ID: 1033410305

View in Genome Browser
Species Human (GRCh38)
Location 7:141111422-141111444
Sequence GTGCCTGTATTTGCTGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033410305_1033410309 12 Left 1033410305 7:141111422-141111444 CCTGAGCCAGCAAATACAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 220
Right 1033410309 7:141111457-141111479 TGTCTACAACCTGAAGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033410305 Original CRISPR GTGCCTGTATTTGCTGGCTC AGG (reversed) Intronic
903009030 1:20317520-20317542 GTGCCTGTCTTTGCTGGAAAAGG - Exonic
905431838 1:37930408-37930430 GTGCCTGCATGGCCTGGCTCTGG + Intronic
905621466 1:39451825-39451847 GTGGCTGTAAATGCTAGCTCAGG - Intronic
907210940 1:52820972-52820994 GTGCCTGTATTTCCAGGCTGAGG + Intronic
907963193 1:59302542-59302564 GTTTCTGTGTTAGCTGGCTCAGG - Intronic
908492145 1:64656051-64656073 GTGCCTGTATCAGTTGGATCAGG + Intronic
909097405 1:71305022-71305044 GTGATTGTATCTGCTGGCTTAGG + Intergenic
909131141 1:71738661-71738683 CTGCCTGTGTGTCCTGGCTCTGG + Intronic
912401054 1:109393149-109393171 GTGTGTTTGTTTGCTGGCTCTGG - Intronic
916444367 1:164858438-164858460 GTGTGTGTGTGTGCTGGCTCTGG - Intronic
917533381 1:175856528-175856550 GGGGCTGTGTGTGCTGGCTCAGG - Intergenic
918635589 1:186770648-186770670 ATGTCTGTTTTTGCTTGCTCAGG + Intergenic
919576714 1:199319156-199319178 GTTCCTGTATTAGCTTGCTAAGG + Intergenic
921298087 1:213723287-213723309 GTGACTGTATTTGTTTGCTAGGG + Intergenic
921301343 1:213754090-213754112 GTGGCTGTATTTGTCAGCTCAGG + Intergenic
921583282 1:216920448-216920470 GTGCCTGCATTTGCTGGCCATGG + Intronic
921774150 1:219078057-219078079 GTTCCTGTATTTGTTTGCTGAGG - Intergenic
922081179 1:222298478-222298500 GTTCCTGCATTTGCTTGCTGAGG - Intergenic
922924867 1:229340400-229340422 GTGCCTGTATTTACCAGCTCAGG - Intronic
923330683 1:232921461-232921483 GTGCCTGTTTTTGCTATCTTGGG + Intergenic
1064004619 10:11690123-11690145 GGGCCTGTATCTTCTGGCTCTGG - Intergenic
1064427491 10:15243153-15243175 GTGCCTGTATTCCTTGGCTTGGG + Intronic
1064872289 10:19951874-19951896 GTTCCTGTATTCACTGGCTTAGG - Intronic
1067286435 10:44911037-44911059 GGGCCTGTAGTGTCTGGCTCTGG - Intergenic
1068252550 10:54462638-54462660 GTGCCTGTATTTCCAGACTGGGG - Intronic
1068827028 10:61452298-61452320 GTGTCTGGGTTTGCTGGCTTTGG - Intronic
1070016869 10:72542505-72542527 GTTCCTGCACTTGCTTGCTCTGG - Intronic
1070633709 10:78106961-78106983 GGCCCTGTCTTTGCTGTCTCTGG - Intergenic
1071500607 10:86201407-86201429 GTTCCTGTGTTAGTTGGCTCAGG - Intronic
1075024705 10:118975987-118976009 GTGCTTGCCTTTGCTGGCTCTGG - Intergenic
1077601614 11:3578655-3578677 GTGCCTGTATCTGCTCAGTCTGG - Intergenic
1079726061 11:23882750-23882772 GTTCCTGGTCTTGCTGGCTCAGG + Intergenic
1080279079 11:30535773-30535795 GTGCCTGGCCTTGGTGGCTCTGG - Intronic
1081351734 11:42061927-42061949 CTGCCTGTATTAGTTTGCTCGGG - Intergenic
1084393076 11:68891169-68891191 GTTCCTGTTTTCTCTGGCTCGGG + Intergenic
1084775532 11:71372279-71372301 GTGCCTGTCTTTACTGCTTCTGG - Intergenic
1084881308 11:72173392-72173414 GTGCCTGTATTTCATTTCTCTGG + Intergenic
1086733801 11:90281693-90281715 GTGCCTGTTTCTCCAGGCTCAGG - Intergenic
1087417686 11:97878733-97878755 CTGCCTGTATTAGTTGGCTTGGG + Intergenic
1089550445 11:119271997-119272019 GTGTATGTATTTCCTGGCTTTGG + Intronic
1089566919 11:119376484-119376506 ATGCCTGTACTTGCCAGCTCTGG - Intronic
1094113034 12:26881767-26881789 GTGCCTGCCTTTGCTGGGTTTGG - Intergenic
1095136371 12:38609491-38609513 GTTCCTGTGTTTGCTTGCTAAGG - Intergenic
1096783935 12:54006534-54006556 GTTCCTTTATTTCCAGGCTCGGG + Intronic
1098172587 12:67761738-67761760 ATGACTGCATTTTCTGGCTCTGG + Intergenic
1098983543 12:76985420-76985442 GAGCCTGTATTTGCAGGAGCTGG + Intergenic
1100442350 12:94628450-94628472 GTGCCTGTCATTGGTAGCTCTGG - Intronic
1101264801 12:103073057-103073079 GTTCCTGTATTAGCTTGCTAAGG - Intergenic
1101455484 12:104826434-104826456 GCCCCTGTGTTTGCTGTCTCAGG + Intronic
1104811547 12:131622762-131622784 GTGCCCGTCTTTGCTGGGTGAGG - Intergenic
1105889456 13:24671939-24671961 GTGTTTTTATTTGCTGACTCCGG - Intergenic
1106196542 13:27498815-27498837 GTGCCTGTGTTTTCTGGGCCGGG + Intergenic
1106431791 13:29687827-29687849 GTTCCTGCTTTTGCTGGCCCTGG - Intergenic
1108043309 13:46359327-46359349 TTGGCTGTATTTTCTGGCTTAGG - Intronic
1109316962 13:60761097-60761119 GTTCCTGTATTAGTTTGCTCAGG + Intergenic
1109662428 13:65481143-65481165 GTGCTTTTATTTGCTGTATCTGG + Intergenic
1111350498 13:87022955-87022977 GAGGCTGTATTTGCTGATTCTGG + Intergenic
1111932415 13:94525459-94525481 GAGCCTGTATTTGCTTGCCAGGG - Intergenic
1116520116 14:45836161-45836183 GTGGCTGGTTTTGCTGTCTCGGG + Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1117213158 14:53522651-53522673 GTTCCTGTATTAGTTGGCTGAGG - Intergenic
1117607029 14:57440479-57440501 GGGCCTGTATTGGGTGCCTCAGG + Intergenic
1118030569 14:61813617-61813639 GGGGCTGGATGTGCTGGCTCAGG + Intergenic
1119169514 14:72523602-72523624 TTGCCTGTATTTGCTTCCTGTGG + Intronic
1119377119 14:74203809-74203831 TTTTCTCTATTTGCTGGCTCAGG - Intergenic
1120474104 14:84965462-84965484 GTGCCTGATTGTGCTGACTCAGG + Intergenic
1121214713 14:92238908-92238930 GTGCCTGCATGTGCAGGATCTGG + Intergenic
1121635128 14:95449085-95449107 GTGCCTGTACATACTGTCTCTGG - Intronic
1122847718 14:104509949-104509971 GTGCCCGTATCTGCTGCCTGGGG - Intronic
1124071150 15:26394139-26394161 GTGCATGTATTGGCTGGCCTCGG + Intergenic
1124721956 15:32118149-32118171 GGGCCTGAAGGTGCTGGCTCAGG - Intronic
1127612144 15:60647331-60647353 GTCTCTGTCTTTTCTGGCTCAGG - Intronic
1127717577 15:61664505-61664527 GTGCCATTATTTGCTTGCTATGG - Intergenic
1131074152 15:89484348-89484370 GTGCCTGTCTTGTATGGCTCAGG - Intronic
1131625039 15:94108672-94108694 GTATCTGTATATGTTGGCTCTGG - Intergenic
1132324944 15:100961181-100961203 GGGCCTGAGTGTGCTGGCTCAGG + Intronic
1132379907 15:101359098-101359120 ATGCCTGTACTTGCTGTTTCTGG + Intronic
1132665308 16:1078781-1078803 ATGCCTGCATGTGCTGGTTCAGG + Exonic
1134309128 16:13059999-13060021 CTGCCTGTATTTGTTTGCTAGGG - Intronic
1135872404 16:26162970-26162992 GAGACTGTATTTGATGGCTAGGG - Intergenic
1137596036 16:49724585-49724607 TTGCCTTTTTGTGCTGGCTCAGG - Intronic
1139252867 16:65512857-65512879 GTGCCTGTATCTGCATCCTCTGG - Intergenic
1141556308 16:84838830-84838852 GTGCGTGTGATGGCTGGCTCAGG + Intronic
1144707539 17:17379524-17379546 GTTTCTGTATTTGCTAGTTCTGG + Intergenic
1146381073 17:32327931-32327953 GTGGCTGGATGTGGTGGCTCAGG - Intronic
1146724264 17:35144857-35144879 ATTCCTGTATTAGTTGGCTCTGG - Intergenic
1149275582 17:55031215-55031237 CTGCTTGTACTTGCTGTCTCAGG - Exonic
1150282547 17:63937848-63937870 GTGCCTGTAGTCCCAGGCTCAGG + Intergenic
1151046111 17:70921454-70921476 GTTCCAGTATCTGCGGGCTCTGG + Intergenic
1153819864 18:8824069-8824091 CTGCCTGTGCCTGCTGGCTCAGG - Intronic
1157627455 18:49062428-49062450 GTGGCTGTATTTGCAGGCCTCGG - Intronic
1160157748 18:76446386-76446408 GGGGCTGTATTTGGGGGCTCTGG - Intronic
1162026749 19:7898726-7898748 GTGCCAGCAATTGCTGCCTCGGG + Exonic
1163071773 19:14848625-14848647 GAGTCTATATCTGCTGGCTCAGG - Intergenic
1163504599 19:17698081-17698103 GTGTCTGCATTTGCTGGCAGTGG - Intergenic
1168046547 19:53798280-53798302 GGGCCTGTGGTTGCTGGCTGAGG - Exonic
925217357 2:2108915-2108937 GTGCCTGTGTTGTCTGGCTGTGG + Intronic
926191077 2:10728012-10728034 GTGCATGTATTGGCTATCTCTGG - Intronic
927919663 2:26962129-26962151 GTGTTTGTATTTGCTGTATCTGG - Intergenic
928655031 2:33441456-33441478 GTGCCTGGCTCTGCTGTCTCTGG - Intronic
930899022 2:56481182-56481204 GTGACTGTCTTTGTTAGCTCTGG + Intergenic
931974082 2:67623587-67623609 GTGCCTGTGTTAGTTGGCTGAGG + Intergenic
932989236 2:76765787-76765809 GTGCCTATGTTAGCAGGCTCAGG - Intronic
933211452 2:79574480-79574502 GTTCCTGTGTTTGCTCGCTTAGG + Intronic
933993097 2:87647643-87647665 ATGTATGTATTTTCTGGCTCTGG + Intergenic
935326565 2:101943023-101943045 CTGCCTGCATTCCCTGGCTCTGG - Intergenic
935350974 2:102151639-102151661 GTGCCTTGAACTGCTGGCTCTGG - Intronic
936300761 2:111303240-111303262 ATGTATGTATTTTCTGGCTCTGG - Intergenic
941192402 2:162402003-162402025 GAGTCTGTATTTCCTTGCTCAGG + Intronic
942595335 2:177586898-177586920 GTGAGTGTATTAGCTGGATCAGG + Intergenic
942747749 2:179254516-179254538 GTGCCTGTATTTGCTGTCCCTGG - Intronic
948446867 2:238039909-238039931 CTGCCAGTATTGTCTGGCTCTGG + Intronic
948865630 2:240773380-240773402 GTGCCAGGCTGTGCTGGCTCAGG - Intronic
1169348354 20:4847967-4847989 ATGCCTGTATTTGCTGATACAGG - Intergenic
1170050676 20:12141441-12141463 GTGCATGAATTTCCTGGGTCAGG + Intergenic
1171137867 20:22713069-22713091 GTTCCTGTATTAGCTTGCTGAGG + Intergenic
1172728739 20:37068976-37068998 GTGCCTGCGATTGCAGGCTCGGG + Intronic
1174521320 20:51132808-51132830 GTGACTGTGTTTGCTGGATGGGG - Intergenic
1179358445 21:40683181-40683203 GTTCCTGTATTTGGCAGCTCTGG - Intronic
1180115925 21:45704981-45705003 GTGCCTCTTTTTTCTGGCTTCGG + Intronic
1180255245 21:46622515-46622537 GTGCCTGTGGTTTCTTGCTCAGG + Intergenic
1181315487 22:21968408-21968430 GGGCCTGTATATGCTGAATCTGG - Intronic
1182678893 22:32062848-32062870 GTGTCTGTCTTAGTTGGCTCAGG + Intronic
950129625 3:10533234-10533256 GCTGCTGTATATGCTGGCTCTGG + Intronic
950230666 3:11272778-11272800 GTGTCTGGATTTGCTGTCTCTGG + Intronic
950354902 3:12399006-12399028 GTGCCTCTCTGTACTGGCTCTGG - Intronic
950475844 3:13214376-13214398 GTGCCTGCCTGTGCTGGCTGTGG - Intergenic
950880232 3:16317353-16317375 GTGCCTGTACTGCCTGGCTGGGG - Intronic
951839480 3:27018607-27018629 TTGCCTCTACCTGCTGGCTCTGG - Intergenic
952223497 3:31349828-31349850 GTGCAAGTATTTCCTGGATCAGG - Intergenic
953022769 3:39126353-39126375 CCCCCTGTATTTGATGGCTCAGG + Exonic
953023510 3:39131026-39131048 GTGCCTGCTTTTGCTGGCAAAGG + Exonic
954493848 3:50933952-50933974 GTGGCTGTCTTTTGTGGCTCTGG + Intronic
955084292 3:55687841-55687863 GTGTCTGTTTTTCCCGGCTCTGG - Intronic
956318054 3:67961710-67961732 GTGCCTGTATTAGTTTGCTGAGG - Intergenic
956449017 3:69355170-69355192 GTGCATGTGTGTGCTGGCACTGG - Intronic
956536460 3:70282203-70282225 CTGGCAGTATTTGCTGTCTCAGG + Intergenic
960021434 3:112958909-112958931 GTGGGTGTATATGCTTGCTCAGG - Intronic
960244000 3:115379685-115379707 GTTCCTGTGTTTGTTGGCTAAGG + Intergenic
960420461 3:117439003-117439025 GTGCCTGTATGTGCTTTTTCTGG - Intergenic
960719264 3:120609696-120609718 GTTCCTGTATTTGTTTGCTTAGG + Intergenic
961281620 3:125769068-125769090 GTGCCTGTATCTGCTCAGTCTGG + Intergenic
962306736 3:134294027-134294049 GTAGTTTTATTTGCTGGCTCTGG - Intergenic
962345192 3:134613479-134613501 GTGACCTTATTTCCTGGCTCAGG - Intronic
962983464 3:140511517-140511539 GTGCCAGTATCTGCTGTTTCTGG + Intronic
965944009 3:174217942-174217964 GTTCATTTATTTTCTGGCTCAGG - Intronic
966763729 3:183439776-183439798 GTTCCTGTATTAGTTTGCTCAGG - Intergenic
967498981 3:190176320-190176342 GTTCGTGGTTTTGCTGGCTCAGG + Intergenic
968727443 4:2254755-2254777 GTGTGTGCATTTCCTGGCTCGGG - Intronic
969797100 4:9534881-9534903 GTGCCTGTATCTGCTCAGTCCGG + Intergenic
974070939 4:57122983-57123005 GGGCTTTTATTTGGTGGCTCTGG + Intergenic
975761348 4:77623606-77623628 GTGACAGCATTTGGTGGCTCTGG - Intergenic
984011375 4:174375710-174375732 GTGCCTGTATTCGCTTGCTAGGG + Intergenic
984837153 4:184032751-184032773 GAGCCTGCAGTGGCTGGCTCTGG + Intergenic
987418048 5:17685282-17685304 GTTCCTGTATTTGTTTGCTGTGG + Intergenic
988291597 5:29295627-29295649 GTTCGTGGTTTTGCTGGCTCAGG + Intergenic
989003370 5:36783663-36783685 GTTCCTGGTCTTGCTGGCTCAGG - Intergenic
989538628 5:42592528-42592550 GTTCCTGTATTAGTTTGCTCAGG + Intronic
990380769 5:55220583-55220605 GTGTCAGTATTCGCGGGCTCTGG + Exonic
991220312 5:64206847-64206869 GTGCCAGCATGTTCTGGCTCTGG - Intronic
995838394 5:116420857-116420879 GTGTATTTCTTTGCTGGCTCTGG + Intergenic
996480498 5:123970275-123970297 ATGCCTGTATTAGTTGGCTCAGG - Intergenic
997201760 5:132013977-132013999 GTGGCTGGATTTGCTGGCTAAGG - Intergenic
997417168 5:133738002-133738024 GTGCCTGTTTCTCCGGGCTCAGG + Intergenic
997424328 5:133792974-133792996 GGGACTGTCCTTGCTGGCTCTGG + Intergenic
997733922 5:136199797-136199819 GTGCCTGTCTTTGCAGGGCCAGG - Intergenic
999671225 5:153960540-153960562 GTGCCTGATTGTCCTGGCTCTGG + Intergenic
1001551991 5:172609550-172609572 GAGCCTGTGTGAGCTGGCTCTGG - Intergenic
1003764984 6:9225651-9225673 GTGTGTGTAATTGCTGGCTCTGG - Intergenic
1003848752 6:10200632-10200654 GTTCCTGTATTTGTTTGCTAAGG - Intronic
1003882198 6:10489010-10489032 GTCCCTGTATTAGCTAGCTTGGG + Intergenic
1006727152 6:36207690-36207712 GTCCCTGTATTTTCTGATTCAGG + Intronic
1007546265 6:42697197-42697219 ACTCCTGTATTTGCTAGCTCAGG + Exonic
1008456032 6:51711735-51711757 GTTCTGGTATTTGCTGGCTTTGG + Intronic
1013604830 6:111738264-111738286 GTGCATGTATTTCCTGTTTCAGG - Intronic
1014429119 6:121345502-121345524 TTGCCTGTATTTGCTGGCCTGGG - Intergenic
1014982328 6:127959388-127959410 GTGCCTGTGCTTCCTGGCCCTGG + Intergenic
1015662610 6:135592025-135592047 GTGTCTGTATTTGTTTGCTTAGG + Intergenic
1017524799 6:155233061-155233083 GTGCCCGCCTTTCCTGGCTCAGG - Intronic
1018053015 6:160028054-160028076 GTGTCTGTATTAGTTTGCTCAGG + Intronic
1018424129 6:163664543-163664565 ATGCCTGTATCTGCTGACCCTGG - Intergenic
1018436578 6:163764871-163764893 GTGCCTGTTCTTTCTGGCCCTGG - Intergenic
1021149684 7:17134441-17134463 CTGCCTGCATTTCTTGGCTCGGG - Intergenic
1022083133 7:27044205-27044227 GTGCCTGCAATTGCAGGCACTGG - Intergenic
1023754532 7:43403928-43403950 TTGCCTGTATTTTTTGGTTCTGG - Intronic
1023959235 7:44912926-44912948 GTGCCTCTATTTGCTGAATCTGG - Intergenic
1024111386 7:46150298-46150320 GTGCCTGTGCTTGCTGGTGCTGG + Intergenic
1024542733 7:50492230-50492252 GTGCCTGCATTAGTTGGCTAGGG - Intronic
1024585100 7:50835378-50835400 GTGCCTGGGTTTGTTTGCTCTGG + Intergenic
1025767738 7:64472487-64472509 GTGCCTGTAATCCCAGGCTCTGG + Intergenic
1025784265 7:64630180-64630202 GTGCCTGTATTAGTTTGCTGGGG - Intergenic
1027674636 7:81142824-81142846 GTTCCTGGTCTTGCTGGCTCAGG - Intergenic
1028744255 7:94309521-94309543 GTGCCTGCATTTAATGGCTGGGG - Intergenic
1029295788 7:99539421-99539443 TTGGCTTTATTTGCTGGCCCTGG - Intergenic
1029507028 7:100968801-100968823 GAGCCTGTCTATGCTGGCACCGG + Intergenic
1029921932 7:104274413-104274435 TTGCCTGTATTAGTTAGCTCAGG + Intergenic
1032821602 7:135529145-135529167 ATGCCTGTATGTCCTAGCTCAGG + Intergenic
1033410305 7:141111422-141111444 GTGCCTGTATTTGCTGGCTCAGG - Intronic
1036257804 8:7219439-7219461 GTGCCTGTATCTGCTCAGTCCGG - Intergenic
1036259053 8:7226436-7226458 GTGCCTGTATCTGCTCAGTCCGG - Intergenic
1036307568 8:7613075-7613097 GTGCCTGTATCTGCTCAGTCCGG + Intergenic
1036309852 8:7678035-7678057 GTGCCTGTATCTGCTCAGTCCGG - Intergenic
1036311106 8:7685032-7685054 GTGCCTGTATCTGCTCAGTCCGG - Intergenic
1036358419 8:8061076-8061098 GTGCCTGTATCTGCTCAGTCCGG + Intergenic
1036359679 8:8068084-8068106 GTGCCTGTATCTGCTCAGTCCGG + Intergenic
1036754394 8:11462798-11462820 GTGCCTGTCCCTGCTGCCTCTGG - Intronic
1036829738 8:12012556-12012578 GTGCCTGTATCTGCTCAGTCTGG - Intergenic
1036892535 8:12605876-12605898 GTGCCTGTATCTGCTCAGTCCGG - Intergenic
1036901728 8:12674493-12674515 GTTCCTGGTCTTGCTGGCTCAGG - Intergenic
1039267554 8:35841948-35841970 GTGCCTGGGTTTGCAGGCTTGGG - Intergenic
1040060357 8:43098322-43098344 GTGTCTGAATTTGCTGTTTCTGG + Intronic
1040702013 8:50077033-50077055 GTGACTGTCTTTTCTGCCTCTGG + Intronic
1042173968 8:66021076-66021098 GTGCCAGGAGTAGCTGGCTCTGG - Intergenic
1042224751 8:66506493-66506515 GTGCCTTTAATTGCTGGTTTAGG + Intronic
1043360007 8:79461136-79461158 GTGCCTGCATTTCCTCTCTCTGG - Intergenic
1043587793 8:81789348-81789370 GTTCCTGTATTAGCTTGCTAAGG + Intergenic
1045158033 8:99501834-99501856 GTGCCTTTATTTTCAGGATCTGG - Exonic
1047411978 8:124631323-124631345 GTTGCTGTGTTTGCTGGCTCTGG - Intronic
1049995325 9:1028940-1028962 GAGCCAGTATTTCTTGGCTCTGG + Intergenic
1050723593 9:8620209-8620231 GAACCTCTATTTGCTTGCTCAGG - Intronic
1053100093 9:35364347-35364369 CTGCCTGTATTTGCTGGCCCAGG - Intronic
1057831235 9:98408901-98408923 GTGCCTGTAATCGCAGGCTGAGG - Intronic
1058828090 9:108792966-108792988 GTTCCTGCACTTGCTTGCTCTGG + Intergenic
1061768960 9:132902601-132902623 ATACCTGTAATTCCTGGCTCTGG + Exonic
1062077823 9:134601472-134601494 CTTCCTGTATCTGCTAGCTCAGG - Intergenic
1062382112 9:136291460-136291482 CAGCCTGGATTTGCTGGCGCAGG + Exonic
1187921170 X:24203346-24203368 GTGCCCGTTTTTGCTGGCCTTGG - Intronic
1188667036 X:32836959-32836981 GTGTCTTTCTTTTCTGGCTCTGG + Intronic
1191729060 X:64314479-64314501 GTGCATGTTTATGCAGGCTCAGG + Intronic
1192173642 X:68872469-68872491 GTGACCCTGTTTGCTGGCTCTGG + Intergenic
1197437170 X:126445395-126445417 GTTCCTGTATTTGTTTGCTAAGG + Intergenic
1199150560 X:144480336-144480358 GTTCCTGTATTTGTTTGCTAAGG + Intergenic
1199691357 X:150311296-150311318 GTGCCTGAGTCTGCTGGCACTGG + Intergenic
1200278659 X:154758027-154758049 GAGTCTGTACTTGGTGGCTCAGG - Intergenic
1201512876 Y:14784863-14784885 GTTCCTGCATTTGTTGGCTAAGG - Intronic
1201555400 Y:15261076-15261098 GTTCCTGGTCTTGCTGGCTCAGG - Intergenic