ID: 1033408388

View in Genome Browser
Species Human (GRCh38)
Location 7:141092877-141092899
Sequence TATGGGGCTCTCTGAGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 324}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033408380_1033408388 26 Left 1033408380 7:141092828-141092850 CCAAGAAGCTGACATTTGAGTCA 0: 1
1: 0
2: 4
3: 46
4: 532
Right 1033408388 7:141092877-141092899 TATGGGGCTCTCTGAGGAAGAGG 0: 1
1: 0
2: 1
3: 25
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033408388 Original CRISPR TATGGGGCTCTCTGAGGAAG AGG Intronic
901306566 1:8237094-8237116 TAGGGGGGTCTCTGGGGAATGGG + Intergenic
901610939 1:10497312-10497334 TGTGGGGCTTTCTGTGCAAGGGG - Intronic
901629915 1:10643010-10643032 CACGGGGGTCCCTGAGGAAGTGG + Intronic
902606773 1:17573441-17573463 TCTGGGGTTCTCTGGAGAAGAGG + Intronic
902679907 1:18036017-18036039 TCGGGGGCTATCTGAGGAGGTGG + Intergenic
903000639 1:20263070-20263092 GATGGTGCTCTGTGGGGAAGTGG - Intergenic
904381096 1:30111691-30111713 TCTGGGGCTCTGTGAGGCACTGG + Intergenic
904702086 1:32363710-32363732 GATGGAGCTCGCTGAGGGAGGGG + Exonic
906409697 1:45568686-45568708 TATGGGGCAGTCTTAGGGAGAGG + Intronic
906409861 1:45569737-45569759 TGTGGTGTTCTCTGAGGATGGGG + Intronic
906836393 1:49086853-49086875 CATGGGGCTCCCTCAGGCAGGGG - Intronic
907512596 1:54972873-54972895 AATGGGGCTCTATGGGGAGGGGG + Intergenic
908251057 1:62266210-62266232 GATGGGTCACACTGAGGAAGTGG - Intronic
909806097 1:79875637-79875659 GATGGTGCTCCCAGAGGAAGAGG + Intergenic
910036516 1:82795692-82795714 TATGAGTCACCCTGAGGAAGAGG - Intergenic
910155306 1:84211010-84211032 TATGAGAATCTCTGGGGAAGAGG + Intronic
910868279 1:91807685-91807707 TCTGCAGCCCTCTGAGGAAGTGG + Intronic
914981777 1:152421202-152421224 TATGGGACTCTCTGAGGCGGTGG + Intergenic
915254836 1:154619333-154619355 TCTGGGGCTGTCTGAGAAAAGGG + Intronic
915741104 1:158118981-158119003 GATGGGGCTCTATGGGGGAGTGG + Intergenic
915940811 1:160117157-160117179 TATGGGCTTCACGGAGGAAGAGG + Intronic
917714708 1:177722349-177722371 GATGGAGCTCTCAGAGGAAGAGG + Intergenic
917997944 1:180460552-180460574 GATGGAGCTCCCAGAGGAAGGGG + Intronic
918959527 1:191255517-191255539 TGTGCTGCTCTCAGAGGAAGTGG + Intergenic
919748977 1:201024796-201024818 GATGGGGATCTCTGGGGGAGGGG + Intergenic
919778665 1:201209387-201209409 TTTGGGGGTTTCTGAGGGAGGGG + Exonic
921380842 1:214523222-214523244 TATGGGGATATGTGGGGAAGTGG - Intronic
922773255 1:228201226-228201248 GATGGGACTCTGTAAGGAAGTGG - Intergenic
1063171549 10:3514267-3514289 TATGAGGCTCTTTCAGGGAGAGG + Intergenic
1065707905 10:28488192-28488214 TATGGGCCAATGTGAGGAAGGGG - Intergenic
1067071452 10:43135623-43135645 TATGGGGCTCATGGAGGAATAGG + Intergenic
1067169861 10:43897797-43897819 TGTGGGGCTCTTTGAGCAATGGG - Intergenic
1068543826 10:58325407-58325429 GATGGGCCACTCTGAGGCAGAGG - Intergenic
1069825680 10:71253737-71253759 TATGGGGATCTCTGGGGAGGAGG - Intronic
1070052188 10:72900149-72900171 TATGAGGCTCTCTCAAGAAGAGG + Intronic
1070054664 10:72923602-72923624 GATGGAGCTCCCAGAGGAAGGGG - Intronic
1070338002 10:75471994-75472016 TTTGGCTCTCCCTGAGGAAGAGG - Intronic
1071371288 10:84954133-84954155 TGTGGAGCTCTATCAGGAAGGGG - Intergenic
1073154100 10:101332909-101332931 TTTGGGACCCCCTGAGGAAGAGG - Intergenic
1074455250 10:113590512-113590534 TATGGCCATCTCTTAGGAAGAGG + Intronic
1074777866 10:116779425-116779447 TGTGGTTCTCTCTGAGGGAGGGG - Intergenic
1075975108 10:126687832-126687854 GCTGGGGTCCTCTGAGGAAGGGG + Intergenic
1076061516 10:127417382-127417404 TGTGGGGCCCTCAGAGAAAGAGG + Intronic
1077440566 11:2566905-2566927 GATGGGGCTCTCAGAGGGATTGG + Intronic
1078887818 11:15522907-15522929 TAGGAGGCTCTCTGAGAAAGGGG - Intergenic
1082912596 11:58393684-58393706 CATGGAGCTCTCTGGGGAATAGG + Intergenic
1083246978 11:61436295-61436317 TTTGGGGCTCTCTGGGGGACTGG - Intronic
1083302255 11:61745353-61745375 GGTGGGGCCCTCAGAGGAAGGGG - Exonic
1084429819 11:69104955-69104977 TGCAGGGCTCTCTGAGTAAGCGG + Intergenic
1086426420 11:86688350-86688372 TTCGGGGCCCTCTGAGGAGGAGG - Intergenic
1087374758 11:97326820-97326842 GATGGAGCTCCCAGAGGAAGGGG - Intergenic
1087439242 11:98161647-98161669 GAGGTGGCTCTCAGAGGAAGGGG - Intergenic
1088113929 11:106295312-106295334 TACTCAGCTCTCTGAGGAAGGGG + Intergenic
1090207726 11:124895215-124895237 TATGAGGGGCTCTGAGGGAGAGG + Intronic
1090407685 11:126486965-126486987 TATGAGGCTCGTTGAGGAGGTGG - Intronic
1090969224 11:131625304-131625326 TATGGACCCCTCTGAGCAAGGGG + Intronic
1092148204 12:6229249-6229271 TAGGGGGCTGGCCGAGGAAGGGG - Intronic
1092524642 12:9302279-9302301 GATGTGACTCTCTGAGGTAGTGG + Intergenic
1092542623 12:9429533-9429555 GATGTGACTCTCTGAGGTAGTGG - Intergenic
1092839573 12:12526928-12526950 GATGGGGCTCCAGGAGGAAGCGG + Intronic
1093044364 12:14425391-14425413 TCTGGTCCTCTCTGATGAAGAGG + Exonic
1094350160 12:29515450-29515472 GAGGGGCCTCTCTGAGGAATGGG - Intronic
1094798146 12:34000421-34000443 AATGGGGATCTCTGAGGAATTGG - Intergenic
1095110912 12:38294509-38294531 AATGGGGATCTCTGAGGAATTGG - Intergenic
1096023852 12:48344500-48344522 TCTGGAACTCTCTGAGGCAGAGG + Intronic
1096579773 12:52577404-52577426 GGTTGGGCTCTCTGAGGTAGGGG + Intergenic
1096670188 12:53193850-53193872 GATGGGGCTCTGGGAGGCAGTGG + Exonic
1097178537 12:57157666-57157688 CAAGGGCCTCTCTGAGGATGTGG + Intronic
1097890617 12:64773613-64773635 GATGGAGCTCTCAGAGGAAGGGG + Intergenic
1099016462 12:77349172-77349194 TATGGGCCTCTTTGGGGATGGGG + Intergenic
1099947323 12:89259321-89259343 TGTGGGGCTCTTGGAGAAAGTGG - Intergenic
1102452214 12:113050285-113050307 TAAGGGGAGATCTGAGGAAGAGG - Intergenic
1102543058 12:113636260-113636282 AATGGGGCCCTCTGAGGATAGGG - Intergenic
1105990404 13:25615058-25615080 TATGGGGGTTTCTCAGGCAGTGG + Intronic
1106439412 13:29752299-29752321 GGTGGGGCTGTCAGAGGAAGTGG - Intergenic
1107171778 13:37350850-37350872 TATGTTGCTCCCTGAGGAACTGG - Intergenic
1107936570 13:45350448-45350470 TCGGCAGCTCTCTGAGGAAGAGG - Intergenic
1110819380 13:79896851-79896873 TGTGGGGCCTTCTAAGGAAGAGG + Intergenic
1113540196 13:111101127-111101149 CATGGGGCTCCCTCAGGCAGGGG - Intergenic
1114988624 14:28261737-28261759 GATGGAGCTCTCTGTGGAAGGGG + Intergenic
1117080769 14:52150212-52150234 CATGGGGCTCCCTCAGGCAGGGG + Intergenic
1117503075 14:56373944-56373966 GATGGAGCTCTCTGGGGGAGGGG - Intergenic
1118057328 14:62093476-62093498 TATGAGGCAGTGTGAGGAAGAGG - Intronic
1119116586 14:72027497-72027519 TATGGGACTCCCAGTGGAAGAGG - Intronic
1119989795 14:79183445-79183467 TATGGGGTTCTCAGAGGACTTGG - Intronic
1120493389 14:85204599-85204621 AAAGTGGCTCTCAGAGGAAGGGG - Intergenic
1122141457 14:99665378-99665400 TATGGGGCTGTCTCTGGAATGGG + Intronic
1125415237 15:39445282-39445304 CCTGGGGCTCTCTGAGGGATGGG + Intergenic
1126902969 15:53332948-53332970 AATGGGGCTCTGGGAGGAGGAGG + Intergenic
1127229407 15:56971939-56971961 TATGGGGTTTTTGGAGGAAGGGG + Intronic
1127726215 15:61752740-61752762 CATGGTGACCTCTGAGGAAGAGG + Intergenic
1128253544 15:66180419-66180441 TATGGGGCTGGCTCAGGATGGGG - Intronic
1129675299 15:77630078-77630100 TGTGTGGCACTCTGTGGAAGTGG - Intronic
1129746285 15:78023712-78023734 TATGGGGTTAGCTGGGGAAGCGG - Intronic
1129897168 15:79117083-79117105 GCTGGGACTCCCTGAGGAAGGGG + Intergenic
1129971478 15:79781124-79781146 GATGGAGCTCCCAGAGGAAGGGG + Intergenic
1130270084 15:82441647-82441669 GATGGGGCTCTCCAAGCAAGAGG - Intergenic
1130462424 15:84168968-84168990 GATGGGGCTCTCCAAGCAAGAGG - Intergenic
1130474045 15:84247890-84247912 GATGGGGCTCTCCAAGCAAGAGG - Intergenic
1130481460 15:84361958-84361980 GATGGGGCTCTCCAAGCAAGAGG - Intergenic
1130490252 15:84425825-84425847 GATGGGGCTCTCCAAGCAAGAGG + Intergenic
1130501840 15:84504575-84504597 GATGGGGCTCTCCAAGCAAGAGG + Intergenic
1131597637 15:93813957-93813979 CATGTGGCTCTCTCAGGCAGGGG - Intergenic
1133357428 16:5146986-5147008 AAAGGGGCTCTCTGAGCATGGGG - Intergenic
1134744009 16:16573369-16573391 TATGGAGCCCTCTGAGGATTCGG - Intergenic
1135001471 16:18780383-18780405 TATGGAGCCCTCTGAGGATTCGG + Intergenic
1135159773 16:20083355-20083377 CATGGAGCTCACAGAGGAAGAGG - Intergenic
1136984026 16:35083384-35083406 TATAGGGCTCTGTCAGGAAGTGG - Intergenic
1137391438 16:48084642-48084664 TATGGGGCTTTCCAAGGAGGAGG - Intronic
1137469125 16:48738876-48738898 AATGGATCTCTCAGAGGAAGAGG + Intergenic
1140583944 16:76265511-76265533 TATAGGGCTTCCTGAGGAACTGG + Intergenic
1141743687 16:85911760-85911782 CCTCGGGCTCGCTGAGGAAGTGG + Intronic
1141882401 16:86868595-86868617 TATTGGGCTCTCTACTGAAGCGG + Intergenic
1143580776 17:7824397-7824419 TCTGGGGCCCTCTGTAGAAGTGG - Intronic
1143769322 17:9157940-9157962 AAGGTGTCTCTCTGAGGAAGGGG + Intronic
1144717623 17:17445429-17445451 CATGGGGCTGTCTGTGGGAGGGG - Intergenic
1144725600 17:17500494-17500516 AGTGGGCCTCTCTGAGGAGGTGG - Intergenic
1144959124 17:19034938-19034960 GAAAGGGCTCTCTGAGGAGGTGG - Intronic
1144976035 17:19139586-19139608 GAAAGGGCTCTCTGAGGAGGTGG + Intronic
1146392860 17:32438860-32438882 AACTGGGCTCCCTGAGGAAGGGG + Intergenic
1147137421 17:38442297-38442319 TCTGGTTCCCTCTGAGGAAGGGG + Intronic
1149078810 17:52629838-52629860 TATGGGACTCCCTCAGGCAGAGG - Intergenic
1151010961 17:70495276-70495298 CATGAGGTTCTCTGAGGAACAGG + Intergenic
1152715713 17:81899608-81899630 CAGGGGCCTCTCTGAGGAGGTGG - Intronic
1153216443 18:2825240-2825262 TATTGCCCTCTCTGGGGAAGGGG - Intergenic
1153404285 18:4718664-4718686 CATAGGGCTCCCTTAGGAAGAGG + Intergenic
1153531567 18:6051720-6051742 TGTGGGACTGTCTGAGGAGGTGG + Intronic
1153753470 18:8257244-8257266 AATGGGGTTCTCTGAGGAAATGG + Intronic
1154181934 18:12145680-12145702 GATGGGGCTCCCAGAGGGAGAGG + Intergenic
1155100041 18:22601835-22601857 TATCAGAATCTCTGAGGAAGGGG - Intergenic
1157200481 18:45655056-45655078 TATTGGTGTTTCTGAGGAAGGGG - Intronic
1158763660 18:60421781-60421803 AATGGGGGTCCCTGAGGAAGCGG + Intergenic
1160837471 19:1131642-1131664 TATGGGGCTCTTGTAGGGAGCGG - Intronic
1161547727 19:4891981-4892003 TTGGGGGCTCTCCTAGGAAGAGG + Intronic
1161704467 19:5812635-5812657 CCTGGGGCCCTCTGAGGGAGGGG + Intergenic
1161825336 19:6560196-6560218 TTTGGGGCTGCCTGATGAAGTGG + Intergenic
1162562516 19:11425883-11425905 TAGGGGGGTCACTGAGTAAGGGG + Intronic
1163672627 19:18637520-18637542 TCTTGGGGGCTCTGAGGAAGGGG + Intronic
1163746598 19:19052431-19052453 TCTGGAGCTGTCTGGGGAAGGGG + Intronic
1164753528 19:30673018-30673040 TATGGGGCTTTCTGGCCAAGGGG - Intronic
1165311659 19:35032179-35032201 CAAGGGACTTTCTGAGGAAGGGG + Intronic
1165467453 19:35983490-35983512 TGGGGGGCTGTCAGAGGAAGAGG - Intergenic
1165826038 19:38706290-38706312 CCTGGTCCTCTCTGAGGAAGAGG + Intronic
1166106848 19:40601761-40601783 TCAGGGGCTATTTGAGGAAGGGG + Intronic
1167324622 19:48816451-48816473 CATGTGGCTCTCTTAGGAAAAGG - Intronic
1167342330 19:48923076-48923098 TCTGGGGCTGTGTGGGGAAGGGG - Exonic
926110557 2:10180509-10180531 CGTGGGCCTCTCTGAGGCAGTGG - Intronic
926168305 2:10535196-10535218 TTTGGGGCTGTCTGAGAAACGGG - Intergenic
927123680 2:19993332-19993354 TATTGTGCTCTCTGAAGAACAGG - Intronic
927812580 2:26188092-26188114 CATCGGGCTCTCAGAGGATGTGG + Exonic
929065770 2:37973697-37973719 TATGTGGCTGTCTAAGGAAACGG + Intronic
929574478 2:43043262-43043284 CTGGGGGCTCCCTGAGGAAGGGG - Intergenic
929611078 2:43271019-43271041 GACGGGGCTCTGGGAGGAAGGGG + Intronic
929654240 2:43714775-43714797 TATGAGGCTCTCTGAGGAATGGG - Intronic
930586060 2:53268118-53268140 GATGGAGCTCTCAGAGGAAGGGG + Intergenic
931234964 2:60405577-60405599 TTTGGGGCACACTTAGGAAGAGG - Intergenic
931514385 2:63036778-63036800 TATTGGCCTTTGTGAGGAAGTGG + Intronic
932523570 2:72440041-72440063 TACAGAGCTCTCAGAGGAAGGGG - Intronic
932606178 2:73167119-73167141 CATGCGGCTTTCTTAGGAAGAGG + Intergenic
933926250 2:87093332-87093354 CATGCGGCTTTCTTAGGAAGAGG - Intergenic
935569287 2:104642087-104642109 TATGGGGCTGTTGGAGGGAGAGG + Intergenic
937868958 2:126774061-126774083 TTTGGAGCTCCTTGAGGAAGGGG - Intergenic
939147349 2:138431831-138431853 TGTGAGGCTCTCCTAGGAAGTGG - Intergenic
940124680 2:150310303-150310325 AATGGAGCTTTCAGAGGAAGGGG + Intergenic
941365844 2:164610243-164610265 TATGAGTCTCTCAGAGCAAGAGG - Intronic
943086345 2:183316483-183316505 TATTCGGCTCTCTGAGAGAGAGG + Intergenic
943286207 2:186004601-186004623 TATGGGTCCCACTGAGGAACAGG + Intergenic
943798612 2:192029619-192029641 GATGGGGTTCTGTGAGAAAGTGG - Intronic
944323355 2:198375389-198375411 TGAGGGGCTCTCTGATCAAGAGG - Intronic
944828700 2:203510998-203511020 CATGGGCTTCTCAGAGGAAGTGG - Intronic
945909701 2:215634956-215634978 CATGGGGCTCCCTCAGGCAGGGG + Intergenic
945990874 2:216394312-216394334 TTTGGGGGTCTCTGAGGACTGGG + Intergenic
947211123 2:227709656-227709678 TGTGGGGCTCCCTGAGGTAGGGG + Intronic
948707597 2:239804740-239804762 TCTGAGGCTCTCTGAGTGAGGGG + Intergenic
948716040 2:239864502-239864524 TAGGGGGAGCTCAGAGGAAGAGG + Intergenic
1173247592 20:41347350-41347372 TGAAGGCCTCTCTGAGGAAGGGG + Intronic
1173458409 20:43222337-43222359 TATGGTGACCTCTGAGGAGGGGG + Intergenic
1174180136 20:48669263-48669285 GATGGGACTCTCTGAGGAGGTGG - Intronic
1174202179 20:48814407-48814429 TAGAAGGCTCTCTGAGGAAGCGG + Intronic
1174203429 20:48823129-48823151 GATGGGAGTCTCTGAGGAACAGG - Intronic
1174885444 20:54329033-54329055 TATGGGGCCCTCTGAGAATGGGG - Intergenic
1175433092 20:58920994-58921016 TATGGGGCTTGGTGAGGTAGAGG + Intergenic
1175634086 20:60566217-60566239 GAAAGGGCCCTCTGAGGAAGAGG + Intergenic
1176937450 21:14883429-14883451 TGAGGGGGTCTTTGAGGAAGAGG - Intergenic
1177273551 21:18877822-18877844 GATGGGGCTCCCAGGGGAAGGGG - Intergenic
1178915469 21:36703466-36703488 TATGGGGAGCTCACAGGAAGGGG - Intronic
1179188765 21:39106225-39106247 TATGGTGGTCTGGGAGGAAGTGG + Intergenic
1179626405 21:42652001-42652023 TCTGGGGCTCTTGGAGGAAATGG + Intergenic
1180075174 21:45458339-45458361 GCTGGAGCTCTCTGAGGCAGGGG + Intronic
1180075186 21:45458392-45458414 GCTGGAGCTCTCTGAGGCAGGGG + Intronic
1180651652 22:17382196-17382218 TATTAGTCTCTATGAGGAAGGGG - Intronic
1180981517 22:19880211-19880233 TGTGGGGCTGTCCGAGGAGGAGG - Exonic
1181127733 22:20711626-20711648 ACAGGGGCTCTCTGTGGAAGTGG + Intronic
1183260871 22:36795054-36795076 TTTGGGGCCCTCTGCGAAAGGGG + Intergenic
1184709414 22:46239709-46239731 GTAGGGTCTCTCTGAGGAAGTGG - Exonic
949194643 3:1290174-1290196 AATGGGCCTCTCTGAAGCAGAGG - Intronic
950053039 3:10006527-10006549 AATTGGTCTCTCTGAGGTAGTGG - Intronic
950488261 3:13285482-13285504 GCTGAGGCTCTTTGAGGAAGAGG - Intergenic
951233049 3:20201716-20201738 TATGGGGCAATCTCAGTAAGAGG - Intergenic
951700976 3:25496550-25496572 TATTGGGCTCCCTGAGGCTGGGG + Intronic
954951862 3:54481753-54481775 TGTGGAGCTTTCTGAGGAGGGGG + Intronic
957061998 3:75489815-75489837 AAAGGGGCTCTCTGAGCATGGGG - Intergenic
958010363 3:87870616-87870638 CATGGGGCTGCCTGAGGAATTGG + Intergenic
958762923 3:98329491-98329513 CATGGGGCTCCCTTAGGGAGAGG - Intergenic
958897875 3:99849779-99849801 TAAGGAGCTCTCTCAAGAAGTGG - Exonic
961291405 3:125849586-125849608 AAAGGGGCTCTCTGAGCATGGGG + Intergenic
961380996 3:126496467-126496489 GCGGGGGCTTTCTGAGGAAGTGG + Intronic
961646333 3:128394719-128394741 TGGGGGGCTGTCTGAGGAGGAGG + Intronic
962928304 3:140015070-140015092 TATGGGACTCACGGAGCAAGGGG - Intronic
964883042 3:161445726-161445748 TATCAGGCTCCCTGTGGAAGAGG + Intergenic
965714441 3:171587498-171587520 GGAGGGTCTCTCTGAGGAAGAGG - Intergenic
965811225 3:172593103-172593125 GAGGGAGCTCTCAGAGGAAGGGG - Intergenic
965825221 3:172723002-172723024 CCTGGGGCTCTCTGAGGGTGAGG - Intergenic
966429631 3:179817840-179817862 TATGGGGTTCTGGGAGTAAGGGG + Intronic
967135151 3:186506906-186506928 TATGGGGCTCTCAGAACAACAGG + Intergenic
967980278 3:195061299-195061321 TCTGGGGCTCTCTGTGGGACTGG + Intergenic
967980443 3:195062106-195062128 TCTGGGGCTCTCTGTGGGATCGG + Intergenic
968922001 4:3527202-3527224 GATGGGGCTGGCTGGGGAAGAGG - Intronic
969147096 4:5133417-5133439 TAGGGAGCTCTCTGAGGGAGTGG - Intronic
969245125 4:5926968-5926990 TATGGTGCTTACTGTGGAAGGGG + Intronic
969659452 4:8517987-8518009 TTGGGGGCTCTCTGAGTGAGGGG - Intergenic
970708054 4:18829214-18829236 TGTGGACCACTCTGAGGAAGAGG + Intergenic
970814735 4:20141245-20141267 AACTGGGCTCTCTGAAGAAGAGG + Intergenic
972247114 4:37256905-37256927 TTTGGGGCTCTCTTATTAAGAGG + Intronic
972408220 4:38766404-38766426 TATGGGGCTCTCTCAGAGACTGG - Intergenic
972883580 4:43456743-43456765 TGTCTGGCTTTCTGAGGAAGTGG + Intergenic
972941233 4:44197318-44197340 TGTGGGGCTCCCTCAGGCAGGGG - Intronic
975026178 4:69550975-69550997 CATGGGGCTTTCTCAGGCAGGGG - Intergenic
978679203 4:111357949-111357971 TATGGGGCACTCTTACAAAGAGG + Intergenic
981240968 4:142475106-142475128 AATGGGGCTCTCTCAGGCAAGGG - Intronic
981546155 4:145895848-145895870 TATGGTTCATTCTGAGGAAGTGG - Intronic
981852574 4:149248480-149248502 TATGGAGCTCTCTGATGTTGGGG + Intergenic
982091643 4:151884728-151884750 TAGGGGGCACTTGGAGGAAGAGG + Intergenic
982325567 4:154125578-154125600 TATGGGACTCTCTTTGGAGGAGG - Intergenic
983975210 4:173925624-173925646 TATGGGGCTGTCAGAAGAAAAGG - Intergenic
988922405 5:35955621-35955643 TATGTGGCTCTCTAAGCATGTGG - Intronic
989859185 5:46344311-46344333 TTTGGAGCGCTTTGAGGAAGTGG - Intergenic
993226134 5:85168706-85168728 GATGGTGCTCCCAGAGGAAGGGG - Intergenic
994112849 5:96026400-96026422 TTGGGGACTCTCTGAAGAAGAGG - Intergenic
995123948 5:108561686-108561708 TCTGGGGCTCTCTGAGCATAAGG - Intergenic
997386370 5:133475967-133475989 TGTGGGGCTCTCTGAGAAGGTGG + Intronic
997470250 5:134113489-134113511 TGTGGGGCCCTCAGAGGGAGAGG + Intergenic
998967853 5:147560001-147560023 TACTGTGCTCTCTGAGGATGTGG + Intergenic
999186592 5:149715241-149715263 GAAGGGCCTCTCTGAGGAGGTGG + Intergenic
1000009344 5:157217064-157217086 TCTGGGGCTCTCTGTGGTACGGG - Intronic
1000297940 5:159928529-159928551 AATGGGGCTCTAGGAGGAATGGG - Intronic
1000325030 5:160165524-160165546 CATGGGGCTCCCTGAGGCACCGG + Intergenic
1000492824 5:161936159-161936181 TATGGGAAACTCTGAGGAAGGGG - Intergenic
1000626537 5:163545685-163545707 CATGAGGAACTCTGAGGAAGAGG - Intergenic
1001101147 5:168815342-168815364 GAAGGTGCTCTCTGATGAAGTGG + Intronic
1002091034 5:176806504-176806526 TATGGAGCCCTCTCAGGATGTGG - Intergenic
1004793187 6:19051382-19051404 TGTGGGGCTCTCTCAGGCAGAGG - Intergenic
1006884749 6:37371834-37371856 TAAGAGGCTCTCTGGGGAAGTGG + Intronic
1006919754 6:37619590-37619612 ACTGGGGCTCCCTGAGGATGGGG - Intergenic
1006924008 6:37644283-37644305 ACTGGGGCTCCCTGAGGATGGGG + Intronic
1007073855 6:39054495-39054517 ACTGGGGCTCCCTGAGGACGGGG - Intronic
1007088609 6:39167935-39167957 ACTGGGGCTCCCTGAGGACGGGG - Intergenic
1007105549 6:39280882-39280904 ACTGGGGCTCCCTGAGGACGGGG + Intergenic
1007105571 6:39280960-39280982 ACTGGGGCTCCCTGAGGACGGGG + Intergenic
1007105603 6:39281077-39281099 ACTGGGGCTCCCTGAGGACGGGG + Intergenic
1007164003 6:39815398-39815420 TATGGGTGTCCCTGAGCAAGTGG + Intronic
1007210784 6:40192039-40192061 ACTGGGGCTCCCTGAGGATGGGG - Intergenic
1007210823 6:40192194-40192216 ACTGGGGCTCCCTGAGGATGGGG - Intergenic
1007215611 6:40235069-40235091 AATGGGGCTCCCAGAGGGAGGGG + Intergenic
1007223068 6:40294176-40294198 ACTGGGGCTCCCTGAGTAAGGGG - Intergenic
1007243319 6:40442541-40442563 GCTGGGGCTCCCTGAGGACGGGG + Intronic
1007243331 6:40442580-40442602 ACTGGGGCTCTCTGAGGACAGGG + Intronic
1007244021 6:40447032-40447054 ACTGGGGCTCCCTGAGGATGGGG + Intronic
1007256977 6:40536295-40536317 ACTGGGGCTCCCTGAGGACGGGG - Intronic
1007273035 6:40652853-40652875 ACTGGGGCTCCCTGAGGATGGGG - Intergenic
1007276132 6:40675417-40675439 AATGGGGCTCTCTGAGGGCAGGG - Intergenic
1007276769 6:40679809-40679831 GCTGGGGCTCCCTGAGGACGGGG - Intergenic
1007276928 6:40680739-40680761 ACTGGGGCTCCCTGAGGAAAAGG - Intergenic
1007284508 6:40738016-40738038 ACTGGGGCTCCCTGAGGATGGGG + Intergenic
1007286512 6:40751793-40751815 ACTGGGGCTCCCTGAGGACGGGG + Intergenic
1007424983 6:41740864-41740886 ACTGGGGCTCCCTGAGGATGGGG + Intronic
1007427735 6:41758006-41758028 ACTGGGGCTCCCTGAGGATGGGG + Intergenic
1007707111 6:43797876-43797898 AGTGGGGCTCCCTGAGGATGGGG - Intergenic
1007707132 6:43797952-43797974 ACTGGGGCTCCCTGAGGATGGGG - Intergenic
1007707154 6:43798029-43798051 ACTGGGGCTCCCTGAGGATGGGG - Intergenic
1007707193 6:43798182-43798204 ACTGGGGCTCCCTGAGGATGGGG - Intergenic
1007729597 6:43937902-43937924 GCTGGGGCTCCCTGAGGATGGGG + Intergenic
1007729632 6:43938018-43938040 ATTGGGGCTCCCTGAGGATGGGG + Intergenic
1007736680 6:43986408-43986430 ACTGGGGCTCCCTGAGGATGGGG + Intergenic
1007736921 6:43987621-43987643 ACTGGGGCTCCCTGAGGATGGGG - Intergenic
1007740011 6:44004471-44004493 ACTGGGGCTCCCTGAGGATGGGG + Exonic
1007740046 6:44004587-44004609 ACTGGGGCTCCCTGAGGACGGGG + Exonic
1007747256 6:44050901-44050923 ACTGGGGCTCCCTGAGGACGGGG + Intergenic
1007750158 6:44066523-44066545 ACTGGGGCTCCCTGAGGATGGGG + Intergenic
1009312317 6:62170326-62170348 CATGGGGCTTTCTCAGGTAGCGG - Intronic
1011462575 6:87620172-87620194 TAAGGGGCTTGCTGCGGAAGAGG - Intronic
1013497280 6:110710619-110710641 GATGGCAGTCTCTGAGGAAGTGG - Intronic
1014017595 6:116551080-116551102 TATTGGGCACTCTGTGGAAAAGG - Intronic
1015869754 6:137764134-137764156 TGTGGGGCTCTCCAAGAAAGTGG + Intergenic
1017966976 6:159275458-159275480 TGTGGGGCGGTCTCAGGAAGTGG + Intergenic
1018210863 6:161480307-161480329 TATGGGGCCCTGTGAGTATGGGG + Intronic
1018210868 6:161480323-161480345 TATGGGGCCCTGTGAGTATGGGG + Intronic
1018222434 6:161594293-161594315 GATGGGGATCTGGGAGGAAGAGG - Intronic
1018251699 6:161877923-161877945 TATGGCGCTCAATGAGGGAGTGG + Intronic
1021220093 7:17965602-17965624 TAAGGGGCTTTCTGAGGAAAAGG - Intergenic
1021822330 7:24510542-24510564 AGTGGGGTTCCCTGAGGAAGAGG + Intergenic
1022550853 7:31237657-31237679 TATGGGCCTGTCTGAGGGTGTGG - Intergenic
1023075891 7:36482680-36482702 CATGGGGCTCCCTCAGGCAGGGG + Intergenic
1023083770 7:36549881-36549903 AATGGGGCTCTCCAAGGAGGTGG - Intronic
1023643272 7:42282944-42282966 TATGAGGCTCTCTGAGCAGCTGG + Intergenic
1024095140 7:45976934-45976956 TGTGGGGCTCCTTGAGGATGGGG + Intergenic
1028143052 7:87292283-87292305 TATGGGGCTCCATCAGGCAGGGG - Intergenic
1028220203 7:88188296-88188318 TATGTGGCTCTCAGAGAAAGAGG + Intronic
1028455146 7:91030522-91030544 TATGGGGCTCTTGGAAGAGGTGG - Intronic
1028961449 7:96753820-96753842 TATGGGGATCTCTGTGGGAGGGG + Intergenic
1029359944 7:100081454-100081476 TAGGGGGATCCCTGGGGAAGCGG + Intronic
1030190458 7:106805498-106805520 AATGGGGCTAGCAGAGGAAGTGG + Intergenic
1033314140 7:140283738-140283760 CATGGGGGTATCTGGGGAAGAGG - Intergenic
1033408388 7:141092877-141092899 TATGGGGCTCTCTGAGGAAGAGG + Intronic
1033488577 7:141817114-141817136 TGAGGGGTTCTCTGAGGAAAAGG + Intergenic
1037963659 8:23117487-23117509 TAGGGGACACCCTGAGGAAGGGG - Intergenic
1037967394 8:23145235-23145257 TAGGGGACACCCTGAGGAAGGGG + Intronic
1038511186 8:28137314-28137336 GAGGGGCCTCTCTGAAGAAGTGG + Intronic
1040584638 8:48727455-48727477 GACAGGGCTCTGTGAGGAAGTGG + Intronic
1041826706 8:62102760-62102782 CATGGGGCTCTCTCAAGCAGAGG - Intergenic
1043881089 8:85543798-85543820 CATGGAGCTCTCTGAGAAAAAGG + Intergenic
1047417134 8:124673951-124673973 TCTCCTGCTCTCTGAGGAAGAGG - Intronic
1047809186 8:128389813-128389835 TCTGAGGCTCACTGAGTAAGTGG + Intergenic
1048424086 8:134306430-134306452 TATGGGTCTAACTCAGGAAGGGG + Intergenic
1049513135 8:143039720-143039742 TCTGGGGTGCTCAGAGGAAGGGG + Intronic
1052250673 9:26393925-26393947 TGTGGGGCTCCCTCAGGAGGAGG + Intergenic
1052916249 9:33926214-33926236 TATATGGTACTCTGAGGAAGAGG + Intronic
1053419449 9:37967983-37968005 TATGGGGTTTCCTGAAGAAGTGG + Intronic
1053479382 9:38404728-38404750 CATGGGGCTCTCAGAGCAACAGG + Intergenic
1056161372 9:83898478-83898500 AGAGTGGCTCTCTGAGGAAGAGG + Intronic
1056299317 9:85225653-85225675 TATGAGGCCCTCTGAAGATGAGG + Intergenic
1057035896 9:91811408-91811430 GGAGGGTCTCTCTGAGGAAGGGG + Intronic
1057636697 9:96776077-96776099 TCTGGTGCTCTCTGGGCAAGGGG + Exonic
1059343507 9:113612932-113612954 GAAGGGGCTTTGTGAGGAAGAGG + Intergenic
1061579554 9:131528731-131528753 TATGGGGCTTTTTTAGGCAGAGG + Intronic
1062308961 9:135925617-135925639 CTTGGGGCTCGCTGAGGGAGGGG - Intergenic
1062681621 9:137785078-137785100 TAGGTGGGGCTCTGAGGAAGAGG + Intronic
1187227555 X:17388408-17388430 GGTGGGCCTCACTGAGGAAGTGG + Intronic
1188247658 X:27854509-27854531 GATGGGGCTCTCTGAGGGCCCGG - Intergenic
1188723456 X:33551557-33551579 GATGGAGCTCCCAGAGGAAGGGG - Intergenic
1190600549 X:52088518-52088540 GATGGAGCTCCCAGAGGAAGGGG - Intergenic
1191224850 X:58032046-58032068 AATGGAGCTCTCACAGGAAGAGG - Intergenic
1192638510 X:72843087-72843109 GATTGGGCTTCCTGAGGAAGTGG + Intronic
1192643204 X:72877721-72877743 GATTGGGCTTCCTGAGGAAGTGG - Intronic
1193274433 X:79569855-79569877 AATGGAGCTCACAGAGGAAGGGG - Intergenic
1195148604 X:102043360-102043382 GATGGAGCTCCCAGAGGAAGGGG + Intergenic
1196023604 X:111016287-111016309 CATGGGGCCTTCTCAGGAAGAGG + Intronic
1197271268 X:124427056-124427078 GCTGGGGCTGGCTGAGGAAGAGG + Intronic
1200874930 Y:8144138-8144160 TATGGGGCACTTACAGGAAGTGG + Intergenic
1202367976 Y:24179746-24179768 GATGGGGCTCTCCAAGCAAGAGG - Intergenic
1202502807 Y:25490371-25490393 GATGGGGCTCTCCAAGCAAGAGG + Intergenic