ID: 1033411034

View in Genome Browser
Species Human (GRCh38)
Location 7:141117982-141118004
Sequence CCATTCTATGGCATCTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033411024_1033411034 11 Left 1033411024 7:141117948-141117970 CCTGAACTTGGAGACTTTTTGGG 0: 1
1: 0
2: 1
3: 18
4: 287
Right 1033411034 7:141117982-141118004 CCATTCTATGGCATCTGTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033411034 Original CRISPR CCATTCTATGGCATCTGTGG TGG Intronic
900291886 1:1927178-1927200 CCCTTCTCTGGCTCCTGTGGGGG + Intronic
902146347 1:14403718-14403740 CCATTTCACAGCATCTGTGGAGG + Intergenic
902300876 1:15502035-15502057 CCATACAAAAGCATCTGTGGTGG - Intronic
903235610 1:21948829-21948851 CCCTTCTATTCCATCTCTGGAGG - Intergenic
905268940 1:36774005-36774027 CCATTCAGTGCCAGCTGTGGCGG - Intergenic
905520831 1:38598246-38598268 CCATTCTATAGAATGTGTAGTGG - Intergenic
906154306 1:43605181-43605203 CCATTGTACAGAATCTGTGGGGG - Exonic
911127805 1:94357017-94357039 CCATCCCTTGGTATCTGTGGTGG - Intergenic
912127626 1:106559327-106559349 CCATTCTTTTGCATTTGTTGAGG + Intergenic
912403221 1:109413847-109413869 CCATTCTCTGGCTACTGTGTTGG + Intronic
912563771 1:110570293-110570315 CCCTTCTGTGCCATCTCTGGGGG - Intergenic
914975496 1:152357122-152357144 CCCTTCTAGGGAATCTGGGGAGG - Exonic
916291996 1:163177162-163177184 CCTTTCTATGGAATGGGTGGGGG - Intronic
916625899 1:166554218-166554240 GTATTCTATGGAATCTGGGGAGG + Intergenic
917051534 1:170930230-170930252 CCCTTCTTTGGAAACTGTGGAGG + Intergenic
917714453 1:177720299-177720321 CCATTCTTTTGCATTTGTTGAGG + Intergenic
918160287 1:181892132-181892154 CCATTCTTTTGCATTTGCGGAGG - Intergenic
922998245 1:229984033-229984055 TCATCCTTTGGTATCTGTGGGGG - Intergenic
1064144454 10:12816360-12816382 CCATTTAATGCCATCTGGGGGGG + Intronic
1064347907 10:14549186-14549208 CCAGTCTGTGGCATCTGTTATGG + Intronic
1067822344 10:49540989-49541011 CCAGTCTATGGCATTTGTTATGG - Intergenic
1068021450 10:51590404-51590426 CCATTGTATGCCATCTATTGTGG + Intronic
1070271008 10:74954983-74955005 TCATCCTTTGGCATCTGTGGGGG + Intronic
1070813697 10:79310915-79310937 CCAGCGTGTGGCATCTGTGGAGG - Exonic
1074499928 10:114013983-114014005 CCATTCTACGTCATCTTAGGAGG + Intergenic
1077427998 11:2495718-2495740 CCATTCTTTGGCATTTGCTGAGG + Intronic
1078136728 11:8657965-8657987 CCATCCTCTGGGACCTGTGGTGG - Intronic
1080886784 11:36375331-36375353 TCATTCTAGGGCTTCTGTTGAGG + Intronic
1083186373 11:61020099-61020121 CCTATCTCTGGGATCTGTGGTGG - Exonic
1085089224 11:73695700-73695722 ACATTCTAGGGCATCTTTGCTGG + Intronic
1088534675 11:110847695-110847717 CCATTCTTTGGCATTTGCTGAGG + Intergenic
1093544776 12:20334012-20334034 CCATTCTTTTGCATTTGTTGAGG + Intergenic
1094289507 12:28831215-28831237 CCATCCTTTGGTATCTGTGGGGG - Intergenic
1095772183 12:45972123-45972145 CCAGTCTGTGACATGTGTGGAGG - Intronic
1096757746 12:53814219-53814241 CCATTCTGTGACATCTTTGCTGG + Intergenic
1098749899 12:74280018-74280040 CCATTCTATGACATCCCTGTAGG + Intergenic
1100090334 12:90960712-90960734 TTATTCTATGACATTTGTGGGGG + Intergenic
1100238944 12:92690482-92690504 TAATTCTCTGACATCTGTGGGGG + Intergenic
1100937043 12:99680971-99680993 ACTTGCTATGGCTTCTGTGGGGG - Intronic
1102323712 12:111960110-111960132 CCGTTCTTTTGCATTTGTGGAGG - Intronic
1104189718 12:126468284-126468306 CCTTTCTCTGGCATCTTTGTGGG - Intergenic
1107024747 13:35788572-35788594 CTATTCTATGGCATATGAAGAGG - Intronic
1110497771 13:76189757-76189779 CCATTCTAGGCCAGGTGTGGTGG + Intergenic
1111968607 13:94886501-94886523 CCATTCTATGGGATTGGTAGAGG - Intergenic
1112034615 13:95485564-95485586 CCATTCTAGGGAATCTGGAGTGG - Intronic
1114937431 14:27558978-27559000 CCATTATAAGTCAGCTGTGGAGG - Intergenic
1115642983 14:35347196-35347218 GCTTTCTATGGCTTCTGCGGAGG - Intergenic
1117172680 14:53116483-53116505 CCATTCTTTTGCATTTGTTGAGG - Intronic
1117226178 14:53662280-53662302 CCATTCTATTGGATGTGTAGTGG - Intergenic
1121217419 14:92259370-92259392 CCATTCTAAGGACTCAGTGGGGG - Intergenic
1121516610 14:94556396-94556418 CCTTGCTATGGCTGCTGTGGGGG + Intergenic
1122039705 14:98976501-98976523 TCATTCCTTGGTATCTGTGGGGG + Intergenic
1124058927 15:26269540-26269562 ACATTATATGGCAGCGGTGGTGG + Intergenic
1125172192 15:36778226-36778248 CCAATCTGAGGCATCTGTGGGGG - Intronic
1133575025 16:7080714-7080736 CTATTCAATGTCATCTGTGATGG - Intronic
1135040035 16:19111282-19111304 CCAATCTATGGTATTTGTAGAGG - Intergenic
1137376072 16:47952942-47952964 CCAGTCTATGGCATTTGTTATGG - Intergenic
1137935046 16:52626803-52626825 CCATTTTCTAGCTTCTGTGGGGG + Intergenic
1140565017 16:76031706-76031728 CCATTCTAGGCCAGGTGTGGTGG - Intergenic
1140962150 16:79926368-79926390 CAATTTTATGGTCTCTGTGGGGG + Intergenic
1141892636 16:86936846-86936868 CCATTACTTGGCTTCTGTGGTGG - Intergenic
1141999551 16:87656381-87656403 CCAGTCCATGGCATTTGTTGGGG + Intronic
1146237312 17:31179124-31179146 CCATTCTTTGGCATTTGCTGAGG - Intronic
1146966096 17:37031417-37031439 TCATCCCATGGTATCTGTGGAGG - Intronic
1147243424 17:39105551-39105573 CCTTACTAGGGCATCTTTGGAGG + Intronic
1148281029 17:46347233-46347255 TCATCCTTTGGTATCTGTGGGGG - Intronic
1148303257 17:46565168-46565190 TCATCCTTTGGTATCTGTGGGGG - Intronic
1151547821 17:74804098-74804120 TCAGTCTGTGGCATTTGTGGTGG + Intronic
1153326423 18:3825332-3825354 TCATCCTATGGTATCTGTGGGGG + Intronic
1153922867 18:9806599-9806621 CCATTCTGTGGCATCTTGGGTGG - Intronic
1155553962 18:26997389-26997411 TCTTTCTAAGCCATCTGTGGGGG + Intronic
1156188117 18:34687522-34687544 CCATTCTTTTGCATTTGTTGAGG + Intronic
1157066271 18:44354560-44354582 CCATTCTTTTGCATTTGTTGAGG + Intergenic
1157525799 18:48380554-48380576 CCATGCTCTGTCATCTGAGGGGG + Intronic
1158847326 18:61458373-61458395 CCATTCTTTGCCATATTTGGGGG + Intronic
1158986564 18:62823809-62823831 CCATTCTAGTGCATATGTAGTGG - Intronic
1160015229 18:75135147-75135169 CCACTCTGTGGCTGCTGTGGGGG - Intergenic
1162254670 19:9479913-9479935 TCATCCTTTGGAATCTGTGGGGG - Intronic
1164255958 19:23528477-23528499 CCACTCTAAGGCATTTGTGATGG + Intronic
1166150703 19:40873164-40873186 CTATTCTATTGCAACTGAGGTGG - Intronic
1168316084 19:55485346-55485368 CCGTTCTCTGGCATGTGGGGAGG + Intronic
925756667 2:7139385-7139407 CCATTCTGTCCCACCTGTGGAGG + Intergenic
928488552 2:31757182-31757204 CCATTCTTTTGCATTTGTTGAGG + Intergenic
929762034 2:44814818-44814840 CCATTCCATCCCATCTCTGGAGG + Intergenic
930923440 2:56786498-56786520 CCATTCTAGTACATATGTGGAGG + Intergenic
931774882 2:65531969-65531991 CCAGTCTATGGCATTTGTTATGG + Intergenic
934652421 2:96100140-96100162 CCATTGTGTGGCCTCTGTGTGGG + Intergenic
934698612 2:96420036-96420058 CCATTCTTTTGCATTTGTTGAGG + Intergenic
934702999 2:96457469-96457491 CCATTCTTTTGCATTTGTTGAGG - Intergenic
935496573 2:103789480-103789502 CCATTCTCTGTCTTCTGTGCAGG - Intergenic
938062933 2:128266606-128266628 CCATGGTGTGGCAACTGTGGTGG + Exonic
939267716 2:139895097-139895119 CCATACCCTGGTATCTGTGGGGG - Intergenic
939318777 2:140588051-140588073 CCATTCTTTGCCATCTGTTGTGG - Intronic
939495101 2:142918837-142918859 TCATCCCTTGGCATCTGTGGAGG + Intronic
941315862 2:163991596-163991618 TCATTCTATGGCATCTGTCAAGG - Intergenic
943292919 2:186098309-186098331 CCACTCTATGTCATCTGTGAGGG - Intergenic
1173812246 20:45963189-45963211 CAGTTTTATGGCGTCTGTGGTGG + Intronic
1181367564 22:22389962-22389984 CCACAATATTGCATCTGTGGAGG - Intergenic
1181565735 22:23736158-23736180 CAGTTCTAGGGCTTCTGTGGGGG - Intergenic
1182372819 22:29823901-29823923 CCATTCTAGGTCAGGTGTGGTGG + Intronic
1182615659 22:31587677-31587699 CCATCCTTTGGTATTTGTGGGGG - Intronic
1182722310 22:32413310-32413332 CCATTTCATTGAATCTGTGGTGG + Intergenic
1183929086 22:41225837-41225859 CCAGTCCAAGCCATCTGTGGAGG - Exonic
1203327552 22_KI270738v1_random:40907-40929 CCATTCTATTCCATCTGATGAGG - Intergenic
1203327560 22_KI270738v1_random:40998-41020 CCATTCTATTCCATCTGATGAGG - Intergenic
949385483 3:3497429-3497451 TCATCCTGTGGTATCTGTGGGGG + Intergenic
950555185 3:13691306-13691328 AAATTCTGTGGCATCTGAGGAGG + Intergenic
951433988 3:22640978-22641000 CCATTCTTTTGCATTTGTTGAGG + Intergenic
951795242 3:26531511-26531533 CCATTCTTTTGCATTTGTTGAGG + Intergenic
956246743 3:67192019-67192041 TCATTCCCTGGTATCTGTGGGGG - Intergenic
957992977 3:87651247-87651269 CCATTCTTTTGCATCTGCTGAGG + Intergenic
958260992 3:91381124-91381146 CCATTCTTTTGCATATGTTGAGG + Intergenic
959601532 3:108191581-108191603 CCATTCTGCAGCATCTGTTGTGG + Exonic
959748972 3:109810688-109810710 CCACTCTCTGGCTTCTGTGGAGG + Intergenic
960220612 3:115104152-115104174 CCATTCTATTACATGTGTGGTGG - Intronic
961077304 3:123993792-123993814 CCTTTCTGAGGCCTCTGTGGAGG + Intergenic
964305559 3:155335882-155335904 CCATTTTATAGCATGTATGGAGG + Intergenic
964782709 3:160358534-160358556 TCATTCTTTGGTATCTGTGGGGG + Intronic
968251634 3:197221830-197221852 TCATCCTTTGGTATCTGTGGGGG + Intronic
972652637 4:41033748-41033770 CCCTTTTATGTCATCTGTGGTGG - Intronic
974680635 4:65156964-65156986 GCATTTTTTGGTATCTGTGGGGG + Intergenic
976548943 4:86372143-86372165 CCATTCTTTTGCATTTGTTGAGG - Intronic
979022587 4:115522447-115522469 CCATTCTTTTGCATTTGTTGAGG + Intergenic
979457875 4:120946829-120946851 CCATTCTTTTGCATTTGTTGAGG - Intergenic
979983629 4:127288225-127288247 TCATTCTTTGGCACTTGTGGTGG - Intergenic
980986744 4:139702881-139702903 CCATTCTGTTGGATGTGTGGTGG + Intronic
981635918 4:146878871-146878893 CCATGCAGTGACATCTGTGGGGG + Intronic
985018789 4:185665599-185665621 CAATTCTATGCCATCTGTCAGGG - Intronic
985503789 5:266127-266149 CCATTACATGTCAGCTGTGGAGG - Intergenic
986322801 5:6647157-6647179 CCATTCTTTTGCATTTGTTGAGG + Intronic
986839548 5:11680336-11680358 CCATTCAATGCCAAATGTGGGGG - Intronic
987425868 5:17772312-17772334 CCACTCTGTGGTATCAGTGGAGG - Intergenic
987776551 5:22373563-22373585 CCAGTCTTTGGCACCAGTGGTGG - Intronic
988200836 5:28066589-28066611 CCAATCCATAGCATCTGTGCCGG + Intergenic
989364206 5:40637219-40637241 CCATTCTTTGGCATTTGCTGAGG - Intergenic
989990031 5:50752155-50752177 CTATTGTTTGGCATCTGTTGAGG + Intronic
990081753 5:51925128-51925150 CCACTCTATGGAAACTGTGCTGG - Intergenic
994378352 5:99040384-99040406 CCATTCTTTTGCATTTGTTGAGG - Intergenic
1000563770 5:162823074-162823096 CCTTTCTTTGGCTTCTGTTGGGG + Intergenic
1001316758 5:170648078-170648100 CCATTCTATGAGTTCTGTAGTGG - Intronic
1001675100 5:173505659-173505681 AAATACTATAGCATCTGTGGTGG + Intergenic
1003102609 6:3188510-3188532 CTTTTCTATGGGATCTGGGGAGG + Intergenic
1005265066 6:24103250-24103272 CAATTATATGGCATCGGTGTAGG + Intergenic
1005674448 6:28139494-28139516 CCATTCTAACGGATATGTGGTGG + Intergenic
1007098866 6:39231023-39231045 CCCTTCTCTGGCCTCTGTAGGGG + Intergenic
1008171219 6:48208757-48208779 CCATTCTATTGGATTTGTAGTGG + Intergenic
1008996305 6:57664260-57664282 CCTTTCTAGGGCATCTCTGAAGG + Intergenic
1009570448 6:65377134-65377156 CCATTCTTTTGCATTTGTTGAGG - Intronic
1010982294 6:82381971-82381993 CCATTCTCTAGCTTCTGAGGAGG - Intergenic
1011130260 6:84045174-84045196 TCATTCCTTAGCATCTGTGGGGG - Intronic
1011510018 6:88089926-88089948 CCATTGGTTGGTATCTGTGGTGG - Intergenic
1011777218 6:90745060-90745082 ACATCCTATGGCATCTGCTGAGG + Intergenic
1012498179 6:99857960-99857982 CCATTCTTTTGCATTTGTTGAGG - Intergenic
1013591169 6:111620553-111620575 CCTTTCTAAGGCATCTTGGGAGG + Intergenic
1015564122 6:134548808-134548830 CCAGTGTATGGCATATGTGATGG + Intergenic
1020630060 7:10628446-10628468 CCATTCTTTTGCATTTGTTGAGG - Intergenic
1020926807 7:14338531-14338553 CAACTCTTTGGCATCTGTGACGG + Exonic
1021893934 7:25215461-25215483 CCAGTCTATGGTATTTGTTGTGG + Intergenic
1023083042 7:36543864-36543886 ACCTTCTATGGCATCTGGGAGGG - Intronic
1023921090 7:44630562-44630584 TCATTCCTTGGTATCTGTGGGGG + Intronic
1030511354 7:110486245-110486267 TCATTCTAAGGCAGCTGTGTAGG + Intergenic
1031233936 7:119147507-119147529 TCATTTTATGCCATGTGTGGTGG + Intergenic
1033411034 7:141117982-141118004 CCATTCTATGGCATCTGTGGTGG + Intronic
1035469183 7:159098718-159098740 CAAGTCTGTGGCTTCTGTGGAGG + Intronic
1037013318 8:13872232-13872254 CCATTTTATGCAATCTGTAGAGG - Intergenic
1039802045 8:40966589-40966611 CCATTCTATTGCATTTGCTGAGG - Intergenic
1041160575 8:55038927-55038949 CCACTCTATGGCATATCTTGGGG - Intergenic
1044020187 8:87096156-87096178 CCAGTCTATGGTATTTGTTGTGG - Intronic
1044337804 8:91008173-91008195 ACATTTTATAGCATCTGTGTTGG - Intronic
1045605974 8:103776381-103776403 CCATTCTTTGGCATTTGAGATGG + Intronic
1046487807 8:114909474-114909496 CTCTTCCATGGCAACTGTGGTGG + Intergenic
1047788722 8:128180416-128180438 TTATTCCATGGCATCTGAGGAGG + Intergenic
1047813155 8:128432445-128432467 CCTTTCTAATGCATCTGGGGAGG - Intergenic
1048783271 8:138024083-138024105 CCATTCCATGGCATCGGATGTGG - Intergenic
1050205882 9:3195579-3195601 CCATTATATAGTGTCTGTGGAGG - Intergenic
1050242401 9:3650886-3650908 CCATTCTTTGGCATATGTGAAGG - Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1050612039 9:7362872-7362894 GCATTTTATGGCATGTTTGGAGG - Intergenic
1051457508 9:17276634-17276656 TCATTCCTTGGTATCTGTGGGGG + Intronic
1051457546 9:17277230-17277252 TCATTCCTTGGTATCTGTGGGGG + Intronic
1052717209 9:32131275-32131297 CCATTCTTTTGCATTTGTTGAGG - Intergenic
1054719494 9:68590560-68590582 CCATTCTTTTGCATTTGTTGAGG + Intergenic
1056467591 9:86873203-86873225 CCATGCTATAGCATTTGTGGAGG - Intergenic
1058474740 9:105320774-105320796 CCATTCTAGTGAATCTGTAGTGG + Intronic
1060304206 9:122395701-122395723 CCATCCTTTGGTATTTGTGGGGG + Exonic
1185483310 X:464268-464290 CCATTCTCTTGCCTCAGTGGAGG + Intergenic
1186744012 X:12547179-12547201 CCATTCTGTGGCATCGTTGCAGG - Intronic
1189328891 X:40130746-40130768 CAATTCACTGGCATTTGTGGAGG - Intronic
1192966274 X:76180668-76180690 CCATTCTTTTGCATTTGTTGAGG + Intergenic
1193883807 X:86960356-86960378 CAATGCTCTGGCTTCTGTGGTGG + Intergenic
1195897450 X:109761079-109761101 CCATTCTATCCCATCTAAGGTGG + Intergenic
1201789927 Y:17827987-17828009 GCATTCTTTGGCATTTGTTGAGG - Intergenic
1201811627 Y:18078002-18078024 GCATTCTTTGGCATTTGTTGAGG + Intergenic
1202351573 Y:23997738-23997760 GCATTCTTTGGCATTTGTTGAGG - Intergenic
1202519206 Y:25672381-25672403 GCATTCTTTGGCATTTGTTGAGG + Intergenic