ID: 1033424436

View in Genome Browser
Species Human (GRCh38)
Location 7:141231157-141231179
Sequence CTGGAAATGCAGAGGCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 411}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033424436_1033424441 8 Left 1033424436 7:141231157-141231179 CCTGTTTGCCTCTGCATTTCCAG 0: 1
1: 0
2: 2
3: 39
4: 411
Right 1033424441 7:141231188-141231210 ACAGAGCTGGTGCATACAGAAGG No data
1033424436_1033424438 -5 Left 1033424436 7:141231157-141231179 CCTGTTTGCCTCTGCATTTCCAG 0: 1
1: 0
2: 2
3: 39
4: 411
Right 1033424438 7:141231175-141231197 TCCAGCGCCTAGAACAGAGCTGG 0: 1
1: 0
2: 4
3: 65
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033424436 Original CRISPR CTGGAAATGCAGAGGCAAAC AGG (reversed) Intronic
900039135 1:442078-442100 CTGGTGATGCCCAGGCAAACAGG + Intergenic
900060568 1:677054-677076 CTGGTGATGCCCAGGCAAACAGG + Intergenic
900323441 1:2095954-2095976 CTGGCACAGCAGAGTCAAACAGG - Intronic
900541326 1:3204477-3204499 CTGGAAGAGCAGAGGCCACCAGG + Intronic
904268741 1:29334371-29334393 CTGGAGCTGCAGAGGCTAAGTGG + Intergenic
904550101 1:31309197-31309219 CAGGAAATGGGGAGTCAAACTGG - Intronic
904909906 1:33927046-33927068 GTGGAAATGAAGATGCCAACAGG + Intronic
906875196 1:49529958-49529980 ATGGGAATGGAGAGGAAAACAGG + Intronic
908450814 1:64252602-64252624 CAGGAAAAGCAGAGGCAACTAGG + Intronic
908598179 1:65710847-65710869 CTGGTAATACCCAGGCAAACAGG - Intergenic
909344818 1:74572695-74572717 CAGGAGAGGCAGAGGCAAGCCGG - Exonic
909557509 1:76969888-76969910 CTGGTAATACCTAGGCAAACAGG + Intronic
909925347 1:81431595-81431617 CTGTAAACACAGAGACAAACTGG + Intronic
910043493 1:82883584-82883606 GTGGAAATGCAAAGGCAAAATGG + Intergenic
910112436 1:83696983-83697005 CTGGAAGTGGAGAGGTAACCTGG - Intergenic
911499741 1:98670418-98670440 CTGGAAATGCAGCTGCAGAAAGG + Intronic
911786923 1:101962794-101962816 AAGGAAAAGCAGAGACAAACAGG - Intronic
911982843 1:104587214-104587236 CTGGTAATACCCAGGCAAACAGG + Intergenic
912301302 1:108520045-108520067 CTGGTGATACAGAGGCAAACAGG - Intergenic
912636262 1:111296410-111296432 CTGGTAATACCCAGGCAAACAGG + Intronic
913021343 1:114791627-114791649 CTGGTGATACACAGGCAAACAGG - Intergenic
913113662 1:115677959-115677981 ATGGAATTTCAGAGGCAAAAAGG - Intronic
914423628 1:147553517-147553539 TTGGAGATGCAGAGGTGAACAGG - Intronic
914700876 1:150132369-150132391 CTGGAAATAATGAGGTAAACAGG - Intronic
914755001 1:150557505-150557527 CGGGAGATGCAGAGGAAAATGGG - Exonic
915061272 1:153188006-153188028 CTGGTAATACCCAGGCAAACAGG - Intergenic
915651633 1:157316097-157316119 CTGGTAATACCCAGGCAAACAGG + Intergenic
916032866 1:160893373-160893395 CTGGCAATACCTAGGCAAACAGG + Intergenic
916205568 1:162313150-162313172 CTTGGAATGCAAAGACAAACAGG + Intronic
917194438 1:172450585-172450607 CTGGCAATCCGGAGGCCAACTGG + Intronic
918077980 1:181184814-181184836 CTGGGAGTGCAGAGGCAATGCGG + Intergenic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
918631980 1:186729897-186729919 CTGGTAATACCCAGGCAAACAGG - Intergenic
919842569 1:201619826-201619848 CTGGAGAAGCAGAGGCAAGCTGG + Intergenic
921738197 1:218653073-218653095 CTGGTAATACCCAGGCAAACAGG - Intergenic
921976428 1:221207736-221207758 CTGGTGATACACAGGCAAACAGG + Intergenic
922486163 1:225974819-225974841 CTGGAAATTCAGAGAAAAAGTGG - Intergenic
923761639 1:236850938-236850960 CTGGAAAAGGAGAGACAGACGGG - Intronic
924249125 1:242113788-242113810 CTGGAAATGGAGATGCCATCAGG - Intronic
924814850 1:247432607-247432629 CTGGAGAGGCAGACACAAACAGG + Intronic
924834447 1:247635012-247635034 CTGGTAATACCCAGGCAAACAGG - Intergenic
1065075908 10:22079601-22079623 CTGGTGATGCCCAGGCAAACAGG - Intergenic
1066257551 10:33695591-33695613 CTGGTAATACACAGGCAAACAGG - Intergenic
1066698963 10:38106182-38106204 CTGGTGATACCGAGGCAAACAGG + Intronic
1067193419 10:44091747-44091769 CTGGTGATACCGAGGCAAACAGG + Intergenic
1068567695 10:58593579-58593601 CTGGTAATACCCAGGCAAACAGG + Intronic
1068623104 10:59208261-59208283 CTGGTAATACCCAGGCAAACAGG + Intronic
1068923509 10:62511057-62511079 CTGTGAATGCAGAGCCAAACCGG + Intronic
1068951666 10:62783145-62783167 CTGGTAATACCCAGGCAAACAGG + Intergenic
1069840848 10:71338366-71338388 CTGGAAATGCTGAGGGGAATGGG + Intronic
1071353558 10:84770280-84770302 CTAGAACTGCAGAGGTAAGCAGG + Intergenic
1072394259 10:95022777-95022799 CTGGTGATACCGAGGCAAACAGG - Intergenic
1072713249 10:97732001-97732023 GTGGAAATGCTGAGGAGAACAGG - Intergenic
1072930029 10:99654357-99654379 ATAGAAATACAGAAGCAAACTGG - Intergenic
1073789468 10:106925453-106925475 CTTGAAATACAGAGGCTAAGAGG + Intronic
1074705428 10:116125558-116125580 CTGCAAATGCAGAGAAAGACAGG + Intronic
1075267910 10:121020818-121020840 CTGGAAAGGCAAAGCCAAAGGGG + Intergenic
1075322414 10:121502678-121502700 CTGAAAATGTCAAGGCAAACAGG + Intronic
1075424752 10:122332804-122332826 CAGGAAAGGCCAAGGCAAACTGG + Intronic
1076056916 10:127383555-127383577 CTGGAAAGGCAGAGCCATACAGG + Intronic
1077713750 11:4560247-4560269 CTGGTAATACCCAGGCAAACAGG + Intergenic
1077786402 11:5389193-5389215 ATTGAAATACAGAGGAAAACTGG + Intronic
1078268962 11:9776952-9776974 CTGGAAAGGCAGAAGCTTACAGG + Intergenic
1078429865 11:11280585-11280607 CTGGAAATGCTGGGAAAAACTGG - Intronic
1078856013 11:15206892-15206914 CTGGAAAAGTAGAGACAAATGGG - Intronic
1079861667 11:25680039-25680061 CTGGGAATGAAAATGCAAACAGG + Intergenic
1079991221 11:27248959-27248981 CTGGAATTGCAGCTCCAAACTGG + Intergenic
1080341522 11:31271103-31271125 CTGAAAATGAAGAGGCAATTAGG - Intronic
1080602317 11:33831639-33831661 CTGGAAGAGCAGAGGAAATCAGG + Intergenic
1080686764 11:34522446-34522468 CAGGAAGGGCAGAGGCAACCAGG + Intergenic
1081625569 11:44653340-44653362 CTGGAAAAGCAGTGGCAAGGAGG - Intergenic
1081793777 11:45805869-45805891 CTGCAGAGGCAGAGGCCAACGGG + Exonic
1083160949 11:60853760-60853782 TTGGAAGTGCAGAGGCCACCGGG + Intronic
1085074346 11:73576601-73576623 CTGGAAATGAAGACGGAAATGGG + Intronic
1085226806 11:74929027-74929049 CTGGAAATACAAAGGCCAATAGG - Intronic
1086442146 11:86838817-86838839 CTGGTGATGCCCAGGCAAACAGG + Intronic
1086608541 11:88725724-88725746 CTGGTAATACCTAGGCAAACAGG + Intronic
1087004771 11:93458891-93458913 CTGGTGATACAAAGGCAAACAGG + Intergenic
1088325660 11:108598399-108598421 CTGGAAATGCAGAGGCACCAAGG + Intergenic
1088593434 11:111422474-111422496 CTGGAAATGCATGTGCACACAGG + Intronic
1091697931 12:2640562-2640584 CTGCAGATGCAGATGCCAACTGG - Intronic
1092259614 12:6946051-6946073 CTGGAAAGGCAGAGGGAATCAGG - Intergenic
1092332237 12:7595052-7595074 CTGGTGATGCCCAGGCAAACAGG + Intergenic
1092951178 12:13504985-13505007 ATGAGAATGCAGAGGTAAACAGG + Intergenic
1093626624 12:21356705-21356727 CAGGAGATGCAAAGACAAACAGG + Intronic
1095230278 12:39731452-39731474 CTGGTAATACTTAGGCAAACAGG - Intronic
1096056881 12:48660498-48660520 CTGGAAATGCAGTGGGCAGCAGG + Exonic
1096117487 12:49063667-49063689 CAAGAAAAGCAGAGGCAAACAGG + Intergenic
1096426244 12:51505909-51505931 CTGGAAATGCAAAGGAAAAGAGG + Exonic
1097139544 12:56888718-56888740 CTGGTGATACACAGGCAAACAGG + Intergenic
1098236723 12:68424744-68424766 AGGGAAATGCAGTGGGAAACTGG - Intergenic
1100129975 12:91480102-91480124 TTGGACACGCAGAGGGAAACAGG - Intergenic
1100540663 12:95554301-95554323 CTGGAAAGGCAGAGGGAGAGAGG + Intergenic
1100652303 12:96604254-96604276 CTGGTGATGCCCAGGCAAACAGG - Intronic
1101361892 12:104035003-104035025 CTGGTGATACCGAGGCAAACAGG + Intronic
1102473984 12:113176778-113176800 CTGGGAAAGCAGAGGCAGAGAGG - Intronic
1103798883 12:123524061-123524083 CTGGGGATGCCGAGGCAGACGGG + Intronic
1105705147 13:22963708-22963730 CTGGAAATGCAGGTGGAAACAGG + Intergenic
1105858060 13:24388724-24388746 CTGGAAATGCAGGTGGAAACAGG + Intergenic
1106033740 13:26025524-26025546 CTGGTGATGCAGAGGGAAGCAGG + Exonic
1106522543 13:30510509-30510531 CTTGAAAGGAATAGGCAAACTGG - Intronic
1106772019 13:32970939-32970961 CTGGGTATGCAAAGGCATACAGG - Intergenic
1108181140 13:47841149-47841171 CTGGAAATCCGGAGGCACCCTGG + Intergenic
1108797093 13:54044667-54044689 CTGGTGATACACAGGCAAACAGG + Intergenic
1109908140 13:68872923-68872945 CAGGAAATTCAGAGTCAAAGAGG - Intergenic
1112944785 13:104914954-104914976 TTGGAAATGCAGAGTCAAGTGGG - Intergenic
1112966927 13:105208792-105208814 CTCTAAAAACAGAGGCAAACAGG - Intergenic
1112986939 13:105462245-105462267 CTGAAATTGCAGAAGCAAAGTGG - Intergenic
1114641458 14:24224831-24224853 CAGGAAATACAGAGGAAAAGAGG + Intronic
1115347758 14:32361450-32361472 CTGGAAAGGAGGTGGCAAACAGG + Intronic
1117170111 14:53085485-53085507 CTGGTAATACCCAGGCAAACAGG + Intronic
1117892719 14:60443884-60443906 CTGGTGATACACAGGCAAACAGG + Intronic
1118088765 14:62448641-62448663 CTGGCAAAGCAGAAGCAAACAGG - Intergenic
1119093502 14:71806911-71806933 CTGGTGATACACAGGCAAACAGG - Intergenic
1119903540 14:78281908-78281930 CTGGGAATGCAGACACAAATAGG - Intronic
1120619834 14:86750278-86750300 CTGGTGATACACAGGCAAACAGG - Intergenic
1120715880 14:87840293-87840315 CTGTAACTGCAGAGGGAGACTGG - Intronic
1120882340 14:89423515-89423537 TTGGACATGCAGATGAAAACAGG + Intronic
1121665506 14:95668998-95669020 TTGGAAGTGCAGAGGCAGACAGG + Intergenic
1121815809 14:96927557-96927579 GTGGAGCTGCAGAGGCAGACAGG + Intronic
1122094556 14:99361670-99361692 CTGAAAAGCTAGAGGCAAACAGG - Intergenic
1122388994 14:101367678-101367700 GGGGAAGTGCAAAGGCAAACAGG + Intergenic
1122992039 14:105241058-105241080 CAGGACACGCAGAGGCCAACGGG + Intronic
1124666811 15:31599345-31599367 CTGGTAATACCCAGGCAAACAGG + Intronic
1125151381 15:36536359-36536381 TTGGAAATACAGAGGCACTCTGG - Intergenic
1125984817 15:44039511-44039533 CTGGTAATACTCAGGCAAACAGG + Intronic
1126711623 15:51463471-51463493 CTGGAAATGCAGAAGAATCCCGG + Exonic
1126773775 15:52082377-52082399 CTGGATATGCAGCGGCAGAAAGG - Intergenic
1127038334 15:54944908-54944930 CTGGTGATACCGAGGCAAACAGG + Intergenic
1127112804 15:55692570-55692592 CTGGACATGTTAAGGCAAACTGG + Intronic
1127401280 15:58588551-58588573 ATGGAAATGCAGAGTTACACGGG - Intergenic
1129495488 15:75976631-75976653 CTGGTGATACACAGGCAAACGGG - Intronic
1129507864 15:76098382-76098404 CTGGTGATGCCCAGGCAAACAGG - Intronic
1129563304 15:76593661-76593683 CTGGTGATACCGAGGCAAACAGG + Intronic
1129893884 15:79089923-79089945 CTGGAGATGCAGAGGAAGATGGG - Intronic
1131120252 15:89818100-89818122 CTGGAAGTGCCAAGTCAAACAGG - Intergenic
1131258803 15:90877960-90877982 TTTGAAAGGCAGAGGCAAACAGG + Intronic
1132206878 15:99992621-99992643 CTGGAGATGCAGGGACAGACAGG - Intronic
1132338248 15:101062557-101062579 CTGGTCCTGCAGAGGCAGACAGG - Exonic
1134029551 16:10980763-10980785 ATGAAAATGCAGGGGGAAACAGG - Intronic
1134645118 16:15858933-15858955 AGGGAAATGCCCAGGCAAACTGG + Intergenic
1134886113 16:17793214-17793236 ATGCAAAAGAAGAGGCAAACAGG + Intergenic
1135420169 16:22300460-22300482 CTGGCAGGGCAGAGGCCAACAGG + Intronic
1135515551 16:23130112-23130134 CCGGAAAGGCAGAGGAACACAGG - Intronic
1135528704 16:23233999-23234021 CTGGAAATGGATAGCCAGACTGG - Intergenic
1137969896 16:52974868-52974890 CTGGTAATACGCAGGCAAACAGG - Intergenic
1138176211 16:54900574-54900596 CTGAAATTGGAGAGACAAACAGG + Intergenic
1141772135 16:86095963-86095985 CTGGACATGCAGAGGCCACCAGG - Intergenic
1141873314 16:86804541-86804563 CTGGCAAGGCAGAGGCAAGGTGG + Intergenic
1142880213 17:2878083-2878105 CTGGAAATGCAGATGCGTAAAGG + Intronic
1143410588 17:6706148-6706170 CTGGAAATGGAGAGAGAAGCTGG + Intronic
1144256619 17:13474723-13474745 CGGTAAATGCAGAGGGAAGCAGG + Intergenic
1144260504 17:13515029-13515051 ATGGAAATGAAGAGGGAAAGGGG + Intronic
1148026740 17:44593915-44593937 CTGCAAACTCAGAGGCAAAAAGG - Intergenic
1148441434 17:47713598-47713620 GAGAAAATGCAGAGGCAAAGGGG + Intergenic
1148843128 17:50511863-50511885 CCGGAGAGGCAGAGGCAAGCTGG - Intronic
1148966828 17:51442793-51442815 CTAGAAATGCAGAGGGAAACGGG - Intergenic
1150199587 17:63340936-63340958 CTAGAACTGCAGAGGAAAAAGGG - Intronic
1150280581 17:63927785-63927807 CTGGAATTCCAGAGGGAATCTGG + Intergenic
1151102024 17:71566894-71566916 CTGGAAAGGGAGAGGAAAGCAGG + Intergenic
1152485548 17:80589426-80589448 ATGGAAATGCAAAGGGACACAGG - Intronic
1152903501 17:82958219-82958241 CAGGGGATGCAGAGGCCAACGGG + Intronic
1153064856 18:1034586-1034608 CTGGTGATGCCTAGGCAAACAGG - Intergenic
1153307500 18:3645577-3645599 CAAGCTATGCAGAGGCAAACAGG - Intronic
1153453710 18:5258327-5258349 CTGGGAAGGCAGAGGCACAGTGG - Intergenic
1153515541 18:5897202-5897224 CTGGAAGTTCAGAGCCAAAAAGG - Intergenic
1154401503 18:14042867-14042889 CTGGCAATACTGAGGCAAACAGG - Intergenic
1155550685 18:26961939-26961961 CTGGAAATACAAAGGCGAAAGGG + Intronic
1156799853 18:41096810-41096832 CAGGAAATGCAGTGGCAACGTGG - Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158843930 18:61420633-61420655 CTGGAACTGCAGTGGTACACAGG + Intronic
1158887039 18:61838430-61838452 CTGGAAGTGCAGATCCAAAATGG - Intronic
1160229436 18:77035150-77035172 CTGGAGAAGCAGAGGAAACCTGG - Intronic
1160553495 18:79711382-79711404 CTGGATACTCAGAGGCAAAAGGG - Intronic
1161733222 19:5974992-5975014 CTGGAAAGGCAGAAGCCAAGAGG + Intronic
1163092855 19:15033337-15033359 CTGGAGGTGGAGAGGCAAAGGGG - Intergenic
1165565438 19:36723282-36723304 CTGGAAATGCAAAATCAAAGGGG - Intronic
1168360726 19:55737800-55737822 CTGGCAATGCAGACACTAACTGG + Intronic
925699782 2:6624748-6624770 CTGGAAAGGCTGAGGCAGATGGG + Intergenic
925998583 2:9311908-9311930 ATGGAAAGGCAGAGGCAAGCAGG + Intronic
926508680 2:13745996-13746018 CTGGTAATACCCAGGCAAACAGG + Intergenic
926970556 2:18463517-18463539 CTGGTAATACCCAGGCAAACAGG - Intergenic
929900119 2:45993337-45993359 CTGGAAATGCCAGGGCAAAGTGG - Intronic
930143225 2:47974358-47974380 CTGGTGATGCCCAGGCAAACAGG + Intergenic
930269444 2:49239383-49239405 CTGAAAATGAATAGACAAACAGG - Intergenic
931142839 2:59482580-59482602 CTGAAAAAGCAGAGGCCATCTGG - Intergenic
931536841 2:63286986-63287008 CTGGAAATTCATTGTCAAACTGG + Intronic
932419059 2:71590746-71590768 CAGGAAATGCAGAGGCAGCCTGG - Intronic
932549025 2:72747773-72747795 CTGAAAATTGAGAGGCAAATGGG - Intronic
933413110 2:81950506-81950528 CTGTAAATACCCAGGCAAACAGG - Intergenic
934519861 2:95013353-95013375 ATGGAAATGCAGGGACAAGCAGG - Intergenic
934999725 2:99001319-99001341 CTGGTGATACCGAGGCAAACAGG + Intronic
935061826 2:99615334-99615356 CGGGAAGTGCAGCTGCAAACTGG - Intronic
935399524 2:102645137-102645159 CTGGTAATGCCCAGGCAAACAGG + Intronic
936769439 2:115894401-115894423 CTGGTGATACACAGGCAAACAGG - Intergenic
937768820 2:125694981-125695003 GTGGAAGAGCAAAGGCAAACAGG + Intergenic
938144829 2:128824528-128824550 CTGGTAATACCCAGGCAAACAGG + Intergenic
940370646 2:152896715-152896737 CTGGTAATACCTAGGCAAACAGG + Intergenic
940732679 2:157412002-157412024 CTGGTAATGAAGAGGAAAAAGGG - Intergenic
940843080 2:158607505-158607527 CTAGGACTGCAGAGGCAAAGGGG + Intronic
941449315 2:165640536-165640558 CTGGTACTGCAGAGGCTTACAGG + Intronic
942753644 2:179315344-179315366 CTGGTGATACACAGGCAAACAGG + Intergenic
943866464 2:192930479-192930501 CTGGTAATACACAGGCAAACAGG - Intergenic
944374835 2:199029300-199029322 CTGGTAATACCCAGGCAAACAGG + Intergenic
945776620 2:214114128-214114150 CTGGTGATACACAGGCAAACAGG - Intronic
945918570 2:215731031-215731053 CTAGAAATGCTGAGTAAAACAGG + Intergenic
946444339 2:219725544-219725566 CTGGTGAGGCAGGGGCAAACTGG - Intergenic
946539959 2:220673346-220673368 CTCAAAATGCAGAGGAAAGCAGG + Intergenic
948419596 2:237848729-237848751 CTGGTAATACCCAGGCAAACAGG - Intergenic
1169646301 20:7813808-7813830 CTGGTAATACCCAGGCAAACAGG - Intergenic
1170915662 20:20622252-20622274 CTGGAGATGCAGAAAAAAACAGG + Intronic
1171000949 20:21414674-21414696 CTGGTGATACACAGGCAAACAGG + Intergenic
1172088979 20:32413676-32413698 CTGGAAACTCCCAGGCAAACTGG + Intronic
1172446038 20:34993922-34993944 CGGGAATTGCAGAGGCCACCAGG + Intronic
1172662965 20:36580002-36580024 CAGGAAGGGGAGAGGCAAACTGG - Intronic
1172978668 20:38925188-38925210 CTGGAAATGCCCAGGCAGAGGGG + Intergenic
1173229259 20:41181331-41181353 CTGCAAATGGTGAGTCAAACTGG + Exonic
1173721032 20:45258374-45258396 TGGGAAGTGCAGAGGCAAGCAGG - Intergenic
1175132075 20:56796830-56796852 GTGGAAATTCAGAGGTGAACAGG + Intergenic
1175444910 20:59013310-59013332 CTGGAAAGCCAGTGGCAACCGGG - Intergenic
1176451078 21:6861662-6861684 CTGGTGATGCCCAGGCAAACAGG + Intergenic
1176829247 21:13726713-13726735 CTGGTGATGCCCAGGCAAACAGG + Intergenic
1176960407 21:15152999-15153021 GTGGTAATGGATAGGCAAACTGG - Intergenic
1178261148 21:31100825-31100847 ATGGTTATGTAGAGGCAAACCGG + Intergenic
1181658953 22:24326505-24326527 CTGCAAACGAAGAGTCAAACAGG - Intronic
1181772441 22:25135763-25135785 CTGGAAACGCAGAACCAAAGAGG - Intronic
1182989734 22:34755630-34755652 CTAGAAATACACAGGCACACAGG - Intergenic
1183040455 22:35173950-35173972 GTGGAAATGCAGAGACAGAAAGG - Intergenic
1183850961 22:40587597-40587619 CTGGTAAGGCAGAGGCAGCCAGG + Intronic
1185047083 22:48533981-48534003 CAGGAAATGCAGATGCTAAGGGG - Intronic
950597357 3:13996583-13996605 CTGGTGATGCCCAGGCAAACAGG - Intronic
952501774 3:33969963-33969985 CTGGAGATACCCAGGCAAACAGG - Intergenic
953259013 3:41319776-41319798 CTGGAAATGGAGATTCAAAGAGG + Intronic
953664267 3:44914869-44914891 CTGGAAAGGCAGAGGATGACAGG - Exonic
953750550 3:45605270-45605292 CTGGAAAGGCAGAGGCCAAGCGG + Intronic
954291515 3:49652440-49652462 CTGGAGATGGAGAGCCTAACGGG + Exonic
954865185 3:53722940-53722962 CTGGAGAGGTAGAGGGAAACGGG - Intronic
955019448 3:55105171-55105193 CAGGAAATGCAAAGCCAGACAGG - Intergenic
955510619 3:59676958-59676980 CTAGAAATACAGAGGTAAACAGG + Intergenic
955630226 3:60965712-60965734 CTGGTGATACACAGGCAAACAGG - Intronic
955701925 3:61690234-61690256 TTGGAAATGCAGAGGCCTCCTGG + Intronic
957850361 3:85799686-85799708 CTGGTAATACCCAGGCAAACAGG - Intronic
958261168 3:91383056-91383078 CTGGTGATACACAGGCAAACAGG - Intergenic
958261342 3:91384751-91384773 CTAAAAATACAGAGGAAAACAGG + Intergenic
959097337 3:101970706-101970728 CTGGTGATACACAGGCAAACAGG - Intergenic
959211447 3:103388286-103388308 CTGAAATTCCAGAAGCAAACAGG + Intergenic
959444985 3:106427773-106427795 CTGGAAGTCCAGAGGCAGAGTGG - Intergenic
959881112 3:111446407-111446429 CTGGTTATACTGAGGCAAACAGG - Intronic
961541164 3:127600368-127600390 CTGGAAATGCAGAGTAAGGCAGG - Intronic
962262980 3:133926825-133926847 ATGGAAATGCAGGGGGAAGCCGG - Intergenic
963474633 3:145789443-145789465 AGGAAATTGCAGAGGCAAACAGG + Intergenic
963984364 3:151575022-151575044 CTGGCAATACCCAGGCAAACAGG - Intergenic
964715337 3:159715111-159715133 CTGGTAATACCCAGGCAAACAGG + Intronic
965157475 3:165082660-165082682 CTGGAAATGCAGAGAGAGCCAGG + Intergenic
965388143 3:168071004-168071026 CTGGAAATTCACAGTCAAACTGG + Intronic
965651449 3:170938206-170938228 CTGGTAATACCTAGGCAAACAGG - Intergenic
966891529 3:184410782-184410804 AAGGAATTGCAGAGGCAAAAAGG + Intronic
968860575 4:3166215-3166237 CTGGTGATGCCCAGGCAAACAGG - Intronic
972339887 4:38142961-38142983 CTGGATATGGAGAGGCAGGCAGG - Intergenic
972962843 4:44474550-44474572 CTGGTAATACCCAGGCAAACAGG + Intergenic
973562732 4:52152337-52152359 CTGGTAATACCCAGGCAAACAGG + Intergenic
973625994 4:52773437-52773459 CTGGTGATGCCCAGGCAAACAGG - Intergenic
974196691 4:58584870-58584892 CTGGTAATACCCAGGCAAACGGG - Intergenic
974877441 4:67716325-67716347 CTGGAAACGCAGAGGCATGATGG + Intergenic
975182023 4:71357185-71357207 ATGGTAATGCAGAGGCCAGCTGG + Exonic
975939581 4:79626462-79626484 CTGCTTATGAAGAGGCAAACTGG + Intergenic
976061161 4:81130291-81130313 CTGGTAATACAAAGGCATACGGG - Intronic
976147345 4:82055047-82055069 CTGGAAAAGCACAGGCAAAAGGG - Intergenic
976610079 4:87021374-87021396 CTGGATAAACTGAGGCAAACAGG - Intronic
977004194 4:91544585-91544607 CTGGTGATGCCCAGGCAAACAGG - Intronic
977671488 4:99699909-99699931 CTGGTAATACCCAGGCAAACAGG + Intergenic
978055004 4:104252779-104252801 CTGGTGATACACAGGCAAACAGG + Intergenic
978552068 4:109938579-109938601 TTGGAAAAGAAGAGGCAATCTGG + Intronic
979516648 4:121617046-121617068 CTGGTGATGCCCAGGCAAACAGG + Intergenic
979581461 4:122365662-122365684 CTGGTGATACACAGGCAAACAGG + Intergenic
981133893 4:141189201-141189223 CTGGTAATACCCAGGCAAACAGG - Intronic
981662606 4:147184721-147184743 CTGGTGATACACAGGCAAACTGG + Intergenic
981872288 4:149501139-149501161 TTGGAAATGCAGAAGCAATCAGG - Intergenic
982208792 4:153018476-153018498 GTGGGGATGCAGAGCCAAACAGG + Intergenic
982826930 4:160013867-160013889 GTGGAAATGCTTAGGCAAGCAGG - Intergenic
983596225 4:169471426-169471448 CTGGAGATACCCAGGCAAACAGG - Intronic
984483443 4:180335713-180335735 CTGCAAACTCAGAGGCAATCTGG - Intergenic
984493764 4:180469225-180469247 CTGGTGATACACAGGCAAACAGG + Intergenic
984758592 4:183345144-183345166 CTGGAAATGCTGATGCAAGGGGG - Intergenic
985011985 4:185592130-185592152 CAGGAAATGCTGAGCCAGACTGG + Intronic
985379102 4:189373509-189373531 CAGGAAATGCAAAGGCTACCTGG + Intergenic
985438129 4:189953435-189953457 TTGGAAGTCCAAAGGCAAACAGG + Intronic
986484436 5:8220849-8220871 CTGGTAATACTCAGGCAAACAGG + Intergenic
986631755 5:9780959-9780981 TTTGAAATGCATAGGCAAGCTGG - Intergenic
987076309 5:14385207-14385229 CTGGAACTGCTGGGGCAGACAGG - Intronic
989334696 5:40302046-40302068 CTGGAGATACCCAGGCAAACAGG - Intergenic
989418320 5:41206085-41206107 CTGGTAATACACAGGCAAACAGG + Intronic
989768708 5:45117096-45117118 CTGGTGATGCCCAGGCAAACAGG - Intergenic
991994286 5:72371745-72371767 CTGGAGATGAAGAGGCACAGCGG - Intergenic
992421244 5:76607517-76607539 AAGGAAATGCAGAGGCAACAGGG - Intronic
992557044 5:77914069-77914091 CAGTAAATAAAGAGGCAAACGGG - Intergenic
992686692 5:79206272-79206294 CTGGAAATGGAGACGGAGACAGG - Intronic
992873571 5:81029515-81029537 CTGGTGATACACAGGCAAACAGG + Intronic
992908804 5:81374176-81374198 CTGGGAATACCTAGGCAAACAGG + Intronic
992911227 5:81397839-81397861 CCGGAAGTGCAGGGACAAACAGG - Intergenic
993502936 5:88682302-88682324 TTTGAAATGCAGTGGGAAACAGG - Intergenic
993531321 5:89028417-89028439 CTGGAAATGCACCAGCAAAGGGG - Intergenic
993609106 5:90032349-90032371 CTGGTGATACACAGGCAAACAGG + Intergenic
993656258 5:90581560-90581582 CTGGTGATGCCCAGGCAAACAGG - Intronic
994233443 5:97335698-97335720 CTGGTAATACCCAGGCAAACAGG - Intergenic
994368456 5:98943325-98943347 ATGGGAAAGCAGATGCAAACTGG - Intergenic
994378178 5:99038444-99038466 CTGGTAATACCCAGGCAAACAGG + Intergenic
994528446 5:100935362-100935384 CTGGGAATACCCAGGCAAACAGG - Intergenic
995179076 5:109213727-109213749 CTGGTAATACCCAGGCAAACAGG - Intergenic
995412715 5:111876693-111876715 ATGGATATGCATAGTCAAACAGG - Intronic
996551625 5:124736399-124736421 CAGGAAATCCAGAAGTAAACTGG + Intronic
996814797 5:127562942-127562964 CTGCAAATGCAAAAGGAAACTGG - Intergenic
996953207 5:129152779-129152801 CTGGAGATACACAGGCAAACAGG - Intergenic
997097063 5:130924635-130924657 CTGGTAATACCCAGGCAAACAGG + Intergenic
997130605 5:131272403-131272425 CTGAAAATGAAGAGGAAAAAAGG - Intronic
997647914 5:135493202-135493224 CTGGAAATGAAGCAGGAAACTGG + Intergenic
997791502 5:136766372-136766394 CAGTAAATGCAGAGACAAACTGG - Intergenic
999500572 5:152142844-152142866 TTGGAAATTCAGAGGCATATAGG + Intergenic
1001346301 5:170902824-170902846 CTGGTGATACCGAGGCAAACAGG - Intronic
1002734712 5:181376865-181376887 CTGGTGATGCCCAGGCAAACAGG - Intergenic
1002912040 6:1497933-1497955 CTGGAAGTGCAGACACAAAGGGG - Intergenic
1003228739 6:4229844-4229866 CTGGTGATGCTCAGGCAAACAGG + Intergenic
1003416794 6:5917148-5917170 CTGGTGATGCCCAGGCAAACAGG - Intergenic
1003511343 6:6783564-6783586 CTGGAAATGCAGAGGCAGATAGG - Intergenic
1005662913 6:28018511-28018533 CTGGAAAATGAGAGACAAACAGG - Intergenic
1005812472 6:29528139-29528161 CTGGAAAGGCAGAGGTCACCTGG - Intergenic
1005871078 6:29974852-29974874 CTGGGAATGGAGAGGCATAGGGG + Intergenic
1006752783 6:36389030-36389052 CTGGAAAAGCTGAGGTAAAGTGG + Intergenic
1007154922 6:39733167-39733189 CTGGAAATACAAAGATAAACAGG - Intergenic
1007367167 6:41403012-41403034 CTGGAGAGGCAGAGGCAATGGGG - Intergenic
1008993818 6:57635397-57635419 CTAAAAATACAGAGGAAAACAGG - Intronic
1009182426 6:60534481-60534503 CTAAAAATACAGAGGAAAACAGG - Intergenic
1009182601 6:60536184-60536206 CTGGTGATACACAGGCAAACAGG + Intergenic
1009264207 6:61532632-61532654 CTGGTGATGCCCAGGCAAACAGG + Intergenic
1009718166 6:67427753-67427775 CTGGTAATACCTAGGCAAACAGG - Intergenic
1010778771 6:79918699-79918721 CTGGAAATTCAAAGCCAACCTGG - Intronic
1010806358 6:80241556-80241578 CTGGTGATGCCCAGGCAAACAGG - Intronic
1011610703 6:89147282-89147304 CTGGAAAAGCAGAGTAAAACAGG - Intronic
1012799118 6:103802689-103802711 CTGGTGATGCCCAGGCAAACAGG + Intergenic
1013017102 6:106169806-106169828 GGGGAAATGGAGAGGGAAACAGG - Intergenic
1013288743 6:108701895-108701917 CAGGGAATGCAGAGGCAAAAAGG - Intergenic
1014069937 6:117169119-117169141 TTTGAAATGGAGAGGCAATCAGG + Intergenic
1014176941 6:118341844-118341866 CTGGTGATACACAGGCAAACAGG - Intergenic
1014225451 6:118841445-118841467 CCTGGAAAGCAGAGGCAAACAGG + Intronic
1014700671 6:124683743-124683765 CTTCAAATGCAGAGACAAAAGGG + Intronic
1014780993 6:125564511-125564533 ATGGAAGTGCTGAGGCCAACAGG + Intergenic
1014831962 6:126113225-126113247 CTGGACATGCAGAGACATACAGG - Intergenic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015290285 6:131531485-131531507 CTGGTGATGCTCAGGCAAACAGG - Intergenic
1015456098 6:133428529-133428551 CTGGAATTCCAGAGGTAGACTGG + Intronic
1016638453 6:146322201-146322223 CTGGTAATACCCAGGCAAACAGG - Intronic
1018114043 6:160565390-160565412 CTGGTAATACCCAGGCAAACAGG + Intronic
1018278103 6:162154202-162154224 CAGGAAATGCAGAGGCGATGCGG - Intronic
1018745285 6:166757197-166757219 CTGCAAGTGCAGAAGCAAAGGGG - Intronic
1019946484 7:4333571-4333593 CTGGATAGGCAGAGGTAATCTGG - Intergenic
1020367141 7:7393262-7393284 CTGGTAATGCCCAGGCAAACAGG - Intronic
1022187353 7:27982808-27982830 CTGGTGATACACAGGCAAACAGG + Intronic
1022272227 7:28819877-28819899 GTGGAAATGGAGAAGAAAACTGG - Exonic
1022589909 7:31651615-31651637 CTGTAAAGGGAGAGGCATACGGG + Intronic
1022591437 7:31667355-31667377 CTTGAAATGCACAGTCACACAGG - Intergenic
1023006816 7:35879124-35879146 TTGAAAGTACAGAGGCAAACTGG + Intronic
1023691805 7:42796963-42796985 CTGGTGATGCTCAGGCAAACAGG + Intergenic
1024178935 7:46869570-46869592 ATTGAAAGGCAGAGGCTAACTGG - Intergenic
1024202899 7:47124716-47124738 CCCAAAATGCAGAGGCAAAGAGG - Intergenic
1026063788 7:67050579-67050601 CTGGCAATGCAGAGAAACACAGG + Intronic
1026230247 7:68476571-68476593 CTGGAAAAGGAGAGGGAGACTGG + Intergenic
1026714561 7:72776881-72776903 CTGGCAATGCAGAGAAACACAGG - Intronic
1026938987 7:74275761-74275783 CTGGAGATGGAGAGGGAAACAGG - Intergenic
1027441171 7:78220459-78220481 CTGGGGATGCAAAGACAAACAGG - Intronic
1028086056 7:86639348-86639370 CTGGATATGCAGGGGCAATGGGG - Intergenic
1028139968 7:87263128-87263150 CTGGTGATGCCCAGGCAAACAGG - Intergenic
1028148800 7:87347982-87348004 CTGTTAAAGCAGAGGAAAACAGG + Intronic
1028520747 7:91727906-91727928 CTGCAAACACAAAGGCAAACTGG - Intronic
1028801310 7:94969447-94969469 CTGGTAATACCCAGGCAAACAGG - Intronic
1028925418 7:96352162-96352184 ATGGAGATGCAGAGAAAAACAGG + Intergenic
1029135949 7:98371521-98371543 GTAGAAATGCCGAGGTAAACAGG - Intronic
1031157146 7:118123058-118123080 CTGGTAATACCCAGGCAAACAGG + Intergenic
1031441718 7:121802644-121802666 CTGGGACTGCAGAGGCATATGGG + Intergenic
1031865481 7:127034535-127034557 CTGGATATGAAGAGGGAAAAGGG - Intronic
1032389204 7:131544785-131544807 CTGGAAAAGCACATGCAAGCTGG + Intronic
1032883363 7:136114131-136114153 CTGGCAATACACAGGCAAACAGG - Intergenic
1033424436 7:141231157-141231179 CTGGAAATGCAGAGGCAAACAGG - Intronic
1035386977 7:158479695-158479717 CTGGAAATGCTGAGGCCACATGG + Intronic
1035457939 7:159021391-159021413 TTGGGAATACAGAGGCAGACTGG - Intergenic
1035763081 8:2084207-2084229 CGGAAAATGCAGAGGGTAACTGG - Intronic
1036127600 8:6077611-6077633 CTGGACATGGAGAGCCAAGCAGG - Intergenic
1038169122 8:25112833-25112855 CTTGAAATGAGGAGGGAAACAGG - Intergenic
1040323232 8:46328857-46328879 CTGGGAATGGAGAGGCATCCTGG + Intergenic
1040355088 8:46609263-46609285 CTGGTAATACCCAGGCAAACAGG + Intergenic
1041248230 8:55909230-55909252 CTGGAAATGCAGTCGCACCCTGG - Intronic
1042254410 8:66788486-66788508 CTGGAAATGACATGGCAAACAGG - Intronic
1042349438 8:67761947-67761969 CTGGTAATACTCAGGCAAACAGG + Intergenic
1042419514 8:68569353-68569375 CAGGAAATGAAGAAGCAAAGGGG + Intronic
1042833538 8:73056599-73056621 CTGGTAATACCCAGGCAAACAGG + Intergenic
1043036579 8:75207625-75207647 CTGGTGATGCCCAGGCAAACAGG - Intergenic
1043376534 8:79655932-79655954 TTGGAGATGCAGAGCAAAACAGG + Intronic
1044144659 8:88696759-88696781 ATGGAAGTGCAGAAGCAAGCTGG - Intergenic
1044509368 8:93057800-93057822 CTGGTAATACCCAGGCAAACAGG - Intergenic
1044798891 8:95933195-95933217 CTGGTAATACCCAGGCAAACAGG - Intergenic
1045897827 8:107239798-107239820 GAGGAACTGCAGAGGCATACAGG - Intergenic
1045989756 8:108292198-108292220 GTGGAAAGGCAAAGGCAGACTGG + Intronic
1046675725 8:117105871-117105893 CTGGAAATGCAGAAGAAATAGGG - Intronic
1047011334 8:120675666-120675688 CTGGAAATGCAGGGGAACAAAGG + Intronic
1047423514 8:124726829-124726851 CTGGATCTGTTGAGGCAAACTGG + Intronic
1048270606 8:133025276-133025298 CTGGCCCTGCAGAGGCCAACAGG + Intronic
1048350679 8:133613515-133613537 GTGGAAGTGCAGAGGCCACCTGG + Intergenic
1049346092 8:142139504-142139526 TGGGAAATGCAGAGGCAGCCTGG + Intergenic
1050069165 9:1792247-1792269 CTGGGAATGCAGAGAAAAGCAGG - Intergenic
1050695014 9:8269054-8269076 CTGGAACTACAGAGGAAAACAGG + Intergenic
1050916962 9:11148376-11148398 CTGGAAACGCGGAGGCCAAATGG + Intergenic
1051489576 9:17646675-17646697 CTGGTGATACCGAGGCAAACAGG - Intronic
1051983570 9:23054848-23054870 CTGGATATCCAGATGCAAAAAGG + Intergenic
1052096492 9:24390788-24390810 CTGGTGATGCCGAGGCAAATGGG - Intergenic
1053148695 9:35729436-35729458 ATGGAAAGGCAGAGGAAGACTGG + Intronic
1053331927 9:37219548-37219570 CAGGAAATACAGAGGCTAAATGG - Intronic
1053568110 9:39274636-39274658 CTGGTGATGCCCAGGCAAACAGG + Intronic
1054129034 9:61344374-61344396 CTGGTGATGCCCAGGCAAACAGG - Intergenic
1054321941 9:63678535-63678557 CTGGAATGGCTTAGGCAAACAGG - Intergenic
1056780048 9:89542511-89542533 CTGGAGATGGAGAGAGAAACGGG + Intergenic
1056997073 9:91473008-91473030 CTGGTGATACACAGGCAAACAGG - Intergenic
1057986495 9:99720734-99720756 CTAGAAATGCAGGGGCTGACAGG - Intergenic
1058234833 9:102476931-102476953 GTGGACCTGCAGAGGCAAACAGG - Intergenic
1058817272 9:108695871-108695893 CTTGTAATGCAGATACAAACAGG - Intergenic
1059865113 9:118505375-118505397 CAGGTAATGCCCAGGCAAACAGG + Intergenic
1060036932 9:120263799-120263821 CTGGAGAGGCAGAGGCGACCAGG + Intergenic
1060039410 9:120286824-120286846 CTGGGAATGCAGAAGTGAACAGG - Intergenic
1060861115 9:126955819-126955841 CTGGAAATGCATTGGCTCACTGG - Intronic
1060936131 9:127517268-127517290 GTGGGAATGCAGAGAGAAACAGG - Intronic
1061995088 9:134179140-134179162 CTGGAAAGACAGAGGAACACGGG - Intergenic
1203518103 Un_GL000213v1:22855-22877 CTGGTGATGCCCAGGCAAACAGG - Intergenic
1186785624 X:12954067-12954089 CTGGAGATACAGAGACAAATAGG + Intergenic
1189566291 X:42244890-42244912 AAGGAAATGTTGAGGCAAACCGG - Intergenic
1189873590 X:45410276-45410298 ATGGGTGTGCAGAGGCAAACAGG + Intergenic
1191050116 X:56182743-56182765 CTGGTAATACCCAGGCAAACAGG - Intergenic
1191657545 X:63614308-63614330 CTGGAGATACCCAGGCAAACAGG + Intergenic
1191931272 X:66375944-66375966 CTGGAGATACCCAGGCAAACAGG - Intergenic
1192254335 X:69443018-69443040 CTGGAAAGGCAGTGGCAGAGAGG + Intergenic
1192357223 X:70415685-70415707 CTGGAAAGGGGGAGGCAAATAGG + Intronic
1192992210 X:76472074-76472096 CTGGTAATACCCAGGCAAACAGG + Intergenic
1193066129 X:77262326-77262348 CTGAAATTGCAGAGACAAATTGG + Intergenic
1194557971 X:95385923-95385945 CTGGAAATCCAGAAGAAAACTGG + Intergenic
1194782393 X:98040480-98040502 CTTTAAATGCAGAGAAAAACAGG - Intergenic
1195016363 X:100785588-100785610 CTGCATATGCAGAAGCAGACAGG - Intergenic
1195340513 X:103902388-103902410 CTGCTAATACCGAGGCAAACAGG - Intergenic
1195398409 X:104435752-104435774 AGAGAAATGCAGAGGCAGACTGG + Intergenic
1195915263 X:109929172-109929194 ATGGAAATACAGAGGAAAATTGG + Intergenic
1197076989 X:122364426-122364448 CTGGAAAAGCAGGGGCAATTAGG - Intergenic
1197335054 X:125203200-125203222 ATAGAAATTCAGAAGCAAACAGG + Intergenic
1197848840 X:130834734-130834756 TTGAAACTGCAGGGGCAAACAGG + Intronic
1198270311 X:135051058-135051080 CTGCAAATTCAGAAGAAAACAGG + Exonic
1198295297 X:135281791-135281813 CTGGTGATACACAGGCAAACAGG - Intronic
1199844803 X:151683454-151683476 CAGGAAATCCAGAGGCCCACAGG - Intergenic
1200204758 X:154307883-154307905 CTGGAAATGCAGAACCAAAAGGG + Intronic