAGG + Intronic
1027221912 7:76219598-76219620 CTGTCTTTGAATAGATAGGAAGG - Intronic
1028123637 7:87086087-87086109 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1028583934 7:92434696-92434718 TTGTCTTTGAAGATGGAAGAAGG + Intergenic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1031206770 7:118768485-118768507 CTGGCTTTGAAGATGTAAGAGGG + Intergenic
1031646184 7:124229053-124229075 ATCCCTTAGAAGAGGAAAGAGGG + Intergenic
1033269503 7:139918112-139918134 ATGGCTTAGAAGAGGGAAAATGG - Intronic
1033389430 7:140912453-140912475 CTGTCTTAGAAGAGGTAAGAGGG - Intronic
1033659414 7:143393406-143393428 CTGCCTGAGAAGAGAAAAGATGG + Intronic
1037269054 8:17105316-17105338 CTGTCCTAGAAAAGGTTATATGG - Intronic
1042398783 8:68321606-68321628 CTGTCTGAGAAAAGTTAAAAGGG + Intronic
1042837006 8:73088018-73088040 CTTTCTTAGAGGAGGTGGGAAGG + Intronic
1045129055 8:99127834-99127856 CTGTATTTTAAAAGGTAAGAAGG + Intronic
1045233291 8:100326700-100326722 AGGTCTTGGAAGAGGGAAGAAGG - Intronic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1048409060 8:134152773-134152795 ATTTCTTAGAAGATGTCAGAGGG - Intergenic
1050034555 9:1421693-1421715 CTTTCAGAGAAGAGGTGAGAAGG + Intergenic
1050279025 9:4031473-4031495 GTGGCTGAGAGGAGGTAAGAAGG + Intronic
1051244260 9:15093233-15093255 CTGGCTTTGAAGAGGGAAGGAGG - Intergenic
1052138108 9:24940847-24940869 TTCTCTGAGAAGAGTTAAGAAGG - Intergenic
1054990187 9:71316588-71316610 CTGTCTTTGAAGATGGAAGGAGG + Intronic
1055058964 9:72049253-72049275 CTGACTTTGAAGAGGGAGGAGGG - Intergenic
1055485075 9:76748716-76748738 CTGCATTAGAAGAGGTGAGTGGG + Intronic
1055680568 9:78710937-78710959 CTGTATCAGTAGAGTTAAGATGG + Intergenic
1055881187 9:81005810-81005832 ATGTCTTGAAAGAAGTAAGAAGG + Intergenic
1058349233 9:104001172-104001194 ATGGTTTAGAAGAGGTAGGAGGG + Intergenic
1058966045 9:110039431-110039453 ATGTCCTAGAGGAGATAAGAAGG + Intronic
1059152613 9:111963153-111963175 CTGACTTTGAAGATGGAAGAAGG + Intergenic
1059645321 9:116260538-116260560 CTGAGTTAGAAGATGTAAGATGG - Intronic
1062699536 9:137891705-137891727 CTGGACTAGAAGAGGTGAGAAGG + Intronic
1186076634 X:5886816-5886838 TTGTTTTAGAAGTGCTAAGAGGG - Intronic
1186387152 X:9121445-9121467 ATGTCTTAAAAGTGGTGAGATGG - Intronic
1186532594 X:10312292-10312314 CTGGCTTTGAAGAGGAAGGAAGG - Intergenic
1186827812 X:13359135-13359157 GTGTCTTAGAAGACATATGAGGG + Intergenic
1188062865 X:25622051-25622073 TGGTCTTAGAAGAGTTCAGAGGG + Intergenic
1188260908 X:28022665-28022687 CTGTCTTAGAAGGTGTGAGATGG + Intergenic
1188266870 X:28087750-28087772 CTGGCTTTGAAGATGAAAGAAGG - Intergenic
1189065708 X:37806065-37806087 CTTTCTGAGAAGAGGTTCGAAGG + Intronic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189551467 X:42098094-42098116 GTGTCTCAGAAGGGGTAAGTTGG - Intergenic
1190320371 X:49176344-49176366 CAGTCTTAGTGGAGGAAAGAAGG - Intronic
1192450521 X:71241932-71241954 CTGTCTTAAATGAGGAAAGAGGG + Intronic
1193866472 X:86737982-86738004 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1196560083 X:117135754-117135776 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1197498013 X:127209610-127209632 CTGTCTTTGAAGATGAAGGAAGG - Intergenic
1198379608 X:136071486-136071508 CTATTTCAGAAGAGGTAAGGGGG + Intergenic
1198464930 X:136896555-136896577 CAGTCTTTGAAGAGGTAATTAGG - Intergenic
1198953274 X:142097587-142097609 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1199318908 X:146415099-146415121 CTGTCTTTGAAGATAGAAGAAGG + Intergenic