ID: 1033417285

View in Genome Browser
Species Human (GRCh38)
Location 7:141173835-141173857
Sequence GCCCCTATTAAGTCTATATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033417285_1033417289 11 Left 1033417285 7:141173835-141173857 CCATATATAGACTTAATAGGGGC 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1033417289 7:141173869-141173891 TTTGTGCCAACTCAAGCAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
1033417285_1033417287 9 Left 1033417285 7:141173835-141173857 CCATATATAGACTTAATAGGGGC 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1033417287 7:141173867-141173889 GTTTTGTGCCAACTCAAGCAAGG No data
1033417285_1033417288 10 Left 1033417285 7:141173835-141173857 CCATATATAGACTTAATAGGGGC 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1033417288 7:141173868-141173890 TTTTGTGCCAACTCAAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033417285 Original CRISPR GCCCCTATTAAGTCTATATA TGG (reversed) Intronic
909320096 1:74274475-74274497 GCCCCTACTTTGTCTATAAATGG + Intronic
917071774 1:171159370-171159392 TCCCCTTTTTAGACTATATAGGG - Intronic
918276404 1:182957393-182957415 GCCCTTATTAAGTCTTTAAGTGG - Intergenic
921586076 1:216947818-216947840 GCCACTCTTAAGCTTATATAAGG + Intronic
924232477 1:241973791-241973813 TCCCCTATTTAGACAATATAGGG + Intergenic
1064329207 10:14378020-14378042 TCCCCTTTTTAGACTATATAGGG - Intronic
1064994263 10:21282586-21282608 GTCCCTATTAATTCAATATATGG - Intergenic
1065029829 10:21574684-21574706 TCCCCTTTTTAGACTATATAGGG + Intronic
1065742766 10:28812136-28812158 TCCCCTTTTTAGACTATATAAGG - Intergenic
1069197862 10:65574868-65574890 GATACTATTGAGTCTATATAGGG + Intergenic
1071013486 10:80967004-80967026 TCCCCTTTTTAGACTATATAGGG - Intergenic
1071208861 10:83314877-83314899 GCCCCTATTTACTCTATAGTTGG - Intergenic
1071958255 10:90782428-90782450 GCCCCTAATAAGTATAAATGGGG + Intronic
1072942931 10:99783666-99783688 GCCCCTCTCACCTCTATATAAGG - Intronic
1073801918 10:107050764-107050786 GGCCTTCTTAAGTATATATATGG + Intronic
1074592783 10:114829293-114829315 TCCCCTTTTTAGACTATATAGGG + Intronic
1074592801 10:114829376-114829398 TCCCCTTTTTAGACTATATAAGG + Intronic
1081970370 11:47194262-47194284 TCCCCTTTTTAGACTATATAGGG - Intergenic
1086291264 11:85312293-85312315 GCCAATATTAAACCTATATAAGG + Intronic
1097845462 12:64361598-64361620 TCCCTTTTTAAGACTATATAGGG - Intronic
1097845642 12:64362850-64362872 TCCCCTTTTTAGACTATATAGGG + Intronic
1098569562 12:71973484-71973506 TCCCCTTTTTAGGCTATATAGGG - Intronic
1098627099 12:72684920-72684942 GCCCCTATTAACTCGATTTTAGG - Intergenic
1099304763 12:80939260-80939282 GGGTCTGTTAAGTCTATATATGG - Intronic
1101857350 12:108455035-108455057 TCCCCTTTTTAGACTATATAGGG - Intergenic
1104153050 12:126103644-126103666 GACTCTATTCAGTCTATATATGG + Intergenic
1107540886 13:41388100-41388122 TCCCCTTTTCAGACTATATAGGG + Intergenic
1114148021 14:20001051-20001073 GCCACTGTTAAATCTATAAACGG - Intergenic
1120913330 14:89687901-89687923 GCACCTATAAAGACTATATGTGG + Intergenic
1121149441 14:91618117-91618139 TCCCCTTTTTAGACTATATAGGG + Intronic
1128149419 15:65353774-65353796 TCCCCTCTTTAGGCTATATAGGG - Intronic
1128277427 15:66365389-66365411 TCCCCTTTTTAGACTATATAGGG - Intronic
1134594815 16:15487773-15487795 TCCACTTTTAAGACTATATAAGG + Intronic
1140518201 16:75559797-75559819 TCCCCTTTTTAGACTATATAGGG - Intergenic
1140930125 16:79619675-79619697 TCCCCAATTAAGTATATAAATGG + Intergenic
1146876359 17:36415447-36415469 TCCCCTTTTTAGACTATATAGGG + Intronic
1147063024 17:37897426-37897448 TCCCCTTTTTAGACTATATAGGG - Intergenic
1155733712 18:29194683-29194705 GCCCCTCTTCAGTCTTTTTATGG + Intergenic
1156888924 18:42167268-42167290 TCCACTTTTATGTCTATATATGG - Intergenic
1156907131 18:42367245-42367267 GCCCCTTTTATGTATATAGAGGG + Intergenic
1159638893 18:70840033-70840055 TCCCCTTTTAAGACCATATAGGG + Intergenic
1166459692 19:42975360-42975382 TCCCCTTTTTAGTCCATATAGGG + Intronic
1166900636 19:46058933-46058955 TCCCCTTTTTAGACTATATAGGG + Intronic
1168606980 19:57767974-57767996 TCCCCTTTTTAGACTATATAGGG + Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926342336 2:11914069-11914091 GACCTTATTAAGTTTATGTAAGG + Intergenic
927408755 2:22801122-22801144 TCCCCTTTTTAGACTATATAGGG + Intergenic
929550998 2:42891819-42891841 TCCCCTTTTAAGACTATATAGGG + Intergenic
935248088 2:101236752-101236774 TCCCCTTTTTAGACTATATAGGG - Intronic
940492833 2:154386611-154386633 ACCCCTATCAAGTCTAAATGAGG - Intronic
941286975 2:163626965-163626987 TCCCCTTTTTAGACTATATAGGG - Intronic
947133926 2:226957659-226957681 ACTTCTATCAAGTCTATATAAGG + Intronic
1169286344 20:4310557-4310579 TCCCCTTTTTAGACTATATAGGG + Intergenic
1169782045 20:9320245-9320267 TCCCCTTTTTAGACTATATAGGG + Intronic
1172960779 20:38797921-38797943 ACCCCATTTAAGTCAATATAAGG + Intergenic
1174102715 20:48139412-48139434 TCCCCTTTTTAGACTATATAGGG + Intergenic
950229744 3:11266173-11266195 CCCCCTTTTTAGACTATATAGGG - Intergenic
951224384 3:20104314-20104336 GCCCCTATTAATAATAAATAAGG + Intronic
951350378 3:21600111-21600133 TCCCCTATTTAGACCATATAGGG - Intronic
954554285 3:51505967-51505989 GCCCCTTTTGAATATATATAAGG + Intergenic
955381174 3:58439605-58439627 TCCCCTTTTTAGACTATATAGGG + Intergenic
956414886 3:69015067-69015089 TCCCCTTTTAAGACCATATAGGG - Intergenic
961510421 3:127398094-127398116 GCCCCTTTTTAGACCATATAGGG + Intergenic
961510971 3:127403285-127403307 GCCCCTTTTTAGGCCATATAAGG + Intergenic
971006708 4:22382488-22382510 TCCCCTTTTTAGACTATATAGGG - Intronic
973172515 4:47163302-47163324 GTACCTAATAAGGCTATATAAGG - Intronic
973996483 4:56464338-56464360 TTCCATATTAAGACTATATACGG - Intergenic
975412190 4:74066426-74066448 ACCCCTATTCAGACTATACAGGG + Intergenic
975509349 4:75176170-75176192 GCCTCTGTAAAGTCTTTATAAGG + Intergenic
980291490 4:130851623-130851645 GCCCATTTTAAATCTGTATAGGG - Intergenic
983401210 4:167268481-167268503 ACCCCTTTTTAGACTATATAGGG - Intergenic
987645163 5:20661256-20661278 GCCCATATTTATTTTATATATGG - Intergenic
988388505 5:30597710-30597732 TCCCCTTTTTAGACTATATAGGG - Intergenic
990340949 5:54822454-54822476 TCCCCTTTTTAGACTATATATGG - Intergenic
991083310 5:62624340-62624362 TCCCCTTTTTAGACTATATAGGG + Intronic
992223071 5:74591651-74591673 GCCCCTTTTTAGACCATATAGGG + Intergenic
994572749 5:101535201-101535223 CCCCCTATGATGTCTATACATGG - Intergenic
996334086 5:122364188-122364210 TCCCCTTTTCAGACTATATAGGG - Intronic
1002951365 6:1815489-1815511 TCCCCTTTTAATTCCATATAAGG - Intronic
1005449725 6:25961095-25961117 TCCCCTTTTTAGACTATATAGGG + Intergenic
1008969062 6:57345885-57345907 TCCCCTTTTTAGACTATATAGGG + Intronic
1009158043 6:60247700-60247722 TCCCCTTTTTAGACTATATAGGG + Intergenic
1014506046 6:122257977-122257999 GCTTCTATTAAGTCCAAATAAGG + Intergenic
1018078600 6:160239226-160239248 TCCCCTTTTCAGACTATATAGGG - Intronic
1018391982 6:163347564-163347586 GCGCTTAGTAAGTGTATATAAGG - Intergenic
1020417595 7:7963737-7963759 GCCCCTAATAAGGCTAAATGCGG - Intronic
1024641163 7:51329743-51329765 GCCCCTTTTTAGACCATATAGGG + Intergenic
1026694002 7:72574446-72574468 GTCCATATTAGGTATATATATGG - Intronic
1027856143 7:83514157-83514179 CCCCCTTTTTAGACTATATAGGG - Intronic
1029863553 7:103601684-103601706 GTCCCTTTCAAGACTATATAAGG + Intronic
1033417285 7:141173835-141173857 GCCCCTATTAAGTCTATATATGG - Intronic
1039421702 8:37449013-37449035 GCCCATTTTAAATCTATACATGG - Intergenic
1042773264 8:72401823-72401845 TCCCCTCTTCAGTCTATACAAGG - Intergenic
1043981154 8:86641201-86641223 TCCCCTTTTTAGACTATATAGGG - Intronic
1045364467 8:101462759-101462781 TCCCCTATTTAGACCATATAGGG + Intergenic
1050908737 9:11039194-11039216 TTCCCTATTTAGTCCATATAGGG - Intergenic
1051161736 9:14216357-14216379 GCCACTATTAAGTCTCTGTGTGG + Intronic
1056727926 9:89138387-89138409 TCCCCTTTTAAGACCATATAGGG + Intronic
1058355321 9:104077496-104077518 TCCCCTTTTAAGACCATATAGGG + Intergenic
1186187072 X:7031004-7031026 TCCCCTTTTTAGTCCATATAGGG + Intergenic
1187028002 X:15456093-15456115 GCTCCTAATAAGTCTATAGGTGG + Intronic
1187140252 X:16586412-16586434 TCCCCTTTTTAGACTATATAGGG - Intergenic
1187285520 X:17899814-17899836 GCCCCTTTGAACTCTAAATATGG - Intergenic
1194267107 X:91767822-91767844 TCCCCTTTTTAGACTATATAGGG + Intergenic
1196401745 X:115324047-115324069 TCCCCTTTTAAGACCATATAGGG + Intergenic
1197935803 X:131739290-131739312 GTCCATATTATGTATATATAGGG - Intergenic
1199313700 X:146351312-146351334 TCCCCTTTTAAGACTATATAGGG - Intergenic
1199545338 X:149002784-149002806 TCCCCTTTTAAGACCATATAGGG - Intergenic
1200584311 Y:4988761-4988783 TCCCCTTTTTAGACTATATAGGG + Intergenic