ID: 1033391164

View in Genome Browser
Species Human (GRCh38)
Location 7:140928816-140928838
Sequence AATCTTGCATTCTATTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033391161_1033391164 16 Left 1033391161 7:140928777-140928799 CCGGACACAAGTTTATTTCCTAC No data
Right 1033391164 7:140928816-140928838 AATCTTGCATTCTATTTTAATGG No data
1033391163_1033391164 -6 Left 1033391163 7:140928799-140928821 CCAGCATTTCTATCTCGAATCTT No data
Right 1033391164 7:140928816-140928838 AATCTTGCATTCTATTTTAATGG No data
1033391159_1033391164 18 Left 1033391159 7:140928775-140928797 CCCCGGACACAAGTTTATTTCCT No data
Right 1033391164 7:140928816-140928838 AATCTTGCATTCTATTTTAATGG No data
1033391158_1033391164 26 Left 1033391158 7:140928767-140928789 CCTTTCTTCCCCGGACACAAGTT No data
Right 1033391164 7:140928816-140928838 AATCTTGCATTCTATTTTAATGG No data
1033391160_1033391164 17 Left 1033391160 7:140928776-140928798 CCCGGACACAAGTTTATTTCCTA No data
Right 1033391164 7:140928816-140928838 AATCTTGCATTCTATTTTAATGG No data
1033391162_1033391164 -2 Left 1033391162 7:140928795-140928817 CCTACCAGCATTTCTATCTCGAA No data
Right 1033391164 7:140928816-140928838 AATCTTGCATTCTATTTTAATGG No data
1033391157_1033391164 27 Left 1033391157 7:140928766-140928788 CCCTTTCTTCCCCGGACACAAGT No data
Right 1033391164 7:140928816-140928838 AATCTTGCATTCTATTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033391164 Original CRISPR AATCTTGCATTCTATTTTAA TGG Intergenic
No off target data available for this crispr