ID: 1033412248

View in Genome Browser
Species Human (GRCh38)
Location 7:141128677-141128699
Sequence CCTCCCTACCACACTCATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033412248 Original CRISPR CCTCCCTACCACACTCATCG TGG (reversed) Intronic
900986594 1:6076735-6076757 CCTCCCTGTCACCCTCATCTGGG - Intronic
901792579 1:11662049-11662071 ACCCCCTACCATACTCATCCAGG - Exonic
901965648 1:12863750-12863772 CCTCCCTCCTACACTCATCAAGG - Intronic
901974029 1:12930242-12930264 CCTCCCTCCCATGCTCATCAGGG - Intronic
901981045 1:13034128-13034150 CCTCCCTCCTACACTCATCAAGG - Intronic
902001042 1:13194802-13194824 CCTCCCTCCTACACTCATCAAGG + Intergenic
902011151 1:13271526-13271548 CCTCCCTCCCATGCTCATCAGGG + Intergenic
902020272 1:13340506-13340528 CCTCCCTCCTACACTCATCAAGG + Intergenic
902208437 1:14887024-14887046 CCTCACAACCACACTCGTGGGGG - Intronic
906609451 1:47191574-47191596 CCTCCCTCCCACACCCAACTTGG + Intergenic
907574560 1:55514420-55514442 TCTCCCTCTCACACTCATGGCGG - Intergenic
911179335 1:94847351-94847373 CCTCCCTGCCACCCTCCTCAAGG - Intronic
911238743 1:95441051-95441073 CCTCCCTGCAACTCTCATCAGGG - Intergenic
912435536 1:109658551-109658573 CCTCCCAACCACCCTCCTCTGGG - Intronic
915364994 1:155309961-155309983 CACCCCAACCACACTCACCGAGG - Exonic
915552968 1:156645965-156645987 GCTCCCTACCACACCCATGTGGG - Intronic
916925690 1:169518334-169518356 CCTCACTACCACAAACATGGAGG - Intronic
920103998 1:203537591-203537613 CCTGCCTGCCACACTTATTGAGG - Intergenic
1062918892 10:1265209-1265231 CCTGCCTTCCCCACTTATCGGGG + Intronic
1067541744 10:47159952-47159974 CCTTCCAACCTCACTCATAGAGG - Intergenic
1070287180 10:75092653-75092675 CCTGCCTGCCACACTCACCCAGG - Intergenic
1071410353 10:85385815-85385837 CTTCCCTAACTCACTCTTCGAGG + Intergenic
1081533024 11:43977178-43977200 TCTACCTACCACACTCAGAGAGG - Intergenic
1083626276 11:64073715-64073737 CCTCCCAAACACACTCCTTGGGG + Intronic
1083636477 11:64123523-64123545 CCCCCCCACCCCACCCATCGAGG - Intronic
1083890385 11:65592892-65592914 CCTCCCGCCCACCCTCACCGCGG + Exonic
1090518429 11:127452902-127452924 CCTCCCTACCAGTCTCAGCATGG + Intergenic
1091630222 12:2154412-2154434 GCTCCCTGCCCCACTCATCGTGG + Intronic
1101540380 12:105659597-105659619 CCTCCCTACCACAATGATGGGGG - Intergenic
1103918745 12:124388859-124388881 CCTCCCTCCCTCCCTCACCGTGG - Intronic
1103983701 12:124753450-124753472 CCTGCCTCCGACACTCCTCGTGG - Intergenic
1106243002 13:27925086-27925108 GCTCCCTAACACACACAGCGGGG + Exonic
1106683319 13:32030978-32031000 CCTGCCTTCCACACGCATGGTGG - Intergenic
1109575388 13:64249929-64249951 CCTCCCTACCTCACTTATAGGGG + Intergenic
1113926348 13:113943913-113943935 CCTCCTCCACACACTCATCGTGG + Intergenic
1115454909 14:33591035-33591057 CCTTCCTACCACACACGTTGTGG + Intronic
1118220783 14:63853184-63853206 CCTCCCTCCCACTCTCTCCGGGG - Intronic
1118986618 14:70761067-70761089 CGTCCCTGCCGCACTCATCTTGG + Exonic
1124611721 15:31214253-31214275 CCTTCTTACCACCCTCATCCAGG - Intergenic
1126533767 15:49738287-49738309 CCTCCCTAACACACTCCATGAGG + Intergenic
1136280033 16:29203034-29203056 CCTCCCTACCACACACGAGGAGG - Intergenic
1139494121 16:67303506-67303528 ACTCCCTACCACACTCCTTAGGG - Intronic
1141882960 16:86872058-86872080 CCTCCCTCCCTCACTCATCTTGG + Intergenic
1142084396 16:88168973-88168995 CCTCCCTACCACACACGAGGAGG - Intergenic
1142413465 16:89927994-89928016 CCTCCCTAACACTCTCTTTGAGG - Intronic
1142982846 17:3681361-3681383 CCGCCCTCCCACAGTCATCAGGG + Intronic
1142986303 17:3697110-3697132 CCTCCCTCCCACACTCAGGGCGG + Intergenic
1144374684 17:14627404-14627426 ACTCCCTGCCACACCCATCTTGG - Intergenic
1148907403 17:50920010-50920032 CCTCCCTCCCACAAGCACCGTGG - Intergenic
1152580650 17:81164284-81164306 CCTCCCTAACCCTCTCATGGGGG + Intronic
1152635284 17:81428324-81428346 CCTCCCTCCCACAGACATCCTGG - Intronic
1152906338 17:82972643-82972665 CCACCACACCACACTCATAGGGG + Intronic
1153905657 18:9659264-9659286 CCTCCCCACCCCTCTCATCTTGG + Intergenic
1157316139 18:46591714-46591736 CCTCCCCACCACACCAATCATGG + Intronic
1161866652 19:6837286-6837308 CCTCCCTACCATACCCATGTAGG - Intronic
1163063543 19:14776688-14776710 CCTCGCTACCACCCCCAGCGGGG + Intronic
1164574647 19:29398607-29398629 CCTCCCACCCACACTCACCTGGG + Intergenic
1164679445 19:30123990-30124012 CCTCCCCACCACACTTACTGTGG - Intergenic
1167534981 19:50044230-50044252 CCTCCCTACCTCCCTCAACTTGG - Intronic
1168265342 19:55220458-55220480 CCTCCCTACCATGCTCATCAGGG + Intergenic
925418714 2:3692910-3692932 CCTCTCAACCACACTCACCCAGG + Intronic
926105291 2:10146052-10146074 CCTCCTTCTCACACTCATCCTGG + Intronic
926157719 2:10466855-10466877 CCTCCCTACCCCATTCCTCCAGG + Intergenic
930257916 2:49112994-49113016 TTTCCCTTCCACACTCATGGAGG - Intronic
931105613 2:59052069-59052091 CCTGCCTTCCAGACTCATTGGGG + Intergenic
946354972 2:219178661-219178683 CCTCCCTCCCCCGCTCATCCCGG - Intronic
947745725 2:232506440-232506462 CCTCCCCACCACCTTCATCTGGG - Intergenic
948725375 2:239930794-239930816 CCTCCCTGCCACACCCCTCCTGG - Intronic
948725407 2:239930880-239930902 CCTCCCTGCCACACCCCTCCTGG - Intronic
948725439 2:239930966-239930988 CCTCCCTGCCACACCCCTCCTGG - Intronic
1168946739 20:1767209-1767231 CGTCCCTGCCACCCCCATCGCGG - Intergenic
1173294734 20:41747032-41747054 CCTCCCAGCCACCCTCATCAAGG - Intergenic
1176142271 20:63549982-63550004 CCTGCCGACCACACTCACCCTGG - Intronic
1176685555 21:9845658-9845680 CATCCCTAGCACACTCAATGGGG + Intergenic
1178723193 21:35028229-35028251 CCTCTCTGCCTCACTCATCATGG + Intronic
1178850509 21:36208811-36208833 CCTCCCTGCCTCAGTCTTCGTGG + Exonic
1179080982 21:38170480-38170502 CCTCCCAACCACACAAAACGAGG - Intronic
1182753396 22:32659321-32659343 TCTCCCCAGCACACTCTTCGTGG - Intronic
1185148186 22:49150451-49150473 CCTCCCTGCCCCACTCAGGGAGG + Intergenic
962012223 3:131402771-131402793 CTTCCCTACCACTCTTATGGGGG - Intergenic
965940152 3:174169538-174169560 CCTTCCTACCACATTAATTGTGG - Intronic
966420495 3:179729770-179729792 CCTCTGTACCACTGTCATCGAGG + Intronic
968903871 4:3443039-3443061 CCTCCCCACAGCACTCACCGAGG + Exonic
970332431 4:15001444-15001466 CCTCCCCACCACATTCATTCCGG - Intergenic
971662659 4:29439965-29439987 CCTCCCTCCCACACGCCTCCAGG - Intergenic
977678954 4:99777818-99777840 CCTCCCTAACTCATTCATTGAGG + Intergenic
980349006 4:131664137-131664159 CATCCCTAGCACACTCAATGGGG + Intergenic
985241795 4:187937995-187938017 CCTCCCTACCGCAGTCCTAGAGG - Intergenic
991146849 5:63317062-63317084 CCTCTCTACTACTCTCATCCTGG - Intergenic
997183914 5:131861959-131861981 CCTCCCTAACTCACTCTTTGCGG - Intronic
1001024390 5:168211281-168211303 CCTCCCTCCCACACTCAGAGGGG + Intronic
1002618568 5:180470381-180470403 CCTCCCCACCCCACACATCCTGG + Intergenic
1003399969 6:5783064-5783086 CCTCCCTGCCTCACGCCTCGGGG + Intergenic
1005097087 6:22128820-22128842 CCTCCCTAACACATTCAATGAGG - Intergenic
1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG + Intronic
1006365746 6:33614132-33614154 CCTCCCTATCACAGTCAGAGAGG + Intergenic
1006447237 6:34086511-34086533 CCTTCCTGCCACACTCAGAGAGG + Intronic
1006861520 6:37174441-37174463 CCCCCCTACCTGACCCATCGCGG - Exonic
1007075766 6:39065235-39065257 CCTCCCTCCCACACTCCTTGGGG - Intronic
1007087376 6:39158455-39158477 CCTCCCTACCCCTGTCATGGGGG - Intergenic
1007424454 6:41737681-41737703 CCTCCCAACCCCAATCATGGTGG + Intronic
1018666505 6:166143298-166143320 GCTCCCGACCACACTAATCTGGG - Intergenic
1023294328 7:38699268-38699290 CCTCCCCATCACACTCAGCAGGG - Intergenic
1023837624 7:44077643-44077665 CCTCACTCCCACACTCACCACGG + Intronic
1031669215 7:124522150-124522172 CCTCCCTAACACACTCTATGAGG - Intergenic
1033099473 7:138458393-138458415 CTTCCCTACCACCATCATCTGGG + Intergenic
1033152910 7:138931959-138931981 CCTCCCCACCACACACCTCCAGG - Intronic
1033412248 7:141128677-141128699 CCTCCCTACCACACTCATCGTGG - Intronic
1037588202 8:20292632-20292654 CCTCCCTACCCCAATCAAAGGGG - Intronic
1037648284 8:20813678-20813700 CCTCCCTACCACATTCTACGGGG + Intergenic
1037780900 8:21868490-21868512 CCTCCATACCATACTCAGAGAGG + Intergenic
1039417663 8:37409483-37409505 CCTCCCAAACACCCTCATAGAGG - Intergenic
1040740812 8:50572119-50572141 CCTACCTAGCACAGTCACCGTGG - Intronic
1042206065 8:66331058-66331080 CCTCCTTACCACCCACAACGGGG + Intergenic
1049167516 8:141135924-141135946 CCTTTCTACCACACTGATCTGGG - Intronic
1053783759 9:41635943-41635965 CATCCCTAGCACACTCAATGGGG - Intergenic
1054171714 9:61846085-61846107 CATCCCTAGCACACTCAATGGGG - Intergenic
1054665821 9:67734727-67734749 CATCCCTAGCACACTCAATGGGG + Intergenic
1060747938 9:126149915-126149937 CCTCCATACCTCACTCCTCCTGG - Intergenic
1061806186 9:133138971-133138993 ACTCCCTCCCACACTCACTGTGG + Intronic
1189326132 X:40112233-40112255 CCTCCCCACCAGTCTCATCCAGG + Intronic
1191950300 X:66584002-66584024 CCTCCCTAACTCATTCATTGAGG + Intergenic
1192208500 X:69111520-69111542 CCTCCCTCCCTCATTCATAGGGG - Intergenic
1200409673 Y:2848915-2848937 CCTCCCAACCTCCCTCATCTGGG + Intronic