ID: 1033391165

View in Genome Browser
Species Human (GRCh38)
Location 7:140928823-140928845
Sequence CATTCTATTTTAATGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033391160_1033391165 24 Left 1033391160 7:140928776-140928798 CCCGGACACAAGTTTATTTCCTA No data
Right 1033391165 7:140928823-140928845 CATTCTATTTTAATGGATGCTGG No data
1033391163_1033391165 1 Left 1033391163 7:140928799-140928821 CCAGCATTTCTATCTCGAATCTT No data
Right 1033391165 7:140928823-140928845 CATTCTATTTTAATGGATGCTGG No data
1033391162_1033391165 5 Left 1033391162 7:140928795-140928817 CCTACCAGCATTTCTATCTCGAA No data
Right 1033391165 7:140928823-140928845 CATTCTATTTTAATGGATGCTGG No data
1033391159_1033391165 25 Left 1033391159 7:140928775-140928797 CCCCGGACACAAGTTTATTTCCT No data
Right 1033391165 7:140928823-140928845 CATTCTATTTTAATGGATGCTGG No data
1033391161_1033391165 23 Left 1033391161 7:140928777-140928799 CCGGACACAAGTTTATTTCCTAC No data
Right 1033391165 7:140928823-140928845 CATTCTATTTTAATGGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033391165 Original CRISPR CATTCTATTTTAATGGATGC TGG Intergenic
No off target data available for this crispr