ID: 1033410630

View in Genome Browser
Species Human (GRCh38)
Location 7:141114577-141114599
Sequence TCACCTGCCCAAAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033410630_1033410637 22 Left 1033410630 7:141114577-141114599 CCTTCTGCCCTTTGGGCAGGTGA 0: 1
1: 0
2: 3
3: 14
4: 253
Right 1033410637 7:141114622-141114644 CTCTTTCCAAAGTCTCCATGGGG 0: 1
1: 0
2: 0
3: 133
4: 1015
1033410630_1033410635 20 Left 1033410630 7:141114577-141114599 CCTTCTGCCCTTTGGGCAGGTGA 0: 1
1: 0
2: 3
3: 14
4: 253
Right 1033410635 7:141114620-141114642 GTCTCTTTCCAAAGTCTCCATGG 0: 1
1: 0
2: 2
3: 26
4: 251
1033410630_1033410636 21 Left 1033410630 7:141114577-141114599 CCTTCTGCCCTTTGGGCAGGTGA 0: 1
1: 0
2: 3
3: 14
4: 253
Right 1033410636 7:141114621-141114643 TCTCTTTCCAAAGTCTCCATGGG 0: 1
1: 0
2: 0
3: 27
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033410630 Original CRISPR TCACCTGCCCAAAGGGCAGA AGG (reversed) Intronic
900638411 1:3676604-3676626 ACTCCTCCCCACAGGGCAGAGGG + Intronic
901332946 1:8424300-8424322 TCACCTGCCCACCGGGCAGAGGG + Intronic
902521744 1:17021938-17021960 GAACCTGGCCAAAGGGCAGCCGG + Intronic
902647041 1:17806762-17806784 TCTCCTGCTCAAAGCGCAGCAGG - Intronic
902651521 1:17840687-17840709 TCACCTTCACATTGGGCAGATGG + Intergenic
903225974 1:21894450-21894472 GGACCTGCCCCAAGGGCAGCTGG + Intronic
903298706 1:22362861-22362883 ACACCTGCCCATAGGAAAGAGGG + Intergenic
904011160 1:27391446-27391468 TCCCCTGGACTAAGGGCAGATGG + Intergenic
904252290 1:29233784-29233806 TCCCCTGCACAAAGGGCAAAGGG + Intergenic
904585280 1:31576606-31576628 TCCCCTGCTCAGAGGGCGGAAGG + Intronic
905530564 1:38675431-38675453 CAACCTGCCCAATGGGCTGATGG - Intergenic
905706989 1:40067908-40067930 TCACTTTCCCATGGGGCAGATGG - Intronic
905863784 1:41366199-41366221 TCCCCAGCCCCAAGGGCTGATGG + Intronic
910476167 1:87609693-87609715 TCACATGGCTGAAGGGCAGAAGG + Intergenic
910773780 1:90854683-90854705 TCCCCTGCCCTAAAGGCAGAGGG - Intergenic
911250553 1:95571665-95571687 TCTCCTGGCAAAAGGGAAGAAGG - Intergenic
912526883 1:110290128-110290150 TCAGCTGCCCCAAGGCCAAAAGG + Intergenic
913105679 1:115612126-115612148 TCAGCCTCCCAAAAGGCAGACGG - Intergenic
914973084 1:152329218-152329240 TCAGCAGCCCAGAGGCCAGATGG - Intergenic
915319084 1:155046341-155046363 TCACCTGGCCAAGGAGCAGGAGG - Exonic
915524935 1:156469973-156469995 CCTCATGCCCAAGGGGCAGAGGG + Intronic
916224713 1:162477848-162477870 TGACATGCTCAAAGGGCTGAAGG + Intergenic
920043306 1:203117704-203117726 TCACCTGCAGAAAGGCCAAAAGG - Intronic
922037556 1:221863935-221863957 TCTACTGCCCAAAGAGCTGAGGG + Intergenic
922825222 1:228512996-228513018 TCCCCATCCCCAAGGGCAGAAGG - Intergenic
922892481 1:229072570-229072592 TCACCTCCACACAGGGCAGCCGG + Intergenic
923126048 1:231035484-231035506 TCTCCTGCCCCCAGGGCTGAAGG + Intronic
923234031 1:232015183-232015205 TCACCTGCCCAAGGGAAGGAAGG + Intronic
923565363 1:235072350-235072372 GCAGCTCCGCAAAGGGCAGAAGG - Intergenic
924589274 1:245387779-245387801 ACACCTGCCCAAAGTGTAGCTGG + Intronic
924694404 1:246383338-246383360 TCTCCTCCCAAAAGGGCAGAAGG + Intronic
1063408302 10:5816807-5816829 TCTCCTTTTCAAAGGGCAGATGG - Intronic
1063466743 10:6250837-6250859 TAACCGGCCCAAATGGCAAATGG + Intergenic
1063988977 10:11539051-11539073 TCTCCTCTCCAAGGGGCAGAAGG + Intronic
1065806071 10:29394724-29394746 TCCCCTGCCCAAAGTCCAGAGGG - Intergenic
1066108936 10:32179524-32179546 TCACAAGCCCAAATGTCAGAAGG - Intergenic
1068556072 10:58460397-58460419 GTACCTGCCCAAAGAGGAGAGGG + Intergenic
1070329740 10:75408686-75408708 CCATCTCCCTAAAGGGCAGAGGG + Intergenic
1072722008 10:97786943-97786965 GCCCCTTCCCAAAGGGCAAAGGG - Intergenic
1076041463 10:127253151-127253173 TGACCTGCCCAAGGGGCTGCTGG + Intronic
1076798266 10:132809151-132809173 TCGCCTGGCCAAGGGGTAGAGGG - Intronic
1078050877 11:7963704-7963726 TCACCTGACTAAGAGGCAGAGGG - Intronic
1079572100 11:21955509-21955531 TCACCTTCACAAAAGGAAGATGG + Intergenic
1081869112 11:46375298-46375320 ACCCCTGGCCAGAGGGCAGAGGG - Intronic
1084869398 11:72087108-72087130 TCACCTCCCCAAAGCTCAGCTGG + Intronic
1085054242 11:73394716-73394738 TCACCTGCCCACAGACAAGATGG - Exonic
1085468245 11:76738764-76738786 TCACCTGCAAAATGGGGAGAGGG - Intergenic
1087149340 11:94844577-94844599 TTGCATGGCCAAAGGGCAGAAGG + Intronic
1089658796 11:119972186-119972208 TCACATGGCAGAAGGGCAGAAGG - Intergenic
1093025316 12:14240410-14240432 GCATCTGCGCAAAGGGCTGATGG - Intergenic
1094654682 12:32408935-32408957 GAACCTTCCCAGAGGGCAGATGG - Intronic
1095938948 12:47713122-47713144 TCCCCTGCCCATATGGCAGGGGG - Intronic
1097015756 12:55986076-55986098 TCACCACTCCTAAGGGCAGAAGG - Intronic
1100981684 12:100167138-100167160 ACACCTGCCCAAAATACAGAGGG + Intergenic
1101204787 12:102475796-102475818 TCACCTGCCCAAGAAACAGAGGG + Exonic
1101271884 12:103156106-103156128 TGACCTGCCCAGAAGGCAGAAGG - Exonic
1102090577 12:110183977-110183999 TCCCCTGGCTAAAGTGCAGAGGG - Intronic
1102823371 12:115926632-115926654 TCACCTCCCCTAAGAGAAGAAGG - Intergenic
1103507445 12:121451437-121451459 TCAACTGCACAGAGGTCAGATGG + Intronic
1103598265 12:122037482-122037504 TCACCAGCTCCAAGGGCAGGGGG + Intronic
1106862227 13:33922020-33922042 ACACCTGCCCAGAGGGCTGCTGG + Intronic
1108795182 13:54022441-54022463 TCCACTGCCCAAAGGCCAAAAGG + Intergenic
1111822840 13:93234209-93234231 CCACCACCCAAAAGGGCAGAAGG - Intronic
1112094873 13:96121474-96121496 CCACCTGCCCAAAGGGAAGGAGG - Intronic
1113652816 13:112048295-112048317 GGACCTGCACAAAGAGCAGATGG + Intergenic
1114540841 14:23457135-23457157 TCACTTGGCAAAAGAGCAGAAGG - Intergenic
1118305391 14:64650891-64650913 TCACCTTCCCCAAGGGAAGGAGG - Intergenic
1118910742 14:70060184-70060206 TTACCTCCTCGAAGGGCAGAGGG + Intronic
1119918643 14:78426043-78426065 TCACCTGCCCTGAGGCCAGCAGG + Intronic
1121938547 14:98044631-98044653 TCACCAGCCCAAAGGCCAACAGG + Intergenic
1122727413 14:103767054-103767076 TCACCTGCCCAATGACCCGAAGG + Intronic
1125416534 15:39459865-39459887 TCACATGACCAAAGGACTGAGGG + Intergenic
1125721074 15:41845465-41845487 CCTCCTTCCCAAAGGGCTGAGGG - Intronic
1127773280 15:62247109-62247131 GCACCTGCCCAAAGCACAGGGGG + Intergenic
1127774595 15:62255121-62255143 GCACCTGCCCAAAGCACAGGGGG + Intergenic
1128558785 15:68650911-68650933 TCATCTGACCAGAGGGCAGCAGG - Intronic
1130412994 15:83662915-83662937 TCTGCTACCCAGAGGGCAGAGGG - Intronic
1130959539 15:88650571-88650593 GCACCTGCCCAAACTGCAGGTGG - Intronic
1132571322 16:645662-645684 TCACCCGACCCCAGGGCAGATGG + Intronic
1134102522 16:11462070-11462092 TAACCTGGCCACAGAGCAGAGGG + Intronic
1134166067 16:11930608-11930630 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1134494651 16:14723119-14723141 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1134500034 16:14762239-14762261 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1134526577 16:14948857-14948879 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1134545827 16:15107488-15107510 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1134580546 16:15366811-15366833 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1134714155 16:16347330-16347352 TCAGATGCCAGAAGGGCAGAGGG + Intergenic
1134722028 16:16390694-16390716 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1134945397 16:18321175-18321197 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1134952662 16:18361328-18361350 TCAGATGCCAGAAGGGCAGAGGG - Intergenic
1135190549 16:20350773-20350795 GCACCTGCCCAAAGGAAAGACGG + Exonic
1135311457 16:21408033-21408055 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1135364409 16:21840484-21840506 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1135420401 16:22302025-22302047 TCACATACCCAAAGAGAAGAGGG - Intronic
1135447434 16:22530864-22530886 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1136150616 16:28345931-28345953 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1136166853 16:28459769-28459791 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1136196122 16:28655263-28655285 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1136212462 16:28769386-28769408 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1136257183 16:29049298-29049320 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1136308163 16:29387029-29387051 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1136321579 16:29488567-29488589 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1136436259 16:30228537-30228559 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1137495319 16:48965011-48965033 TCACCTTCCCAGAAGGCACATGG - Intergenic
1139083940 16:63561407-63561429 TCACATGCCCAAAGGTCTAAAGG - Intergenic
1139393490 16:66621537-66621559 GCACCAGCCCAAAGGCCACAGGG - Intronic
1140366874 16:74388633-74388655 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1140410428 16:74737725-74737747 ACACCTGCCCCTGGGGCAGAAGG - Intronic
1140777419 16:78262789-78262811 TCACCTCCCCACAGCCCAGATGG - Intronic
1141148392 16:81547723-81547745 GCACTTCCCCAAAGGGAAGAGGG - Intronic
1143295895 17:5871740-5871762 TCACCTGCACAAAGGGGCCATGG + Intronic
1143311751 17:5997743-5997765 TCCCCTTCCCCAAGGGCAGCAGG + Intronic
1144183243 17:12772016-12772038 TAACCCAGCCAAAGGGCAGATGG + Intergenic
1148019218 17:44542390-44542412 ACACCAGCCAAAAGGACAGATGG - Intergenic
1148070630 17:44906616-44906638 TCACCTGCCCAGATCCCAGAAGG - Intronic
1148336966 17:46848445-46848467 TCAGGAGCCCACAGGGCAGAGGG + Intronic
1148687408 17:49508588-49508610 TCACCCACCCTCAGGGCAGAAGG + Intronic
1149030110 17:52072923-52072945 TCACAGGCAAAAAGGGCAGAGGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151135234 17:71940295-71940317 TCACTTGCCAAAAGGGCCTATGG - Intergenic
1151597479 17:75087474-75087496 TCACCTGCTCCCAGGGCTGAGGG + Intergenic
1151991015 17:77574325-77574347 CCACCTACCCAAAGAGCACAAGG - Intergenic
1152196919 17:78923875-78923897 TCACCTGCCCAGAGTGGAGGTGG - Intronic
1152417882 17:80174832-80174854 TCAGCTGCCCAAACAGTAGAGGG + Intronic
1154117328 18:11622653-11622675 TCAGATGCCAGAAGGGCAGAGGG - Intergenic
1156005691 18:32438426-32438448 TCAGCTGCCTCTAGGGCAGAAGG - Intronic
1162306520 19:9877744-9877766 TCCCATGGCCAAAGGGCTGAAGG - Intronic
1162459842 19:10808210-10808232 ACCCCTGCCCAATGGGGAGAAGG - Intronic
1163404617 19:17114343-17114365 TCACCTCCCCCAAGGGACGAGGG - Intronic
1166534276 19:43562417-43562439 TCACATGCAAAAAGGGAAGATGG + Intronic
1167094860 19:47369740-47369762 TCACCTGACCCAGGGCCAGAGGG - Intronic
1167286847 19:48603303-48603325 CCACCTGCCCAAAATGCAGCAGG + Intronic
1167528953 19:50002890-50002912 TCCCCTTCCCAAAGGTCAGCTGG + Intronic
1168304544 19:55428477-55428499 TCACATGCTCAGAGGACAGAGGG + Intergenic
925359796 2:3269837-3269859 GCAGCTGCGCCAAGGGCAGAGGG - Intronic
925973078 2:9121301-9121323 TCACCTGACCTGTGGGCAGAAGG - Intergenic
929283356 2:40107436-40107458 ACACTTTCCCAAAAGGCAGAGGG + Intronic
931880741 2:66567881-66567903 TTACCTGTCAAAAGGGCAAAGGG + Intronic
931984047 2:67724422-67724444 CCACCTGCCCAAAGCGCAGAAGG + Intergenic
937156828 2:119725574-119725596 TCACCTGACCCAAGGGCGGCGGG + Intergenic
938730386 2:134142598-134142620 TCACATGACCAAAGGGCACTGGG + Intronic
941633785 2:167913801-167913823 CCACCCCCCCAAAGGGGAGAAGG + Intergenic
943658872 2:190536354-190536376 GCTGCTCCCCAAAGGGCAGAAGG - Intergenic
948592243 2:239058553-239058575 AAACCTGGCCAAAGGGCAGCTGG + Intronic
1169212176 20:3772731-3772753 TCTCCAGTCCAAAGGGCAGCAGG + Intergenic
1169912622 20:10659663-10659685 TCCTCTGCCCAGAAGGCAGATGG + Intronic
1171464108 20:25315865-25315887 GCACTGGCCCACAGGGCAGAAGG - Intronic
1171902202 20:30868386-30868408 TCACCTGCCCCAACGGCTCACGG + Intergenic
1172049282 20:32104014-32104036 TCACATGTCCACAGGTCAGATGG - Intergenic
1172500898 20:35426389-35426411 TCCCATGGGCAAAGGGCAGAAGG - Intergenic
1172852918 20:37979510-37979532 TCACATGCCCAAAGAGCTGTGGG - Intergenic
1173360042 20:42335260-42335282 TCTCCTGCCTAAGGGGTAGAGGG - Intronic
1175118111 20:56697821-56697843 TCACCGGCCCAGACGCCAGAGGG - Intergenic
1175236861 20:57519957-57519979 TCAACTGCCCAAAGGCCACATGG + Intronic
1176682196 21:9825224-9825246 TCACCTCCCCACAGGGTCGAAGG - Intergenic
1176682475 21:9826633-9826655 TCACCTCCCCACAGGGTCGAAGG - Intergenic
1176682753 21:9828052-9828074 TCACCTCCCCACAGGGTCGAAGG - Intergenic
1176683033 21:9829449-9829471 TCACCTCCCCACAGGGTCGAAGG - Intergenic
1176683312 21:9830859-9830881 TCACCTCCCCACAGGGTCGAAGG - Intergenic
1176683592 21:9832268-9832290 TCACCTCCCCACAGGGTCGAAGG - Intergenic
1176683872 21:9833671-9833693 TCACCTCCCCACAGGGTCGAAGG - Intergenic
1176684149 21:9835080-9835102 TCACCTCCCCACAGGGTCGAAGG - Intergenic
1176684429 21:9836481-9836503 TCACCTCCCCACAGGGTCGAAGG - Intergenic
1179577925 21:42319315-42319337 TCAGCCTCCCAAAGTGCAGAGGG + Intergenic
1179745236 21:43440659-43440681 TCACCTGGACTAAGGGCAGGAGG + Intergenic
1180113153 21:45675254-45675276 TCAGCTGCCCAAGAGGTAGAGGG - Intronic
1180335578 22:11574321-11574343 TCACCTGCCCCAACGGCTCACGG + Intergenic
1182320065 22:29473017-29473039 TAACCTCCCCAAATGCCAGAAGG + Intergenic
1183680597 22:39326802-39326824 TCACATACCTGAAGGGCAGATGG + Intergenic
1184394058 22:44222236-44222258 ACATGGGCCCAAAGGGCAGAGGG + Intergenic
1184467414 22:44677013-44677035 TCACATGGCCAAAGGGCAGAGGG - Intronic
1184769558 22:46589417-46589439 TCACGTGGCCCGAGGGCAGATGG + Intronic
1185020172 22:48369886-48369908 CCACCTTCCCAAGAGGCAGAGGG - Intergenic
1185181745 22:49367531-49367553 CCACCTGCCCACAGCACAGAGGG + Intergenic
949763628 3:7500673-7500695 ACATCTGCCCAAGGGGCTGAGGG - Intronic
954653825 3:52181929-52181951 ACACCCACCCACAGGGCAGAGGG + Intergenic
955561584 3:60196633-60196655 ACACCCGCCCTAAGTGCAGACGG + Intronic
955719408 3:61865629-61865651 CCACCTGCCGACAGGGCAGGTGG + Intronic
956437849 3:69251755-69251777 TCTCCTGCCTGAAAGGCAGAGGG - Intronic
960270418 3:115667962-115667984 TGACATGCTCAAAGGACAGAAGG - Intronic
961143493 3:124575099-124575121 GTAACTGCCCATAGGGCAGAGGG - Intronic
961629199 3:128283865-128283887 GCACCCGCCCAAATGGGAGAGGG + Intronic
961832887 3:129633282-129633304 TCCACTGAGCAAAGGGCAGAGGG + Intergenic
963199138 3:142568871-142568893 TGGCCTGCCCAAAGTCCAGAGGG - Intronic
965767098 3:172142374-172142396 TAACAAGCCTAAAGGGCAGAAGG - Intronic
966241045 3:177755680-177755702 TCATCTTCCCACAGGACAGAAGG + Intergenic
967260700 3:187638929-187638951 TCACATGGCAAAAGGGAAGAAGG + Intergenic
968881246 4:3301226-3301248 TGTCCTGCCCACAGGGCAGCCGG - Intronic
969513309 4:7631934-7631956 GCACCTGCCCAGAAGGCAGCTGG - Intronic
969855593 4:9996642-9996664 TCAAATGCCCAAAGGGGAAAGGG - Intronic
977864492 4:102008085-102008107 TCATCTGCCCACAGTGCAGATGG + Intronic
979471680 4:121106440-121106462 TTACCTGCCCAAAGGACTGTGGG - Intergenic
980478679 4:133356372-133356394 TCATCAGCCCAGAGGGAAGATGG - Intergenic
980659971 4:135844793-135844815 TCACCTGCTCAAAGGAAAGGTGG - Intergenic
980710839 4:136564976-136564998 TCACCTGACTACAGGGCACAGGG + Intergenic
981475921 4:145186799-145186821 TCATCTGTCTAAAGTGCAGATGG - Intergenic
986167865 5:5291523-5291545 TCTCCTCCGCAAAGGGGAGATGG - Intronic
986536973 5:8798109-8798131 TCTCCTTGACAAAGGGCAGAAGG + Intergenic
986972062 5:13348552-13348574 TCACCTGCTCTGAGGACAGATGG - Intergenic
989624152 5:43413605-43413627 TCACCTGGCAGAAGAGCAGAAGG - Intergenic
990826686 5:59907956-59907978 TCACCTTCTGAAAGGGAAGAGGG - Intronic
994828094 5:104742627-104742649 TCACCTGCCCACAGGTAAAATGG + Intergenic
995035016 5:107523764-107523786 TCACCTGCATAAAGAGAAGAAGG - Intronic
995487484 5:112653757-112653779 TCAGCAGTCCACAGGGCAGATGG + Intergenic
999343286 5:150792287-150792309 TTCCCTGCCCAGAGGGCACAAGG - Intronic
999777442 5:154822431-154822453 TCCCCAGAGCAAAGGGCAGATGG - Intronic
1000257431 5:159553289-159553311 ACACCCACCCAAAGGGCAGCAGG - Intergenic
1001492429 5:172165122-172165144 TCAGCTGCACAAAGGCCAGCAGG + Intronic
1001637955 5:173226222-173226244 ACTCCTGCTCAAAGGACAGATGG + Intergenic
1002277499 5:178113537-178113559 TCGCCTGCCCCAAAGGCGGAGGG - Exonic
1002313382 5:178328138-178328160 ACCCTTGGCCAAAGGGCAGAGGG - Intronic
1002647807 5:180669817-180669839 TGCCCTGACCACAGGGCAGATGG - Intergenic
1004583022 6:16972780-16972802 TCACCAGTTAAAAGGGCAGAAGG - Intergenic
1005591363 6:27331614-27331636 TCACCTTCCAAAAGGGCCTAAGG + Intergenic
1005967170 6:30734943-30734965 TCATCTGCTCAGAGGGAAGAAGG + Intronic
1008666073 6:53717712-53717734 TCCCCTTCCCACAGGTCAGAGGG + Intergenic
1013179797 6:107708183-107708205 TCAGCAGCCCAGAGTGCAGAAGG + Intronic
1014032704 6:116724319-116724341 TCACCTGCATTAAGGGCAGTTGG + Exonic
1017318490 6:153060419-153060441 GCACCTTCCCAAAGGCCAGGAGG - Intronic
1018709410 6:166486923-166486945 TAACCGGCCCAAAATGCAGACGG + Intronic
1019039237 6:169089844-169089866 TCACCTCTCCACAGGGCAGCAGG - Intergenic
1019265040 7:110393-110415 TCCCCTGCCCACGGGGCGGAGGG - Intergenic
1019273014 7:161087-161109 TCATCTGCCCTCAGGGCTGATGG + Intergenic
1019611097 7:1937082-1937104 GCACCTGTCCACAGGGCACAGGG - Intronic
1021325295 7:19258827-19258849 TCACCTCCTCACAGGGCAGCAGG - Intergenic
1021848575 7:24786137-24786159 TCACGTGCCCCAACAGCAGATGG - Intergenic
1022458284 7:30578848-30578870 TCTCCTGCCCAGAAGGCGGAAGG - Intergenic
1022459714 7:30594096-30594118 CCTCCTGCCCAAAGGGTGGAGGG - Intergenic
1022634194 7:32116501-32116523 TGACCTCCCCAAATGGCAGGGGG + Intronic
1025782606 7:64615224-64615246 GCACCTGCCCACAGGGAAGATGG + Intergenic
1027262258 7:76473262-76473284 TGACCTTCTCACAGGGCAGATGG - Intronic
1027313639 7:76971359-76971381 TGACCTTCTCACAGGGCAGATGG - Intergenic
1028556146 7:92127244-92127266 ACATCTGCCCACAGGGCAGCAGG - Intronic
1029605890 7:101599205-101599227 TCACATGCCAAGAGGGCAGAGGG - Intergenic
1030672515 7:112352826-112352848 TCTCCTGTCCAAGGAGCAGAAGG - Intergenic
1031537705 7:122955812-122955834 TCCCCTGGCCAAAAGGCAGGAGG - Intergenic
1033410630 7:141114577-141114599 TCACCTGCCCAAAGGGCAGAAGG - Intronic
1033715976 7:144002933-144002955 TTACCTCCTCAAAGGTCAGAGGG + Intergenic
1034711011 7:153191535-153191557 TCATCTACCCAGAGGGCAGAGGG - Intergenic
1036181452 8:6588800-6588822 TGACCTGGCCCAAGGGCAGCTGG - Intronic
1036646028 8:10611804-10611826 TCCCCTGCCCACCCGGCAGAGGG + Exonic
1041903494 8:63007740-63007762 TCACCTGGCCAAGGCACAGAAGG + Intergenic
1042102065 8:65284561-65284583 TCAAATGCACAAAGGGAAGAGGG - Intergenic
1045555325 8:103209452-103209474 TCAGCAGCCCCAAGGGCTGAAGG + Intronic
1046983354 8:120360862-120360884 TGACCTTGCCAAAGAGCAGAGGG - Intronic
1047310479 8:123687742-123687764 GCACCAACCCAAATGGCAGAAGG - Intronic
1049109119 8:140632309-140632331 TCAACTGCCCCACGGGTAGAGGG + Intronic
1049732284 8:144184886-144184908 TCACCTCCACCCAGGGCAGAAGG + Intronic
1049738590 8:144223089-144223111 TCACCTGCCCAGAGAACAAATGG - Exonic
1053451513 9:38197862-38197884 TGCCCTCCCCACAGGGCAGAGGG + Intergenic
1055945247 9:81687684-81687706 TCACCAGGCCAAAGGGAAGGGGG + Intronic
1056732268 9:89177121-89177143 TGAGCTGCCCAACCGGCAGAAGG + Intronic
1056827950 9:89890038-89890060 TTCCCTGCCCCAAGCGCAGATGG + Intergenic
1057365251 9:94414450-94414472 TCACATGCTCAAAGGCCTGAGGG - Intronic
1057658071 9:96973634-96973656 TCACATGCTCAAAGGCCTGAGGG + Intronic
1057857064 9:98609922-98609944 CCACAAGCCAAAAGGGCAGAGGG + Intronic
1060915535 9:127387313-127387335 TCACCTTCCCCCAGGGAAGAAGG - Exonic
1061014986 9:127976322-127976344 TCACCTACCCCATGGGCTGATGG - Intronic
1061839562 9:133350034-133350056 TCACCTGCTCGAAGGACAGGTGG - Exonic
1062114685 9:134802048-134802070 TCACTTGCCCACAGGGAAGAGGG + Intronic
1203782856 EBV:110517-110539 GCACTTGCTCAAAAGGCAGAGGG + Intergenic
1186878261 X:13838691-13838713 TCCCCTGCCCAAAGGGAGGAAGG + Intronic
1190444105 X:50505772-50505794 TCAGAGGCCCAAAGGGTAGAGGG + Intergenic
1191900566 X:66035895-66035917 TCAGCTCCCCTAAGGTCAGAAGG - Intronic
1192671135 X:73143100-73143122 CCACCTGGGCAAAGGGCTGATGG - Intergenic
1194585787 X:95732515-95732537 ACACCTGCGGAGAGGGCAGATGG - Intergenic
1195010817 X:100731350-100731372 TCCCCAGCCCCAAGCGCAGAGGG + Intronic
1195139565 X:101945646-101945668 TCACATGCCAGAAGGGCAAAAGG - Intergenic
1200032340 X:153306844-153306866 TCACATGGGCAAAGGCCAGAAGG - Intergenic
1202373543 Y:24213876-24213898 GGACCTGCCCAAAGCACAGAGGG + Intergenic
1202497238 Y:25456244-25456266 GGACCTGCCCAAAGCACAGAGGG - Intergenic