ID: 1033416693

View in Genome Browser
Species Human (GRCh38)
Location 7:141167836-141167858
Sequence CTGCTTCCCTGGGGCACAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033416693 Original CRISPR CTGCTTCCCTGGGGCACAAC GGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900810144 1:4795714-4795736 CAGCTTCCTTAGGGAACAACAGG + Intergenic
902043662 1:13510106-13510128 TTGCTTCTCTGGGGGACAAGGGG + Intronic
902406878 1:16189192-16189214 CTGCTTGGGTGGGGCACAGCGGG - Intergenic
902549698 1:17212052-17212074 CAGCTTCCCTGGGGCACACAGGG - Intronic
902583324 1:17423040-17423062 CTCCTTCCCTGGGGCAGCAGCGG + Intronic
903516885 1:23917082-23917104 CTGCTTCCCTGTGGCCTGACAGG - Intergenic
904120891 1:28197076-28197098 CCGCTTCCCTGGGGCCCCAGTGG - Intergenic
905308997 1:37036746-37036768 CTGCTTCCCTGGGGCGCCGAGGG - Intergenic
907103599 1:51859963-51859985 CTGCTTCCCTCAGCCATAACAGG + Intronic
907328893 1:53658743-53658765 CTGCATCCATGGTGCACAGCAGG + Intronic
908270568 1:62417881-62417903 CTGTTTCTCTGGAGAACAACTGG - Intergenic
909398402 1:75196360-75196382 CTGCTTCTTTGGGGGCCAACTGG + Intergenic
910469710 1:87539130-87539152 CTGCTTCCCAGGGCCACATCAGG + Intergenic
911194597 1:94980994-94981016 CAGCTTCCCTGGGCCCCCACAGG - Exonic
911511609 1:98813910-98813932 CATCTTCCCTGCTGCACAACTGG + Intergenic
913447294 1:118963378-118963400 CTGCTTACCTGGACCACCACAGG + Intronic
915725096 1:158011676-158011698 CTCCTTCCCTGGGCCACAGTGGG + Intronic
916219665 1:162431384-162431406 CTGCTCCCCTGGGGCTCAGTGGG - Intergenic
916771116 1:167909633-167909655 CGGCTTCCCTGGGGCACAATTGG - Intronic
918390498 1:184054842-184054864 CTGCTTCCCTCAGCCATAACAGG + Exonic
920126872 1:203700427-203700449 CTCCTTCCCTGGGGTTCAGCTGG + Intronic
920399502 1:205668328-205668350 CGCCTTCCCTGGAGCACAAACGG + Intronic
920866390 1:209757216-209757238 CTGCTTCCTTGGGGCAGACATGG - Intronic
1062772739 10:115963-115985 CTGCCTACCTTGGGCACAGCAGG + Intergenic
1062979798 10:1712637-1712659 CTCCTTCCCTGGGGGACAGAGGG - Intronic
1066244590 10:33570263-33570285 ATGTTTCCCTGGTGCACTACTGG + Intergenic
1066250619 10:33629391-33629413 TGGCTTCCCTGGGGCACATTGGG + Intergenic
1069009299 10:63353483-63353505 CTGCTTCCTTTGGGAACCACAGG + Intronic
1069807227 10:71133614-71133636 CTCCTTCCCTGAGCCACACCAGG + Intergenic
1070392799 10:75985745-75985767 GAGTTTCCCTGGGGCACATCAGG + Intronic
1071233071 10:83611712-83611734 CTCCTTCCCTGGGTCATAAATGG - Intergenic
1071284956 10:84136041-84136063 CTCCTCTCCTGGGCCACAACTGG + Intergenic
1073603619 10:104871084-104871106 CTGCTTCCCAGAGGAACCACGGG + Intronic
1074363516 10:112840555-112840577 CTGCTTCCCTAGCACTCAACAGG + Intergenic
1075733631 10:124651171-124651193 CTGTCTCCCTGTGGCACAAAGGG - Intronic
1076133671 10:128030214-128030236 CTGCTGCCCTGGCGAACAACGGG + Intronic
1076477509 10:130762736-130762758 CTGCTTCCCTGGGGCTCTTGGGG + Intergenic
1076802111 10:132835632-132835654 GTGCTTCCCTGGGGCCCAGGAGG - Intronic
1077080973 11:724625-724647 CAGCTTCCCAGGTGCACGACTGG - Intronic
1077262107 11:1628206-1628228 CTCCTTCCCTCGGGTACAAGAGG - Intergenic
1077407482 11:2389090-2389112 CTGCGTCCCTAGGACACAATTGG - Intronic
1078142759 11:8703755-8703777 CTGCTTCTCTGGGGCCCAGAAGG - Intronic
1078573029 11:12475771-12475793 TTGCTCCCCTGGATCACAACCGG + Intronic
1079116428 11:17643331-17643353 CTCCTGCCCTGGGGCATCACGGG + Intronic
1079258495 11:18853365-18853387 CTGCCTTCCTGGGGCTGAACAGG + Intergenic
1079272429 11:19000697-19000719 CTCCTTGCTTGGGGGACAACTGG + Intergenic
1081278606 11:41181409-41181431 CTGTTTCCCTGAGCCACCACTGG + Intronic
1081669399 11:44934758-44934780 CTGCCTCCCTGGGGCAGGACTGG + Exonic
1082660739 11:55907940-55907962 GTGCTTCCCTGGCGCACATTTGG + Intergenic
1083301083 11:61739908-61739930 GAGCTGCCCTGGGGCACACCAGG - Intronic
1083898174 11:65630699-65630721 CAGCTTCCCTTGGACAAAACAGG - Intronic
1084429052 11:69101320-69101342 CTCCTTCCCTGGTGCACACTGGG - Intergenic
1084944476 11:72631302-72631324 CTGCTTCCCATGGGCACCTCTGG + Intronic
1085059378 11:73430682-73430704 CTCCTTACCTGGAGCATAACTGG + Exonic
1085291655 11:75404698-75404720 ATGCTGCCCTGGGACCCAACTGG + Exonic
1087899621 11:103626150-103626172 CTGCTTACCTGGGGTAGAAGCGG + Intergenic
1088754301 11:112872906-112872928 CTCCTGGCCTTGGGCACAACTGG + Intergenic
1088821800 11:113463060-113463082 CTGCTTCCCTGTGAGAAAACGGG + Intronic
1089845499 11:121454875-121454897 GTGTTTCCCTGGGGCAGACCTGG + Intronic
1090259965 11:125312475-125312497 CTGCTCTCCTGGGGCACAGCAGG - Intronic
1090604401 11:128406544-128406566 CATCTTCCCTGGGGCAGAAGTGG - Intergenic
1090657120 11:128854558-128854580 CTGCTTTCTTGGGTGACAACAGG + Intronic
1091645191 12:2267804-2267826 TTCCTTCCCTGTGGCACATCTGG + Intronic
1091665435 12:2415402-2415424 TTGCTGCCATGGGGCACTACAGG - Intronic
1091767259 12:3129842-3129864 CTGCTTCCCCGAGGGACAGCTGG - Intronic
1091902600 12:4156615-4156637 ATGCTGCCCTGGGGCTCAAAAGG - Intergenic
1093184243 12:16001779-16001801 CTGCTTCCCTGAGTCAGAAGTGG + Intronic
1093533112 12:20190631-20190653 CTGCTTTCCTGGAGAGCAACTGG - Intergenic
1093757439 12:22868158-22868180 CTGCTTCCCTGAAGCTCACCTGG + Intergenic
1095524247 12:43106214-43106236 TTGCTTCCCTGGGCCACATAAGG - Intergenic
1097195066 12:57238601-57238623 CTGGTTCTCTGTGGCACAGCTGG + Intronic
1097536843 12:60882889-60882911 CTGCTTTCTTTGGGCACAATGGG + Intergenic
1098292182 12:68967228-68967250 CTGCTTCCCTGGGTGAGTACGGG + Intronic
1099480748 12:83162876-83162898 CTGCCTCCTTGGGGCTCCACTGG + Intergenic
1100613948 12:96216267-96216289 CTCCTTCCCTGGGGTACATTCGG - Intronic
1102862107 12:116344876-116344898 CTGCTTCCCTAGTGCTGAACTGG - Intergenic
1102939252 12:116924492-116924514 CTGGTTCTCTGTGGCACTACAGG - Intronic
1103917341 12:124382723-124382745 TTGCTTCCCTGGGATACAGCAGG + Intronic
1104643458 12:130481698-130481720 GTGTTTCCCTGGGGCCCATCTGG - Intronic
1105255873 13:18743867-18743889 CTCCTTACCTGGGGGACAGCAGG - Intergenic
1107601012 13:42012434-42012456 CTGCTTCCCTGAGGCCCAGAAGG + Intergenic
1107814236 13:44229842-44229864 CTTCGTCCCTGGGGCCCCACTGG + Intergenic
1108591476 13:51916647-51916669 CTGGTTCCCTGGGGCGCCATTGG + Intergenic
1111227060 13:85288320-85288342 CTGCTTCCCTGTGGCTCTGCAGG + Intergenic
1113593587 13:111517083-111517105 CTTCTTTCCTGGGGAGCAACAGG + Intergenic
1113784515 13:112995508-112995530 CTGCTCTCCTGGGGCAGAAGTGG - Intronic
1115037685 14:28879942-28879964 ATGCTTCCCTTGGGAACAATGGG + Intergenic
1115471498 14:33773114-33773136 CTCCTTCCCAGGGGCTCCACTGG - Intronic
1121429769 14:93878631-93878653 CTGGGTCCCTGGGGAAAAACAGG + Intergenic
1121442890 14:93959823-93959845 CTGCCTCCCTGGGGCTGACCTGG - Intronic
1121663203 14:95651189-95651211 CTTCCTCCCTGGGGCTTAACAGG + Intergenic
1122346785 14:101065844-101065866 CTGCTTCCCGGGGGCAGCGCTGG + Intergenic
1125414403 15:39437638-39437660 CTGATTCCCTTTGGCAGAACAGG + Intergenic
1126134757 15:45379036-45379058 CTGCCTCCCCGGGGAACAAATGG - Intronic
1126426182 15:48529213-48529235 CTGCTTCCTTGAGGCAGAAAAGG + Intronic
1127520532 15:59739127-59739149 CAGCTCCCCTGGGGCACTAAAGG - Intergenic
1127805121 15:62512089-62512111 CTGCTGTCCTGGGTCACAGCTGG + Intronic
1128323692 15:66709452-66709474 CTGCTTACCTGGGACTCAAAAGG - Intronic
1129274299 15:74434914-74434936 ATGGTTCCCTGGGGCACAAGTGG - Intergenic
1132886707 16:2185366-2185388 CTGCTTCCCTGGGGCAGGCTTGG + Exonic
1133419939 16:5637675-5637697 CTGCCTCCCTGGGGAACTACTGG - Intergenic
1134198048 16:12174187-12174209 ATGCTTCCCTGGTGCACTACTGG + Intronic
1135350839 16:21727761-21727783 CTGCATCCCTGGGGAAGATCAGG + Intronic
1136548382 16:30967994-30968016 CTGCTTCCCTGGAGACCCACTGG + Intronic
1137591679 16:49697639-49697661 GGGGCTCCCTGGGGCACAACAGG + Intronic
1140256956 16:73345871-73345893 CTGCTTCCCTAGGGCACAGATGG + Intergenic
1140350452 16:74257468-74257490 CTCTTTCCCTGAGGCAAAACAGG - Intergenic
1140979542 16:80093623-80093645 CTGCTTTCTTGGGGCAAACCTGG - Intergenic
1141177871 16:81732703-81732725 CTGCTTCTCTGGCTGACAACAGG + Intergenic
1141903492 16:87007707-87007729 CTGCTTCCCTGGGGCCCAACTGG + Intergenic
1142161628 16:88560776-88560798 TTGCGTCCATTGGGCACAACTGG - Intergenic
1142692184 17:1613306-1613328 CGGCTTCCCTGGAGCTCAGCTGG - Intronic
1143272890 17:5688901-5688923 CTTCCTCCCTAGGGCAGAACAGG - Intergenic
1144701468 17:17343634-17343656 CTGCCACCCTGGGGCAGAGCCGG - Intronic
1144719347 17:17457075-17457097 CTGCTTCCCTCAGCCATAACAGG + Intergenic
1147453405 17:40519990-40520012 CTGCTTCCCTGGGTCTCAGTTGG - Intergenic
1149550799 17:57537967-57537989 CTGCTTCCGTGGGCCACAGCAGG - Intronic
1149866243 17:60152540-60152562 CAGCCTCCCTGGGGCCCATCTGG - Intronic
1150296223 17:64008996-64009018 CTGCTTGGCTGGGACACACCGGG + Intronic
1150417169 17:64997006-64997028 TTGCTGCCCTGTGGCACAGCAGG - Intergenic
1150794492 17:68226916-68226938 TTGCTGCCCTGTGGCACAGCAGG + Intergenic
1151475248 17:74341512-74341534 CTGCTCCCCTGGGGCTGTACTGG + Intronic
1154501532 18:15000082-15000104 CGGCTTACCTGGGGCGCAGCGGG + Intergenic
1157729776 18:49993568-49993590 CAGCTTCCCTGGTGCAGAGCTGG - Intronic
1160196538 18:76759829-76759851 ATGCTTCCCTGGGGCCCAGCTGG - Intergenic
1160818987 19:1049395-1049417 CCGCCTTCCTGGGCCACAACGGG + Exonic
1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG + Intronic
1161680632 19:5678088-5678110 CTGCTTCCCTGCGGGACACAGGG - Intronic
1161686991 19:5707819-5707841 CTGACTCCCTGGGGGACAAAGGG + Exonic
1162573543 19:11485912-11485934 GAGATTCCCAGGGGCACAACTGG + Intronic
1162759202 19:12878572-12878594 CTGCTTGCCTGGAGGACAAGGGG + Exonic
1164662290 19:29986340-29986362 CTGTTTTACTGGGGGACAACTGG + Exonic
1165665169 19:37621901-37621923 ATCCTGCCCTGGGGCCCAACAGG + Intronic
1166409635 19:42547892-42547914 CCGCTTCCCAGGGGCTCAGCTGG + Intronic
1166888410 19:45974891-45974913 CACCTGCCCTGGGGCACAACTGG + Intergenic
1167586532 19:50378599-50378621 CTGCTGCCCTGCGGCCCCACAGG - Exonic
925814711 2:7736433-7736455 CTGCTTCCCTGGGGAAGGCCTGG - Intergenic
928196130 2:29218055-29218077 CAGCTTCCCTGGGGCTTAGCTGG - Intronic
929547677 2:42866385-42866407 CTGCTCCCATGGGGGAAAACAGG - Intergenic
932656877 2:73618161-73618183 CTGATTCCCTAGGGAACAATGGG + Intergenic
933833752 2:86230125-86230147 CTGCCTCCCTGGGGCATGGCAGG + Intronic
934523703 2:95035558-95035580 AGGCTTCCCTGGGGCTCAAGGGG + Intronic
938500714 2:131830264-131830286 CGGCTTACCTGGGGCGCAGCGGG + Intergenic
941714410 2:168748902-168748924 CTGCTTCCCTGGGGCACTGCAGG - Intronic
941868792 2:170362015-170362037 CTGCAACCCTGGGGCATTACAGG + Intronic
942812650 2:180017119-180017141 CTGCTTCCCAGGGGCCCAGGTGG - Intergenic
944046159 2:195414181-195414203 CTGCTTTTCTTGGGCACAAGGGG - Intergenic
945987814 2:216369744-216369766 CTGCTTCCAGGGGCCAGAACAGG - Exonic
946461236 2:219870690-219870712 CTGCATGCCAGGGGCACACCAGG - Intergenic
948445731 2:238031298-238031320 CTGCTCCCCTGGGGCTCAGATGG + Intronic
948942236 2:241202361-241202383 CCGCCTCCCTGGGGGCCAACAGG - Intronic
949009751 2:241671733-241671755 CTGGTTCACTTGGGCACCACTGG + Intronic
1170530716 20:17288242-17288264 CTGCTACCCTAGGGCACATGAGG + Intronic
1171312005 20:24152086-24152108 CTGTTTCCCAGGAGCACAATGGG + Intergenic
1172554913 20:35832429-35832451 CTGCTTCCCCAGGAGACAACAGG - Intronic
1173588389 20:44203333-44203355 CTGTTTCCCTGGGGCAGATCAGG + Intronic
1173596602 20:44262572-44262594 CTGCCTGCCTGGGGCACAAGGGG - Intronic
1173960956 20:47072172-47072194 CTCCTTCCCACAGGCACAACAGG + Exonic
1175056604 20:56204439-56204461 CTGCATCACTTGGGCACGACTGG + Intergenic
1175389700 20:58619213-58619235 CTGCTTCCCTGGGGGTCTGCTGG - Intergenic
1175507434 20:59495796-59495818 CTGCCCCCCTAGGGGACAACTGG + Intergenic
1175743641 20:61437832-61437854 CTGTTTTCCAGGGGCACATCTGG - Intronic
1176013563 20:62914650-62914672 CTGCCTCCCTGGGGCAAGCCTGG - Intronic
1176388625 21:6152067-6152089 CTGCCTGCCAGGGGCACAGCCGG - Intergenic
1178022910 21:28430356-28430378 CTGCCTGCCTGGGGCGGAACTGG - Intergenic
1179734847 21:43386181-43386203 CTGCCTGCCAGGGGCACAGCCGG + Intergenic
1180595489 22:16970236-16970258 CTGCCTCCCTGGGGCAGTCCTGG - Intronic
1182021051 22:27081818-27081840 CTGCCTCACTGGTGCTCAACTGG + Intergenic
1184403541 22:44287281-44287303 CTGCTTCCCTTGGGCTCCTCTGG + Intronic
1184596527 22:45517385-45517407 CTCCTCCCTTGGGGCACAATGGG + Intronic
1184835122 22:47016403-47016425 CAGCTTCCCTGGGCCACATGAGG - Intronic
1185008627 22:48300319-48300341 CTGCTTCCCTGGTGCCCCAGTGG - Intergenic
1185009364 22:48304700-48304722 CTGCTTCCCTGACACACAACAGG + Intergenic
1185107505 22:48882731-48882753 CGGCTTCCCTGGGACATGACGGG - Intergenic
950266280 3:11575506-11575528 CTCCTTTCCTTGGGCACAATCGG + Intronic
954114793 3:48460506-48460528 CTGCTCCGCTGTGGCACACCAGG - Exonic
955786253 3:62542572-62542594 CTGCTGCCCAGAGGCACAAATGG + Intronic
957602781 3:82359517-82359539 CTGGTACCCTGGGGGACTACTGG + Intergenic
962276564 3:134019029-134019051 CTGCTCCCCTTGGTCACAGCTGG + Intronic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
966848643 3:184150268-184150290 ATGCTGCCCTGGGACCCAACTGG + Intronic
968220255 3:196932456-196932478 CTGCTTCCCAGTGTCACCACTGG - Exonic
968292103 3:197546890-197546912 CTGATGCCCTGGGGCACCACAGG - Intronic
971303731 4:25462823-25462845 CTGCTAGCCCAGGGCACAACAGG - Intergenic
971454494 4:26831511-26831533 CTGCTGCCATGGGTCACATCTGG - Intergenic
971924463 4:32989523-32989545 CTGCTTCACTAGGTCAGAACTGG - Intergenic
974135302 4:57809275-57809297 CCACTTCCCTGTGGCTCAACAGG + Intergenic
977358835 4:95980054-95980076 CTGCTGCCCTGGGGGCCACCAGG + Intergenic
977429329 4:96911757-96911779 CTTCTTCACTGGGGCATAAAAGG + Intergenic
983253046 4:165366276-165366298 CTGTTTCCCTGGAGCCCACCTGG + Intronic
985012069 4:185593065-185593087 CTGCTCACCTGGAGCAGAACAGG - Intronic
985481070 5:111282-111304 CAGCTTCCCTGGGGCAGCTCTGG + Intergenic
985752146 5:1686788-1686810 CACCTTGGCTGGGGCACAACTGG - Intergenic
988497066 5:31754356-31754378 CTTCATGCCTGGGGCACAAAGGG - Intronic
990466847 5:56078875-56078897 CTGATTTCCTGGGGCACCTCAGG - Intergenic
991291130 5:65034984-65035006 CGGCAGCCCTGGGGCAGAACAGG - Intergenic
994005897 5:94836848-94836870 CTGCTTTCCTGGGACACATATGG - Intronic
997869772 5:137497588-137497610 CCACATCCCTGGGGCACACCTGG + Intronic
998353950 5:141518970-141518992 CTACTTCCCAGGGGCACAAGAGG + Intronic
998380182 5:141718897-141718919 CTGCTTCCTTGGAGCAGACCTGG + Intergenic
999798323 5:155008957-155008979 CTGCTTCCCTGGGGCCTAGATGG + Intergenic
1002270517 5:178068784-178068806 CGTCTTCCCTGGGGCACACATGG - Intergenic
1002451282 5:179320196-179320218 CTGCTGCCCAGGAGCACAGCAGG - Intronic
1002935192 6:1665710-1665732 CTGCCTCGATGGGCCACAACTGG + Intronic
1003580793 6:7338982-7339004 ATGCTGCCCTGGGACCCAACTGG - Intronic
1003747393 6:9017903-9017925 CAGTTTCCCTGGTGCTCAACGGG + Intergenic
1005957575 6:30675084-30675106 CTGTTTTCCTGGGTCACAACTGG + Intergenic
1006643433 6:35500152-35500174 CTACTCCCCTGGGGCACCCCAGG - Exonic
1015071971 6:129105259-129105281 TTGGTTCCCTGGGGCACTGCTGG - Intronic
1018065635 6:160123449-160123471 CTGCTTGCCTGGAGCAGAGCAGG + Intronic
1018378121 6:163232631-163232653 CCGCTTCCCTAAGGCACACCGGG + Intronic
1020434740 7:8150853-8150875 CTGCTTCCCAGGGGCACTTCTGG - Intronic
1021044787 7:15909169-15909191 CTTCTTTCCTAGGGCCCAACTGG + Intergenic
1022990840 7:35705559-35705581 CTTATTTCCTGGGGCACAGCTGG - Intergenic
1023598098 7:41853683-41853705 CTGCTTCCCTGGGACACCTGAGG + Intergenic
1030361989 7:108605035-108605057 CTTCATCCCTGGGTCACATCAGG - Intergenic
1031784531 7:126012868-126012890 ATGCTTCTCTGAGGCACCACTGG - Intergenic
1033414767 7:141152113-141152135 CTGCCTCCCTGGAGCACATGTGG + Intronic
1033416693 7:141167836-141167858 CTGCTTCCCTGGGGCACAACGGG - Intronic
1034207081 7:149326916-149326938 ATGCTCTCCTGGGGCTCAACTGG - Intergenic
1035284988 7:157800089-157800111 CTCCATCCCTGAGGCACCACAGG + Intronic
1036545765 8:9768214-9768236 CTGCTTCCCTGGGGCTGCACTGG - Intronic
1038220724 8:25604619-25604641 CTGCATACCTGGGGCCCATCAGG + Intergenic
1038645855 8:29361538-29361560 CTGCGTCTCTGGGGCAGGACTGG - Intergenic
1041124397 8:54621060-54621082 CTGATTCGCTTGGCCACAACAGG - Exonic
1041131067 8:54700993-54701015 CTGCCTCCCTGGGGAACTAGAGG + Intergenic
1042556177 8:70035234-70035256 CGGCTCCCCCGGGACACAACCGG + Intergenic
1042745749 8:72103819-72103841 TTGCTTCCCTGGTGGACAAATGG + Intronic
1047001560 8:120578281-120578303 CTGCCTGCCTCGGGAACAACAGG + Intronic
1047566106 8:126046378-126046400 CTGCTACCCTGGGGCGGAGCAGG - Intergenic
1048552840 8:135449483-135449505 CTGATTCCCTGGGTCATACCTGG + Intergenic
1048853723 8:138669036-138669058 CAGCTTCCCTGGGGCATTCCTGG - Intronic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1050625929 9:7503578-7503600 CTCCATCACTGGAGCACAACAGG - Intergenic
1056136823 9:83637923-83637945 CTGCCTCCCTGGGCCACAGGTGG + Intronic
1056693836 9:88829824-88829846 CTGTTTCCTTGGGGCAGCACAGG + Intergenic
1057528720 9:95825322-95825344 CTGCTTCCCTGGGGAAGCACAGG + Intergenic
1059294993 9:113262434-113262456 CCTCTGCCCTGAGGCACAACTGG - Exonic
1060894792 9:127210709-127210731 ATGCCACCCTGGGGCCCAACTGG + Intronic
1061191729 9:129086241-129086263 CTGCTATCCTGGGGAACAGCGGG - Exonic
1061506021 9:131032274-131032296 CCTCTCCCCTGGGGCACACCTGG - Intronic
1061861345 9:133470086-133470108 CTGCCACCCTGGGGCTCAGCTGG - Exonic
1061917611 9:133763411-133763433 CTCCTTGCCAGGGGCACACCCGG - Exonic
1061962150 9:133993647-133993669 CTGATTCACTGGGGGACACCAGG + Intergenic
1062498967 9:136844265-136844287 CGGCTTACCTGGGGCGCAGCGGG - Intronic
1062582647 9:137235303-137235325 CTGCTGCCCGGAGGCCCAACAGG + Intronic
1062629339 9:137456805-137456827 CTGTTTCCCTTGGGCAGAAGAGG + Intronic
1062694442 9:137866281-137866303 CTGCTTCCCTGGGGGACTAGAGG - Intronic
1188581357 X:31717905-31717927 CTGTTGCCCTGGGCCACAGCTGG - Intronic
1189873118 X:45404929-45404951 GTGCTTCCCTGGGGAACATGAGG - Intergenic
1193227038 X:78995899-78995921 CTTCTGCCCTGGGGCATCACAGG - Intergenic
1197551740 X:127900485-127900507 ATGCAGCCCTGGGGCATAACAGG - Intergenic