ID: 1033415161

View in Genome Browser
Species Human (GRCh38)
Location 7:141155466-141155488
Sequence GCTCTCAGCAGTTTAACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033415159_1033415161 -8 Left 1033415159 7:141155451-141155473 CCACCATGATTTCAAGCTCTCAG 0: 1
1: 0
2: 2
3: 32
4: 424
Right 1033415161 7:141155466-141155488 GCTCTCAGCAGTTTAACAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 105
1033415157_1033415161 9 Left 1033415157 7:141155434-141155456 CCATGGTCTAAATACACCCACCA 0: 1
1: 3
2: 55
3: 213
4: 465
Right 1033415161 7:141155466-141155488 GCTCTCAGCAGTTTAACAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 105
1033415155_1033415161 11 Left 1033415155 7:141155432-141155454 CCCCATGGTCTAAATACACCCAC 0: 1
1: 0
2: 1
3: 11
4: 130
Right 1033415161 7:141155466-141155488 GCTCTCAGCAGTTTAACAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 105
1033415156_1033415161 10 Left 1033415156 7:141155433-141155455 CCCATGGTCTAAATACACCCACC 0: 1
1: 0
2: 6
3: 45
4: 183
Right 1033415161 7:141155466-141155488 GCTCTCAGCAGTTTAACAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 105
1033415158_1033415161 -7 Left 1033415158 7:141155450-141155472 CCCACCATGATTTCAAGCTCTCA 0: 1
1: 0
2: 2
3: 7
4: 149
Right 1033415161 7:141155466-141155488 GCTCTCAGCAGTTTAACAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 105
1033415152_1033415161 30 Left 1033415152 7:141155413-141155435 CCCTGATGGGGGCATAGCACCCC 0: 1
1: 0
2: 1
3: 16
4: 318
Right 1033415161 7:141155466-141155488 GCTCTCAGCAGTTTAACAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 105
1033415153_1033415161 29 Left 1033415153 7:141155414-141155436 CCTGATGGGGGCATAGCACCCCA 0: 1
1: 0
2: 2
3: 9
4: 170
Right 1033415161 7:141155466-141155488 GCTCTCAGCAGTTTAACAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033415161 Original CRISPR GCTCTCAGCAGTTTAACAGC TGG Intronic
900181959 1:1315088-1315110 GCCCACAGCATTTTACCAGCTGG - Intronic
907400001 1:54219270-54219292 GCTCTCAGCAGTCCCTCAGCAGG - Intronic
910652440 1:89584015-89584037 GCCCTCTGCAGTCTCACAGCTGG + Exonic
911374565 1:97036276-97036298 GCTCTCAGCACTTTCAAAGTGGG + Intergenic
911446977 1:98007894-98007916 GCTCTCAGTAGTGTAACTGTAGG - Intergenic
919377663 1:196814954-196814976 GCTATCAGCCGTTTATCAGATGG + Intergenic
919387178 1:196936851-196936873 GCTATCAGCCGTTTATCAGATGG + Intronic
919572606 1:199267805-199267827 GCTTTGAGCAGTCTATCAGCTGG + Intergenic
921071504 1:211662260-211662282 GCTTTCAGGATTTTAACATCTGG + Intronic
922684927 1:227631760-227631782 GCGCCCAGAAGTTTAACAACTGG - Intronic
1064238757 10:13605285-13605307 TCTCTCAAAAGTTTAATAGCTGG + Intronic
1064643034 10:17433648-17433670 CCTCTCAGCACTTTAATAACTGG + Intronic
1071022935 10:81080832-81080854 GATCTCATCAGGCTAACAGCAGG - Intergenic
1073632152 10:105159868-105159890 ACTCTCATCAGATTGACAGCTGG + Intronic
1076097372 10:127742795-127742817 GCTCTCATCAGTTTAGCTTCTGG - Intergenic
1081413629 11:42787976-42787998 GCTTTCAGGAGTTGAACAACAGG + Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1087066170 11:94029943-94029965 CCTCTTAGCAGATTAAAAGCAGG + Intronic
1088651943 11:111965341-111965363 GATCTGAGCTGTTTAAGAGCAGG + Intronic
1089409299 11:118225845-118225867 GCTACCAACAGTTTAACAACTGG + Intergenic
1091861740 12:3791616-3791638 GCCCTATGCAGTTTAACAGCGGG + Intronic
1096485351 12:51976611-51976633 GCTTTCATCAGTTTCCCAGCAGG + Intronic
1106277767 13:28230002-28230024 GCTCTCAGCAGATTAGGAGGAGG - Intronic
1112322192 13:98417707-98417729 GCTGTCAGGAGTTTCACAGAGGG + Intronic
1114512906 14:23277109-23277131 GGTCTCAGTAGTTCACCAGCGGG - Exonic
1118379623 14:65207130-65207152 ACACTCAGAATTTTAACAGCAGG - Intergenic
1118490183 14:66251349-66251371 GCTCTCAGCACTTTTACAGGAGG - Intergenic
1122440230 14:101726779-101726801 GCTACCAGTGGTTTAACAGCAGG - Intergenic
1123825657 15:24079188-24079210 GCTCTCATGTGTTTAATAGCTGG + Intergenic
1125899901 15:43335976-43335998 ACTGTCAACAGTCTAACAGCTGG - Intronic
1127850063 15:62904518-62904540 GCTGGCAGCAGTGTGACAGCAGG - Intergenic
1130796031 15:87210408-87210430 GATCTCAACATTTTAAAAGCAGG + Intergenic
1133698054 16:8283719-8283741 ACTCTCTGCAGTTTTAAAGCAGG - Intergenic
1136281143 16:29212202-29212224 GCTCTCAGCAGTTTGATCGATGG - Intergenic
1137074315 16:35943584-35943606 TCTCACAGCAGTTTCACAGATGG + Intergenic
1140652326 16:77101981-77102003 TCTTTTAGCAGTTTAGCAGCTGG + Intergenic
1142085506 16:88178125-88178147 GCTCTCAGCAGTTTGATCGATGG - Intergenic
1145010298 17:19364159-19364181 GCTCCCAGTAGTTTAAGACCTGG + Intronic
1147799636 17:43074746-43074768 TCTCCCAGCTGTTTAAAAGCAGG + Intronic
1149163424 17:53722535-53722557 GCTCACAGCAGTTGAGCAGTTGG + Intergenic
1156887953 18:42157610-42157632 GCTCTCAGCAAGTTGCCAGCTGG - Intergenic
1159659025 18:71070543-71070565 GCTCTCAGCGGTCTAAAATCAGG - Intergenic
1161916191 19:7230149-7230171 GCTCTCAGCAGATGGACAGAAGG + Intronic
1162294947 19:9806939-9806961 GCTACCAACAGTTTAACAACTGG - Intergenic
1165915164 19:39254189-39254211 GCTCTCTGCAGGTGAACTGCAGG + Intergenic
1168275190 19:55274125-55274147 GCACACAGCAGTTTTTCAGCTGG - Intronic
1168379885 19:55911112-55911134 GCTCTCAGCATTGTAGCAGATGG + Intronic
926380340 2:12280807-12280829 GCTCTCTGCATTTTCTCAGCTGG - Intergenic
927171107 2:20370552-20370574 GCTACCAGCAGCTTAACAACTGG - Intergenic
927406835 2:22780335-22780357 GCTCTCAGCACTCTACCACCAGG + Intergenic
929708747 2:44244247-44244269 GCTCTCAGCAGGTTTACAGATGG - Intronic
930310627 2:49735050-49735072 GCTATCAACATTTTAACAACTGG - Intergenic
930916155 2:56690922-56690944 CCTCTCACCATGTTAACAGCTGG - Intergenic
933724949 2:85421335-85421357 GTTTTCAGCAGATAAACAGCCGG + Intronic
934749321 2:96782476-96782498 TCTTTCTTCAGTTTAACAGCGGG - Intronic
939136223 2:138297804-138297826 GCTCTCAGGAGATTAGCAACAGG - Intergenic
939160267 2:138579692-138579714 GTTTTCAGCAGTTTTACTGCAGG + Intergenic
942955341 2:181766494-181766516 TCTCTCAGCAGTATAGCAGAGGG + Intergenic
944499642 2:200345961-200345983 GTTGTCAGGGGTTTAACAGCTGG - Intronic
945179124 2:207074047-207074069 GGTGTCAGGAGTGTAACAGCGGG - Intergenic
946751988 2:222901588-222901610 GATCTCAGCTGTATAAAAGCTGG - Intronic
1168931580 20:1628798-1628820 GCTACCAGAAGTTTAACAACTGG - Intergenic
1169127388 20:3139603-3139625 GCTGTCAGGAGTTTAAGACCAGG - Intronic
1171139432 20:22728424-22728446 TCTCACAGCAGCTTCACAGCAGG - Intergenic
1171157523 20:22890007-22890029 GCTCTCAGAAGTTTTAATGCAGG - Intergenic
1172872104 20:38142295-38142317 GTTCTCAGCACTTGGACAGCAGG - Intronic
1174746057 20:53064544-53064566 GATTTCAGGAGTTTAAGAGCAGG + Intronic
1176022687 20:62970263-62970285 GCTCTCAGAGATTTTACAGCTGG - Intergenic
1179570581 21:42276333-42276355 AGCCTCAGCAGTTTAACAGGCGG + Intronic
1182684781 22:32113626-32113648 GCTCTCAGGACTTCAAAAGCTGG + Intergenic
1183065458 22:35359712-35359734 GTCCTCAGGAGTTTCACAGCTGG - Intergenic
1184207916 22:43016795-43016817 GCTCTCAGCACTTTCATATCTGG + Intergenic
954785512 3:53089635-53089657 GCTGTCAGCACTTTGGCAGCAGG - Exonic
955192845 3:56777852-56777874 GCTCTCAGCTGCTTTACATCTGG + Intronic
955892715 3:63666801-63666823 CCTCTCACCATTTTAACAGGAGG + Intronic
957397556 3:79661823-79661845 GCTGTCAGCTGGTTAACAGCAGG + Intronic
957410218 3:79830603-79830625 GCTCTCAGCAGGATGGCAGCTGG + Intergenic
957800992 3:85081342-85081364 GCTCTGAGCAGTTTTACATGAGG - Intronic
959065369 3:101651416-101651438 GCTGTTAGCATCTTAACAGCAGG - Exonic
963374307 3:144444164-144444186 GCTCTCAGCAGTTAGATAGGAGG + Intergenic
969236464 4:5868794-5868816 GTTCTCAGAAGCTTAACAACTGG + Intronic
972408649 4:38769597-38769619 GCTCTCAGCAACTTCACAGCTGG - Intergenic
984205482 4:176782931-176782953 GCTGTCAGCTGTTCAAGAGCTGG + Intronic
984520791 4:180798357-180798379 TCTCTCAGCAGATTCACTGCTGG + Intergenic
984586950 4:181575800-181575822 TCTCTCTGCAGTCTGACAGCAGG - Intergenic
990329948 5:54715527-54715549 GTTCTCAGCTCTTTATCAGCTGG + Intergenic
990350813 5:54914090-54914112 TCTCTCAGCAGTTCACCACCAGG + Intergenic
992422026 5:76615962-76615984 TCTCAAAGCAGTTAAACAGCAGG - Exonic
992434028 5:76738204-76738226 GCTCCCAACTGTTTAACAGTTGG + Intergenic
994782074 5:104103145-104103167 GCTCTAAGCACTTTACCTGCAGG + Intergenic
996545227 5:124670997-124671019 GCTATCAGCAGCTTAATAGCAGG - Intronic
997287122 5:132688067-132688089 GTCTTCAGCAGTTCAACAGCTGG - Intergenic
997384389 5:133461107-133461129 GCTCCCAGCAGTTTAGCATTAGG - Intronic
998572924 5:143280817-143280839 TCTCTCAGCTGTGTTACAGCTGG + Intronic
1000046933 5:157529791-157529813 GCTGGTAGCAGTTTACCAGCTGG - Intronic
1001554886 5:172630443-172630465 CCTATGAGGAGTTTAACAGCGGG + Intergenic
1003618045 6:7673079-7673101 GCCTTCAGCAGTGGAACAGCAGG + Intergenic
1011110393 6:83831339-83831361 GCTACCAGCGGTTTAACAGCAGG + Intergenic
1016718827 6:147268806-147268828 GTTTTCAGCAGTTAGACAGCAGG + Intronic
1029618177 7:101673035-101673057 GCTCTCAGCAGCTTACTAGCTGG + Intergenic
1033415161 7:141155466-141155488 GCTCTCAGCAGTTTAACAGCTGG + Intronic
1033836133 7:145314604-145314626 GATCTGAGCAGTTTAACACCTGG - Intergenic
1036175647 8:6535832-6535854 GCTCTCAGGAGTTTGAGACCAGG + Intronic
1038121796 8:24625310-24625332 TCTCTTTTCAGTTTAACAGCTGG + Intergenic
1045415540 8:101963063-101963085 GCTGCCAACAGTTTAATAGCTGG + Intronic
1046113230 8:109752031-109752053 GCTCCTAGCAGTATAACAGCAGG - Intergenic
1046346828 8:112940219-112940241 TATCTCAGCAGTGAAACAGCAGG - Intronic
1047028052 8:120846161-120846183 GCTCTCTGCAGTTTGGCAGATGG + Intergenic
1047136808 8:122088581-122088603 GGTCTCAGCATTTTAAAGGCTGG - Intergenic
1047957377 8:129985937-129985959 GGACTCAGTATTTTAACAGCTGG - Intronic
1048905030 8:139079433-139079455 GCTCTCTGCTGTTAAGCAGCAGG + Intergenic
1050182526 9:2935640-2935662 GCTCTCAGGAGTTTGAGACCAGG - Intergenic
1050789581 9:9449457-9449479 GATGTCACCTGTTTAACAGCAGG + Intronic
1187268354 X:17757704-17757726 GCTCTCAGAAGCTGAACAGGCGG + Intergenic
1187313875 X:18173608-18173630 GCCTTCAGCAGTTTAGCAGCGGG + Intronic
1187464974 X:19519064-19519086 GCTCTCAGCATTTACTCAGCAGG - Intergenic
1192548187 X:72030757-72030779 GCTACCAACAGTTTAACAACTGG + Intergenic