ID: 1033404317

View in Genome Browser
Species Human (GRCh38)
Location 7:141057228-141057250
Sequence GTGAGACAGCATATTTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033404314_1033404317 10 Left 1033404314 7:141057195-141057217 CCCTATCTCAAAAACCATCATAT No data
Right 1033404317 7:141057228-141057250 GTGAGACAGCATATTTATCTTGG No data
1033404315_1033404317 9 Left 1033404315 7:141057196-141057218 CCTATCTCAAAAACCATCATATA No data
Right 1033404317 7:141057228-141057250 GTGAGACAGCATATTTATCTTGG No data
1033404313_1033404317 29 Left 1033404313 7:141057176-141057198 CCTGGCTGACAGAGGGAGACCCT No data
Right 1033404317 7:141057228-141057250 GTGAGACAGCATATTTATCTTGG No data
1033404316_1033404317 -4 Left 1033404316 7:141057209-141057231 CCATCATATATATACGTATGTGA No data
Right 1033404317 7:141057228-141057250 GTGAGACAGCATATTTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033404317 Original CRISPR GTGAGACAGCATATTTATCT TGG Intergenic
No off target data available for this crispr