ID: 1033391162

View in Genome Browser
Species Human (GRCh38)
Location 7:140928795-140928817
Sequence TTCGAGATAGAAATGCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033391162_1033391165 5 Left 1033391162 7:140928795-140928817 CCTACCAGCATTTCTATCTCGAA No data
Right 1033391165 7:140928823-140928845 CATTCTATTTTAATGGATGCTGG No data
1033391162_1033391164 -2 Left 1033391162 7:140928795-140928817 CCTACCAGCATTTCTATCTCGAA No data
Right 1033391164 7:140928816-140928838 AATCTTGCATTCTATTTTAATGG No data
1033391162_1033391166 27 Left 1033391162 7:140928795-140928817 CCTACCAGCATTTCTATCTCGAA No data
Right 1033391166 7:140928845-140928867 GAGAGTCCCACCAGCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033391162 Original CRISPR TTCGAGATAGAAATGCTGGT AGG (reversed) Intergenic
No off target data available for this crispr