ID: 1033391166

View in Genome Browser
Species Human (GRCh38)
Location 7:140928845-140928867
Sequence GAGAGTCCCACCAGCCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033391163_1033391166 23 Left 1033391163 7:140928799-140928821 CCAGCATTTCTATCTCGAATCTT No data
Right 1033391166 7:140928845-140928867 GAGAGTCCCACCAGCCAGCCAGG No data
1033391162_1033391166 27 Left 1033391162 7:140928795-140928817 CCTACCAGCATTTCTATCTCGAA No data
Right 1033391166 7:140928845-140928867 GAGAGTCCCACCAGCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033391166 Original CRISPR GAGAGTCCCACCAGCCAGCC AGG Intergenic
No off target data available for this crispr