ID: 1033410350

View in Genome Browser
Species Human (GRCh38)
Location 7:141111984-141112006
Sequence ATTTGTCTCTAGAAGTATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033410349_1033410350 -5 Left 1033410349 7:141111966-141111988 CCTGACAAAGGCAGAAACATTTG 0: 1
1: 0
2: 2
3: 33
4: 268
Right 1033410350 7:141111984-141112006 ATTTGTCTCTAGAAGTATTAAGG 0: 1
1: 1
2: 0
3: 16
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033410350 Original CRISPR ATTTGTCTCTAGAAGTATTA AGG Intronic
903986525 1:27233293-27233315 CTTTGTCTCTGGGAGTATTCAGG + Intergenic
907794310 1:57699610-57699632 AATTGTCATTAGAAGTAATAAGG + Intronic
908815896 1:68033659-68033681 ATTTGGCTCTAAAAATGTTAAGG - Intergenic
909404508 1:75272495-75272517 GTTTTTTTCTAGAAGTTTTATGG + Intronic
909987587 1:82181671-82181693 CTTGGCCTCTCGAAGTATTAGGG + Intergenic
910142763 1:84044413-84044435 ATTTTTCTCTAGAAATATCAAGG - Intergenic
910555220 1:88524019-88524041 ATTTTTCTTTAGAAATGTTAAGG - Intergenic
911808890 1:102247788-102247810 ATTTTTCTCTAAAAGTTTCAAGG + Intergenic
912072774 1:105833512-105833534 GTTTTCCTCTAGAAGTTTTATGG - Intergenic
912163491 1:107014245-107014267 ATATGTCTCTAGAAAAGTTACGG - Intergenic
912478958 1:109963147-109963169 ACTTTTCCCTAGAAGTATAAAGG - Intergenic
913281911 1:117193723-117193745 TTTTGTCTGTAGAATTATTGAGG - Intronic
913432476 1:118810383-118810405 ATTTGTTTCTTAAAGTTTTATGG + Intergenic
914203578 1:145507044-145507066 TTTTGTCTCCAGAAGACTTAGGG - Intergenic
914482700 1:148080198-148080220 TTTTGTCTCCAGAAGACTTAGGG - Intergenic
918673249 1:187247830-187247852 GTTTTCTTCTAGAAGTATTATGG - Intergenic
919100189 1:193086682-193086704 ATATTTGTCTAAAAGTATTATGG - Intronic
919192574 1:194242678-194242700 ATTTTTCCCTAAAACTATTAAGG - Intergenic
919341208 1:196309377-196309399 ATATGTAGCTAGAAGTATTTGGG + Intronic
920355971 1:205372919-205372941 ATTTGTCTCTTGAAGGAGAATGG - Intergenic
921341009 1:214134720-214134742 ATTTTCTTCTAGAAGTTTTATGG + Intergenic
921984828 1:221301256-221301278 ATTTGTATATTGAAGTATTTAGG - Intergenic
922425845 1:225491974-225491996 ATTTGTATATAGAACTTTTACGG + Exonic
923116144 1:230939752-230939774 ATTTATCTCAAATAGTATTATGG + Intronic
924180916 1:241437843-241437865 AAGGGCCTCTAGAAGTATTAGGG - Intergenic
924372612 1:243368776-243368798 ATTTGTCCCTACAAATATCAAGG - Intronic
1062778857 10:182098-182120 ATGTTTCTCTAGAAGCTTTAGGG + Intronic
1064705147 10:18064391-18064413 ATTGTTTTCTAGAAGTGTTATGG + Intergenic
1067710407 10:48646771-48646793 GTTTGTTTCTAGAAGTTGTATGG - Intronic
1068347828 10:55806962-55806984 ATTTATCTCTAAGAGTATCATGG - Intergenic
1068830352 10:61487136-61487158 ATTTGACTCTCCAAATATTAGGG + Intergenic
1071440333 10:85685591-85685613 GTTTGTCTCTAAGAGTATTTTGG - Intronic
1072178719 10:92957735-92957757 ATTTGTCTCTAAATGTGATAAGG + Intronic
1073631292 10:105152072-105152094 ATTTGTTTCTTGATTTATTAGGG - Intronic
1078034413 11:7788051-7788073 ATTTTCCTCTAGGAGTTTTACGG - Intergenic
1078537967 11:12190277-12190299 ATTTGTCTCTTGAAGAATCAGGG + Intronic
1080237989 11:30093763-30093785 ATTAGTCTCTAAAATTAATATGG + Intergenic
1083074861 11:60026242-60026264 ATTTTCTTCTAGAAGTTTTATGG + Intergenic
1085812053 11:79692190-79692212 ATTTGATTCTAGGAGTATTAAGG - Intergenic
1087370533 11:97278598-97278620 ATTTGTGTCTAGAAATACTATGG - Intergenic
1087666994 11:101061606-101061628 ATTTGTCTATAGCAGTATAAGGG + Intronic
1088929467 11:114336174-114336196 ATTTGTATCTCCAAGTATTGGGG - Intergenic
1090115152 11:123963261-123963283 GTTTCTCTCTGGAAGTTTTATGG - Intergenic
1093321766 12:17722248-17722270 AAGGGTCTCTAAAAGTATTAGGG + Intergenic
1094454856 12:30620802-30620824 GTTTGTCTCAAAAAGAATTATGG + Intergenic
1095594000 12:43938388-43938410 AATTTTCTCTAGAAGTGCTAGGG + Intronic
1099121605 12:78696399-78696421 CTTTGTCTCTGGAAGTAATTTGG - Intergenic
1099420112 12:82446915-82446937 ATTTGTTTCAAGAAATTTTAAGG - Intronic
1099609298 12:84846842-84846864 ATTTTTCTCTAGAAATATGAAGG - Intergenic
1099873075 12:88371722-88371744 AAGGGTCTCTAAAAGTATTAGGG - Intergenic
1101772321 12:107762353-107762375 ATTTTCCTCTGTAAGTATTATGG - Intergenic
1103308597 12:119987472-119987494 ATGTGTCTCCAGACATATTAGGG + Intergenic
1106704288 13:32264365-32264387 CTTTGACTCTAGAATTAATAGGG - Intronic
1107227837 13:38072247-38072269 ATTTTTCTCTACAAGGATTCTGG + Intergenic
1107518538 13:41156140-41156162 ATTTCTGTCTAGAAGTTCTAAGG - Intergenic
1109485540 13:63014435-63014457 CTTTTTCTCTAGAAGTTTTGTGG + Intergenic
1111048242 13:82845466-82845488 ATTTGTCTCTAGACTTTATAAGG - Intergenic
1111669296 13:91308310-91308332 ATTTGTCTCTAAAATCAGTATGG - Intergenic
1112139827 13:96626629-96626651 ATTTGTCTGTAGAAAAATTTGGG + Intronic
1112456453 13:99567479-99567501 ATGTGTCTTAAGAAGTTTTAAGG - Intergenic
1114399945 14:22400831-22400853 ATTTGTCTCTAAAAAAATTTTGG - Intergenic
1114593219 14:23888621-23888643 ATTTTTTTCTAGAATTGTTATGG - Intergenic
1115064520 14:29241130-29241152 ATTAGTATCTTGAAGTTTTAAGG + Intergenic
1115525612 14:34277504-34277526 ATATTTCTCTAGAAGGGTTAGGG - Intronic
1116205917 14:41866151-41866173 GTTTTTATCTAGAAGTTTTATGG + Intronic
1116212909 14:41970811-41970833 ATTTTTCTCTATAATTTTTATGG + Intergenic
1118136702 14:63036439-63036461 TTTTTACTCTAGAAGTGTTAGGG - Intronic
1118356989 14:65022402-65022424 ATTTGTAGCAAGAAGTATTTAGG - Intronic
1121025491 14:90613093-90613115 TTTTCTCTCTAAAAATATTAGGG + Intronic
1125178184 15:36850041-36850063 ATTTTTCTCTAGAAATGCTATGG - Intergenic
1126031234 15:44499910-44499932 GTTTTTCTGTAGAAGTATAATGG + Intronic
1127363884 15:58269172-58269194 ATATGTCTCAAGAAGTTTTCTGG + Intronic
1127704154 15:61530770-61530792 ATTTTTCTCTAGAACTGTTCAGG + Intergenic
1128593445 15:68923303-68923325 ATTTTTCTCTTAAAGTTTTATGG + Intronic
1129027664 15:72593433-72593455 ATTTTCTTCTAGAAGTTTTATGG + Exonic
1131700122 15:94926240-94926262 AATTGTCTCTAGAATTATTGAGG - Intergenic
1131883547 15:96884636-96884658 ATTTGTCTCTGCAATTATTTTGG - Intergenic
1133458398 16:5963794-5963816 TTTTGTTTCTAGGAGTCTTATGG - Intergenic
1133527772 16:6623083-6623105 CTGTGTCCCTTGAAGTATTATGG + Intronic
1137350235 16:47707233-47707255 ATTTGCCTTTATAAGTATTTGGG - Intergenic
1138801302 16:60033332-60033354 ACTCCTCTCTAGAAGTAATAAGG + Intergenic
1139108437 16:63857735-63857757 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
1140329048 16:74035237-74035259 TTGTGTTTCTAGAAGTATAATGG - Intergenic
1140831081 16:78751969-78751991 AATTCTCTTTAGAAGTATTGTGG - Intronic
1146736999 17:35246941-35246963 ATTTTTCTCTAGAAATTTTATGG + Intronic
1148952330 17:51324370-51324392 ATTTGCCTGTAGAAGAATTCAGG + Intergenic
1153439100 18:5097627-5097649 ATTTTTCTGAAGAAGTTTTAGGG - Intergenic
1154942034 18:21123564-21123586 ATTTATCTCTAGAACTATGAGGG - Intergenic
1159159673 18:64627664-64627686 ATTTATCTCTTGAAACATTATGG - Intergenic
1164264130 19:23595977-23595999 ATATGTCTATAAAAGAATTAGGG + Intronic
1165026069 19:32962504-32962526 ATTTTCTTCTAGAAGTGTTATGG - Intronic
1165579235 19:36848067-36848089 ATTTTGCTGTAGAAGTACTAAGG + Intronic
925560590 2:5189503-5189525 ATTTGTCTGTAGAAGTTTTTGGG - Intergenic
926346319 2:11949200-11949222 GTTTTTCTCTAGAAGTTTTATGG - Intergenic
926486392 2:13465341-13465363 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
926808463 2:16735117-16735139 ATTAGTTTCTAAAAGTATCATGG + Intergenic
927335087 2:21912355-21912377 TTTTGACTCCAGAAGTATAACGG - Intergenic
927910051 2:26891044-26891066 GTTCGTCTCTAGAGTTATTATGG - Intronic
928148538 2:28805378-28805400 ATTTGTCTTTAAAAGTCATAAGG + Intronic
928234103 2:29525079-29525101 TTCTGTCTCTAGAAGGACTATGG - Intronic
928899927 2:36306281-36306303 ATGTGTCTCTATATGTGTTATGG - Intergenic
930429416 2:51254532-51254554 ATTTGTTTCAAGAAATATTTCGG - Intergenic
930445384 2:51464382-51464404 ATTGGACTCTTGAAATATTAAGG + Intergenic
930992729 2:57678999-57679021 TTTTCTCTTTAGAAGTAATAAGG + Intergenic
931104785 2:59043448-59043470 ACCTGTCTCTAAAAGAATTATGG - Intergenic
931890554 2:66666675-66666697 AAGTGCCTCTAGAAGTATTCTGG + Intergenic
934097783 2:88623623-88623645 GTTTGTTTCAAGGAGTATTAGGG - Intronic
934167257 2:89305647-89305669 AAATGTCTCTACAAGTATTCTGG - Intergenic
934200018 2:89876797-89876819 AAATGTCTCTACAAGTATTCTGG + Intergenic
937575664 2:123418567-123418589 ATTTGTTTATAGAAGCATTTGGG + Intergenic
937690689 2:124751413-124751435 CTTTGTCTGTACAAGGATTATGG + Intronic
937817857 2:126273418-126273440 ATTTGTCTCTAGACTCATTTTGG + Intergenic
939242952 2:139585536-139585558 ATTTGTCTTTAGAAATCTAAAGG + Intergenic
939614476 2:144347090-144347112 ATTTCTCTGTAGAAGTAATAAGG - Intergenic
939802626 2:146729667-146729689 ATGTGTTTCTAAAAGTAATATGG - Intergenic
941396264 2:164977562-164977584 ATTTGTCTTTTTAAGTATAAAGG + Intergenic
942408113 2:175676911-175676933 ATTTTCTTCTAGAAGTATTTGGG + Intergenic
945280629 2:208032175-208032197 ATTTTCCTCCACAAGTATTATGG + Intergenic
945673345 2:212828280-212828302 ATTCTTCTCTAGAATTTTTAAGG + Intergenic
946766885 2:223049172-223049194 TTTTGCTTCTAGAAGTTTTATGG - Intergenic
948405769 2:237717750-237717772 TTCTGTCTATAGAAATATTATGG + Intronic
1169511766 20:6272062-6272084 ATTTTTCTATAAAAATATTAAGG + Intergenic
1172025988 20:31949048-31949070 ATTTTTCTCTACAACTCTTAAGG - Intronic
1172558449 20:35864643-35864665 ATTTGTCTCTATATGAAATAAGG + Intronic
1175528097 20:59650227-59650249 ATTTTTCTCTAAAATTAATAAGG + Intronic
1177166344 21:17609019-17609041 ATATTTTTCTTGAAGTATTAGGG + Exonic
1177733524 21:25059848-25059870 AATTTTCTCTAGTAGAATTACGG + Intergenic
1178057668 21:28817703-28817725 ATTTGTCTATAAAAGTAGCAGGG + Intergenic
1181088099 22:20453260-20453282 CTTTTTTTCTAGAAGTTTTATGG + Intronic
1182967895 22:34540057-34540079 GTTTTTCTCTAGAAATTTTATGG + Intergenic
1183581626 22:38729812-38729834 ATTTGTCTCTAGAAGCTATAAGG + Intronic
1185219259 22:49621262-49621284 ATTTGTTTCTAAAAATATGATGG - Intronic
949591482 3:5498875-5498897 AATTGTCTCTTGATGTAATAAGG + Intergenic
951368880 3:21818550-21818572 ATTTTTATCTAGAAATATTTTGG - Intronic
951911234 3:27752759-27752781 ATTTGTTTCTGGAAGCATTCAGG - Intergenic
952047381 3:29339162-29339184 ACTTATCTCCAGAAGAATTACGG - Intronic
952624356 3:35386260-35386282 ATTTTTCTCTAAAAGTTTAAAGG - Intergenic
953280701 3:41553139-41553161 ATTTTTTTCTAGTAATATTATGG - Intronic
954494423 3:50941183-50941205 ATTTGTATCTAGAATATTTATGG + Intronic
954859851 3:53678507-53678529 ATTTATCTTTAGAAGTTTAAGGG + Intronic
955720732 3:61878061-61878083 AATTTTCTCAAGAAGTGTTAGGG + Intronic
957057899 3:75458363-75458385 TCTTGTTTCTAGCAGTATTATGG - Intergenic
957352583 3:79045455-79045477 ATGTTTCTCTATAATTATTAAGG - Intronic
957429118 3:80078536-80078558 ATTTTTCACTAGAAGTTTAATGG + Intergenic
959731318 3:109605803-109605825 ATTTGTGTCTATAAATATGAGGG - Intergenic
961113688 3:124309476-124309498 ATTTGACTCCAGGAGTTTTATGG + Intronic
963167772 3:142223316-142223338 CTTTGTGTCTAGAATTATAAGGG + Intronic
963557050 3:146805376-146805398 ATCTGTCTCTGGAAATATTTTGG + Intergenic
964026006 3:152075331-152075353 ATTTGACACTAGAAAAATTATGG + Intergenic
964271592 3:154962130-154962152 CTTTGTGTCTAGAAGTACGAGGG - Intergenic
966327837 3:178777022-178777044 ATATCTCTCTTAAAGTATTATGG - Intronic
969001766 4:3988370-3988392 TCTTGTTTCTAGCAGTATTACGG - Intergenic
969752261 4:9120290-9120312 TCTTGTTTCTAGCAGTATTATGG + Intergenic
969812148 4:9656441-9656463 TCTTGTTTCTAGCAGTATTATGG + Intergenic
971070341 4:23083896-23083918 CTATGTCTCTAGATGCATTAAGG + Intergenic
972370337 4:38417438-38417460 ATTTGTCTCTAGTAATACTCTGG + Intergenic
973615675 4:52675598-52675620 ATTTGTCCCTATAAGGTTTATGG + Intergenic
974179765 4:58369240-58369262 ATTTTCTTCTAGAAGTTTTACGG - Intergenic
974237589 4:59201668-59201690 ATTTCAGTCTGGAAGTATTATGG + Intergenic
974595695 4:64012310-64012332 ATTTTTCTCTACAAGTAGTCAGG - Intergenic
974939453 4:68447539-68447561 TTTTCTTTCTAGAAGTCTTAAGG + Intronic
975517247 4:75260261-75260283 TTGTGTCTCTAGGAGGATTATGG - Intergenic
977147106 4:93457509-93457531 ATTTTACTCTAGAAATATTCTGG + Intronic
977404845 4:96583973-96583995 ATTTTTGTTTTGAAGTATTAGGG - Intergenic
979372330 4:119904135-119904157 ATTTGTATCTAGAATACTTAAGG + Intergenic
980232691 4:130064784-130064806 AATTTTCTCTAGAAGAATTTTGG - Intergenic
980491715 4:133535873-133535895 ATTTGTCTTCAGATGCATTATGG + Intergenic
980728843 4:136801760-136801782 ATTTTTCTCTAGACATATAATGG + Intergenic
982003748 4:151045355-151045377 TTTTGAATATAGAAGTATTACGG - Intergenic
982565941 4:156986744-156986766 AAGTGTCTGTACAAGTATTATGG + Intergenic
983950304 4:173631712-173631734 TTTTTTTTCTAGAAGTTTTATGG + Intergenic
984041251 4:174736651-174736673 ATTTGTTTATAGAAGTGTGAAGG + Intronic
985778907 5:1859438-1859460 CTTGGTCTCTAGAAGGTTTACGG - Intergenic
986323806 5:6656469-6656491 TTTTGTTTCTAGCAGTATAATGG + Intronic
987001945 5:13668612-13668634 ATTTGTTGCTACTAGTATTATGG - Intergenic
987287594 5:16473402-16473424 ATTAGTCTTTAGAAATATAAGGG + Exonic
988434698 5:31160175-31160197 ATTAGTATCTAGAAGTTATAGGG - Intergenic
989755281 5:44944873-44944895 ATTTTTCTCTAAAAGTCTTAGGG - Intergenic
989759657 5:44998014-44998036 ATTTTTCTTTAGAAGTAATTTGG - Intergenic
990633165 5:57693106-57693128 ATGTCTGTCTAGAAGGATTAAGG - Intergenic
990806026 5:59663063-59663085 CTTTTGTTCTAGAAGTATTAAGG - Intronic
992924135 5:81563781-81563803 ATGTTTCTCTAGTAGTTTTATGG - Intronic
993262682 5:85680048-85680070 ATTTTTCTCTAAAATAATTATGG - Intergenic
993340659 5:86721213-86721235 ATTTTTCTGGAGAAATATTATGG - Intergenic
993366191 5:87036449-87036471 CTTTGTCTCATGAAGTATTTAGG + Intergenic
993848111 5:92971075-92971097 ATTTGGCTGTAGATGTATTTTGG + Intergenic
994627499 5:102239381-102239403 AATTGTCCCTAAAAGAATTATGG + Exonic
994883581 5:105529309-105529331 TTGTGTATCTAGAAGGATTATGG + Intergenic
995545609 5:113227182-113227204 ATGTGTCTAGAGAAATATTATGG - Intronic
996325404 5:122267478-122267500 TTTTGTATCTAGGAGGATTATGG - Intergenic
996630639 5:125627587-125627609 CTTTGTCTCTAGTAATATTTTGG - Intergenic
996879718 5:128282177-128282199 TTTTCTCTCTGGAAGTTTTAAGG + Intronic
999432069 5:151532969-151532991 CTCTGTCTCTAGAAAAATTATGG - Intronic
1000591206 5:163159626-163159648 ATTTGTATCTATAAGGTTTATGG + Intergenic
1003875040 6:10427719-10427741 ATTTGCCTCAAGAACTTTTAAGG + Intergenic
1005340212 6:24836860-24836882 ATATGTCATCAGAAGTATTAGGG - Intronic
1005835118 6:29702885-29702907 ATCTGGCTCTAGAATTCTTATGG + Intergenic
1009169056 6:60376401-60376423 ACTTATCTTTAAAAGTATTATGG + Intergenic
1009411378 6:63369017-63369039 ATTTGTCTCTATAAATGTTGAGG + Intergenic
1010089680 6:71965931-71965953 TTGTGTCTCTTAAAGTATTAGGG + Intronic
1010579932 6:77583105-77583127 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
1012261983 6:97098043-97098065 ATTTGTCTGTGGAAGCACTAAGG + Intronic
1012342009 6:98138434-98138456 ATTTGTGTCTAGATATGTTAAGG + Intergenic
1013330712 6:109097155-109097177 ATTTGGCCATAGAAGTATGAAGG - Intronic
1021392355 7:20108714-20108736 AATTTTCTCTAGCAGTATTTTGG - Intergenic
1023005143 7:35857083-35857105 ATTTGTTTTTAGAAATATTGGGG + Intronic
1024827479 7:53408615-53408637 ATTTGTCTTTTGAAATAATAGGG - Intergenic
1025218231 7:57078582-57078604 ATTTGTTTTTAGAAATATTAGGG - Intergenic
1025629150 7:63252202-63252224 ATTTGTTTTTAGAAATATTGGGG - Intergenic
1025653113 7:63491871-63491893 ATTTGTTTTTAGAAATATTAGGG + Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028038974 7:86022927-86022949 ATTTGTCTCTAGAGGTATTAAGG + Intergenic
1030630454 7:111889648-111889670 ATTTTTCTCTACAAGTTTTCAGG - Intronic
1031005228 7:116462491-116462513 ATTTGTTTCTAAATGTTTTATGG - Intronic
1031212137 7:118843283-118843305 ATTTGTCTCTATAGGTTTTTGGG + Intergenic
1032105375 7:129024709-129024731 ATTTATCTGTTGAAGTATCAGGG - Intronic
1032200411 7:129818554-129818576 ATATGTCACTAGAAGTAATGAGG - Intergenic
1033410350 7:141111984-141112006 ATTTGTCTCTAGAAGTATTAAGG + Intronic
1033634544 7:143199463-143199485 CTTTTTCTCTAGAAGTTTTTAGG + Intergenic
1036375468 8:8195701-8195723 TCTTGTTTCTAGCAGTATTATGG + Intergenic
1036854064 8:12227448-12227470 TCTTGTTTCTAGCAGTATTATGG - Intergenic
1036875437 8:12469946-12469968 TCTTGTTTCTAGCAGTATTATGG - Intergenic
1040283123 8:46079176-46079198 ATTTTTCACTATATGTATTATGG - Intergenic
1040546200 8:48399842-48399864 ATTAGTCTCTAGCTGTATCATGG - Intergenic
1040938279 8:52804785-52804807 ATTTTTTTCTAAAAGTATTTAGG + Intergenic
1043451943 8:80376562-80376584 ACTTGGCTCTAAAAGCATTAGGG + Intergenic
1047019883 8:120763996-120764018 ATTACTCTCCATAAGTATTATGG - Intronic
1047857682 8:128930073-128930095 ATTGGGCTCTGGAAGTAATAAGG + Intergenic
1051247783 9:15128958-15128980 ATGTGTATCTAGAAGTTTTTTGG - Intergenic
1052649368 9:31281152-31281174 ATTTTTCAATATAAGTATTATGG + Intergenic
1054918708 9:70520517-70520539 ATCTGTCTCTAGAAGAAATCAGG - Intergenic
1056326557 9:85484429-85484451 ATTTCCCTCTAGTAGTGTTAGGG - Intergenic
1057608676 9:96520956-96520978 GTTTTTCTTTGGAAGTATTATGG - Intronic
1058668594 9:107342056-107342078 TTTTGTCTATACAAATATTAGGG + Intergenic
1059056765 9:110991116-110991138 GTTTTCCTCTAGAAGTTTTATGG - Intronic
1187461009 X:19486738-19486760 GTTAGTCTCTGGAACTATTAGGG + Intronic
1187530164 X:20089089-20089111 ATTTTCTTCTAGAAGTTTTATGG + Intronic
1189730971 X:44020653-44020675 ATTTGTCTCTATACTTATTTTGG - Intergenic
1189863570 X:45299466-45299488 GTTTTTCTCTAAAAGTTTTATGG - Intergenic
1190663873 X:52679643-52679665 CATTGACTCTAGAAATATTAAGG + Intronic
1190675549 X:52778779-52778801 CATTGACTCTAGAAATATTAAGG - Intronic
1191138610 X:57092803-57092825 AGTTGTTTCCAGAAGGATTATGG - Intergenic
1191692320 X:63952943-63952965 TTATGTTTCTAGAAGGATTATGG - Intergenic
1192069080 X:67918131-67918153 ATGTGTCCCTAGGAGGATTACGG + Intergenic
1192975149 X:76275656-76275678 ATTTGTTTCAAGAAATATTTAGG + Intergenic
1193692367 X:84661383-84661405 ATTTTACTCTAGAATTAATATGG - Intergenic
1197498001 X:127209473-127209495 ATTTATTTCTAGAAGTTCTAAGG + Intergenic
1199107754 X:143890833-143890855 ATTTTTTTCTAGAATTTTTATGG + Intergenic
1202038080 Y:20655430-20655452 GTTTTTCTGTAGAAGTATTCTGG - Intergenic
1202342967 Y:23888758-23888780 ATTTGTCTCTGCCAGTATTGGGG + Intergenic
1202527801 Y:25781327-25781349 ATTTGTCTCTGCCAGTATTGGGG - Intergenic