ID: 1033425070

View in Genome Browser
Species Human (GRCh38)
Location 7:141236534-141236556
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033425070_1033425076 14 Left 1033425070 7:141236534-141236556 CCATCTTCCCTCAAATATTGCAG 0: 1
1: 0
2: 0
3: 28
4: 235
Right 1033425076 7:141236571-141236593 ATCACCTCTATCTTCACTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 138
1033425070_1033425077 15 Left 1033425070 7:141236534-141236556 CCATCTTCCCTCAAATATTGCAG 0: 1
1: 0
2: 0
3: 28
4: 235
Right 1033425077 7:141236572-141236594 TCACCTCTATCTTCACTCCAGGG No data
1033425070_1033425074 -9 Left 1033425070 7:141236534-141236556 CCATCTTCCCTCAAATATTGCAG 0: 1
1: 0
2: 0
3: 28
4: 235
Right 1033425074 7:141236548-141236570 ATATTGCAGGCCATTTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033425070 Original CRISPR CTGCAATATTTGAGGGAAGA TGG (reversed) Intronic
902282408 1:15384165-15384187 CTGCAAGGTTTGTGGGATGAAGG - Intronic
902282408 1:15384165-15384187 CTGCAAGGTTTGTGGGATGAAGG - Intronic
902671924 1:17980504-17980526 CTGCAATGTTGCAGGGAAGGCGG + Intergenic
902671924 1:17980504-17980526 CTGCAATGTTGCAGGGAAGGCGG + Intergenic
902991333 1:20189343-20189365 CTGCAATGTTTAGGGAAAGATGG + Intronic
902991333 1:20189343-20189365 CTGCAATGTTTAGGGAAAGATGG + Intronic
908328971 1:63051686-63051708 AGGCAATATCTGGGGGAAGAAGG + Intergenic
908328971 1:63051686-63051708 AGGCAATATCTGGGGGAAGAAGG + Intergenic
909797813 1:79765201-79765223 CTTGCATATTTGAGAGAAGATGG - Intergenic
909797813 1:79765201-79765223 CTTGCATATTTGAGAGAAGATGG - Intergenic
910950261 1:92639325-92639347 CTTCAATATTTGAAGGAAATAGG + Intronic
910950261 1:92639325-92639347 CTTCAATATTTGAAGGAAATAGG + Intronic
911019597 1:93373672-93373694 CTGCAATATTTTAAGTAAGGAGG + Intergenic
911019597 1:93373672-93373694 CTGCAATATTTTAAGTAAGGAGG + Intergenic
913355887 1:117921824-117921846 CTGCAATAATTTAGGTGAGATGG + Intronic
913355887 1:117921824-117921846 CTGCAATAATTTAGGTGAGATGG + Intronic
914880408 1:151542035-151542057 TTGGAATAGTTGAGGGAAAAGGG + Intronic
914880408 1:151542035-151542057 TTGGAATAGTTGAGGGAAAAGGG + Intronic
915538531 1:156552519-156552541 CTCCAAGATTTGGGGCAAGATGG - Intronic
915538531 1:156552519-156552541 CTCCAAGATTTGGGGCAAGATGG - Intronic
918525988 1:185465688-185465710 AAGCAATATTTGAAGGGAGATGG - Intergenic
918525988 1:185465688-185465710 AAGCAATATTTGAAGGGAGATGG - Intergenic
919207624 1:194437546-194437568 CTGCAATAGTTGTTGGAGGAGGG - Intergenic
919207624 1:194437546-194437568 CTGCAATAGTTGTTGGAGGAGGG - Intergenic
919879644 1:201893281-201893303 AGGCAATATTTGTGGGAGGAGGG - Intergenic
919879644 1:201893281-201893303 AGGCAATATTTGTGGGAGGAGGG - Intergenic
920207778 1:204305444-204305466 CTGCAATCCTGTAGGGAAGATGG - Intronic
920207778 1:204305444-204305466 CTGCAATCCTGTAGGGAAGATGG - Intronic
921545257 1:216467148-216467170 CTTCAATATTTGAGTGCTGATGG + Intergenic
921545257 1:216467148-216467170 CTTCAATATTTGAGTGCTGATGG + Intergenic
922869180 1:228886331-228886353 CTGCAATATTTTAGGCAAGGTGG + Intergenic
922869180 1:228886331-228886353 CTGCAATATTTTAGGCAAGGTGG + Intergenic
923076030 1:230609239-230609261 GTACCATCTTTGAGGGAAGAGGG + Intergenic
923076030 1:230609239-230609261 GTACCATCTTTGAGGGAAGAGGG + Intergenic
924503402 1:244657777-244657799 CAGCAGTATGTGAAGGAAGATGG + Intronic
924503402 1:244657777-244657799 CAGCAGTATGTGAAGGAAGATGG + Intronic
924948985 1:248865508-248865530 ATAAAATATCTGAGGGAAGAGGG - Intergenic
924948985 1:248865508-248865530 ATAAAATATCTGAGGGAAGAGGG - Intergenic
1069189870 10:65473679-65473701 CTGGAATATTTGGAGGAAGAAGG - Intergenic
1069189870 10:65473679-65473701 CTGGAATATTTGGAGGAAGAAGG - Intergenic
1071105595 10:82090608-82090630 CTGCCATATTTGAATAAAGAAGG + Intronic
1071105595 10:82090608-82090630 CTGCCATATTTGAATAAAGAAGG + Intronic
1071224240 10:83509354-83509376 CTGGAATATGTAAGGCAAGAAGG - Intergenic
1071224240 10:83509354-83509376 CTGGAATATGTAAGGCAAGAAGG - Intergenic
1071745325 10:88412172-88412194 CTGCAATAATTCAGAGAGGAGGG + Intronic
1071745325 10:88412172-88412194 CTGCAATAATTCAGAGAGGAGGG + Intronic
1073687384 10:105770110-105770132 CAGTAATATTTGAGGGAATCTGG + Intergenic
1073687384 10:105770110-105770132 CAGTAATATTTGAGGGAATCTGG + Intergenic
1073884007 10:108016920-108016942 CAGAAATTTTTGAGGGGAGAAGG + Intergenic
1073884007 10:108016920-108016942 CAGAAATTTTTGAGGGGAGAAGG + Intergenic
1079498872 11:21078715-21078737 CTGCAATATATGAGAGAAGGTGG + Intronic
1079498872 11:21078715-21078737 CTGCAATATATGAGAGAAGGTGG + Intronic
1080123705 11:28706186-28706208 CTGCTATGGTTGAGGGAAGAAGG + Intergenic
1080123705 11:28706186-28706208 CTGCTATGGTTGAGGGAAGAAGG + Intergenic
1080407546 11:31993054-31993076 CTGCAATATTTCAAGGCACACGG + Intronic
1080407546 11:31993054-31993076 CTGCAATATTTCAAGGCACACGG + Intronic
1080875888 11:36274017-36274039 CTGCATTAGATGAAGGAAGAGGG + Exonic
1080875888 11:36274017-36274039 CTGCATTAGATGAAGGAAGAGGG + Exonic
1081729283 11:45357685-45357707 CTGCAATAACTGGGTGAAGAGGG - Intergenic
1081729283 11:45357685-45357707 CTGCAATAACTGGGTGAAGAGGG - Intergenic
1082988487 11:59187437-59187459 CTGTAACATGTGAGTGAAGAAGG + Intronic
1082988487 11:59187437-59187459 CTGTAACATGTGAGTGAAGAAGG + Intronic
1087296648 11:96384880-96384902 ATGAAATATCTGAGTGAAGATGG + Intronic
1087296648 11:96384880-96384902 ATGAAATATCTGAGTGAAGATGG + Intronic
1089077926 11:115753523-115753545 CTGCAGTATATCAGGGGAGAGGG + Intergenic
1089077926 11:115753523-115753545 CTGCAGTATATCAGGGGAGAGGG + Intergenic
1090441574 11:126729096-126729118 CTGCTAGAGATGAGGGAAGATGG - Intronic
1090441574 11:126729096-126729118 CTGCTAGAGATGAGGGAAGATGG - Intronic
1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG + Intronic
1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG + Intronic
1093941044 12:25054811-25054833 ATTCAATCTTTGAGAGAAGAGGG + Intronic
1093941044 12:25054811-25054833 ATTCAATCTTTGAGAGAAGAGGG + Intronic
1095800410 12:46266478-46266500 TTTCCATAATTGAGGGAAGAAGG - Intronic
1095800410 12:46266478-46266500 TTTCCATAATTGAGGGAAGAAGG - Intronic
1096846306 12:54408948-54408970 CTGAAATCTGTGAGGGGAGAAGG + Exonic
1096846306 12:54408948-54408970 CTGAAATCTGTGAGGGGAGAAGG + Exonic
1097229185 12:57498766-57498788 CAGGCATTTTTGAGGGAAGATGG + Intronic
1097229185 12:57498766-57498788 CAGGCATTTTTGAGGGAAGATGG + Intronic
1098032130 12:66265720-66265742 CTGCCATCCTGGAGGGAAGATGG - Intergenic
1098032130 12:66265720-66265742 CTGCCATCCTGGAGGGAAGATGG - Intergenic
1098831548 12:75370979-75371001 ATGCAATAGCTGAGGGAAGCTGG - Intronic
1098831548 12:75370979-75371001 ATGCAATAGCTGAGGGAAGCTGG - Intronic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1099744314 12:86683472-86683494 GGGCAATATTTTAGGTAAGATGG - Intronic
1099744314 12:86683472-86683494 GGGCAATATTTTAGGTAAGATGG - Intronic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1100346531 12:93737074-93737096 CTGGGATAGTTGAGGGAAGGTGG + Intronic
1100346531 12:93737074-93737096 CTGGGATAGTTGAGGGAAGGTGG + Intronic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1103039257 12:117681411-117681433 TTGAAAGATTTGAAGGAAGAAGG + Intronic
1103039257 12:117681411-117681433 TTGAAAGATTTGAAGGAAGAAGG + Intronic
1104153901 12:126111657-126111679 CTGCAATATTTATGGGGATATGG + Intergenic
1104153901 12:126111657-126111679 CTGCAATATTTATGGGGATATGG + Intergenic
1104318153 12:127723358-127723380 CTGCATTATTTCAGGCAAGCTGG + Intergenic
1104318153 12:127723358-127723380 CTGCATTATTTCAGGCAAGCTGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107330416 13:39294187-39294209 GTACAATAGTTTAGGGAAGAAGG + Intergenic
1107330416 13:39294187-39294209 GTACAATAGTTTAGGGAAGAAGG + Intergenic
1107909397 13:45091202-45091224 CTGAAATATTTAAGGGCAAAGGG + Intergenic
1107909397 13:45091202-45091224 CTGAAATATTTAAGGGCAAAGGG + Intergenic
1109274396 13:60287301-60287323 CTGCAATATTTGGGCGAGGGCGG + Intergenic
1109274396 13:60287301-60287323 CTGCAATATTTGGGCGAGGGCGG + Intergenic
1109644882 13:65240631-65240653 CTTCAATATTTAAGGGGAAAAGG + Intergenic
1109644882 13:65240631-65240653 CTTCAATATTTAAGGGGAAAAGG + Intergenic
1110415785 13:75250841-75250863 CTGCCATAATTGGGAGAAGATGG + Intergenic
1110415785 13:75250841-75250863 CTGCCATAATTGGGAGAAGATGG + Intergenic
1111415557 13:87938993-87939015 CTGCAATTCTTGAGGGGAAATGG + Intergenic
1111415557 13:87938993-87939015 CTGCAATTCTTGAGGGGAAATGG + Intergenic
1111885400 13:94014440-94014462 CTGCCATATTTGAGTGTAAAGGG - Intronic
1111885400 13:94014440-94014462 CTGCCATATTTGAGTGTAAAGGG - Intronic
1112561765 13:100521478-100521500 CTGCAGTATTTGAGCAAGGATGG - Intronic
1112561765 13:100521478-100521500 CTGCAGTATTTGAGCAAGGATGG - Intronic
1112646657 13:101340433-101340455 CTGTGTTATTTGAGGGAAAATGG - Intronic
1112646657 13:101340433-101340455 CTGTGTTATTTGAGGGAAAATGG - Intronic
1115688490 14:35821199-35821221 CTGGCAGATTTTAGGGAAGAGGG + Intergenic
1115688490 14:35821199-35821221 CTGGCAGATTTTAGGGAAGAGGG + Intergenic
1119451347 14:74713377-74713399 CTGGGTTATTTGAGGCAAGAAGG + Intronic
1119451347 14:74713377-74713399 CTGGGTTATTTGAGGCAAGAAGG + Intronic
1119523935 14:75307423-75307445 CTACAAGATCTTAGGGAAGAGGG + Intergenic
1119523935 14:75307423-75307445 CTACAAGATCTTAGGGAAGAGGG + Intergenic
1119672781 14:76532099-76532121 TTGTAATATTAGTGGGAAGAGGG - Intergenic
1119672781 14:76532099-76532121 TTGTAATATTAGTGGGAAGAGGG - Intergenic
1120612224 14:86656196-86656218 CTGCAAAATTTCAGGAAATATGG + Intergenic
1120612224 14:86656196-86656218 CTGCAAAATTTCAGGAAATATGG + Intergenic
1121598141 14:95181550-95181572 TTGCATCATTTGAGGGCAGAGGG - Intergenic
1121598141 14:95181550-95181572 TTGCATCATTTGAGGGCAGAGGG - Intergenic
1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG + Intergenic
1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG + Intergenic
1123962962 15:25425761-25425783 CACCAATATTTGAGGGATGGTGG + Intronic
1123962962 15:25425761-25425783 CACCAATATTTGAGGGATGGTGG + Intronic
1125121855 15:36169329-36169351 CTGAAATATTTGAGCAGAGAAGG - Intergenic
1125121855 15:36169329-36169351 CTGAAATATTTGAGCAGAGAAGG - Intergenic
1125777499 15:42230246-42230268 CTGCAAGCGTTGAGAGAAGAGGG - Intronic
1125777499 15:42230246-42230268 CTGCAAGCGTTGAGAGAAGAGGG - Intronic
1126884411 15:53134266-53134288 CTTCATTCTTAGAGGGAAGAGGG + Intergenic
1126884411 15:53134266-53134288 CTTCATTCTTAGAGGGAAGAGGG + Intergenic
1127843493 15:62849607-62849629 CAGCAATATTTGGGGGGAGTTGG + Intergenic
1127843493 15:62849607-62849629 CAGCAATATTTGGGGGGAGTTGG + Intergenic
1131074851 15:89488950-89488972 CTGGAATAGTTAAGGGTAGAGGG + Intronic
1131074851 15:89488950-89488972 CTGGAATAGTTAAGGGTAGAGGG + Intronic
1131582700 15:93660757-93660779 CTGCAACATGTGCAGGAAGATGG + Intergenic
1131582700 15:93660757-93660779 CTGCAACATGTGCAGGAAGATGG + Intergenic
1132838386 16:1966089-1966111 CCGCAGTATTGGAGAGAAGAGGG + Intergenic
1132838386 16:1966089-1966111 CCGCAGTATTGGAGAGAAGAGGG + Intergenic
1136501795 16:30674425-30674447 CTGCATCAAGTGAGGGAAGAGGG - Intergenic
1136501795 16:30674425-30674447 CTGCATCAAGTGAGGGAAGAGGG - Intergenic
1138545650 16:57717965-57717987 CAGCAAGATTTGATGGCAGAAGG - Intronic
1138545650 16:57717965-57717987 CAGCAAGATTTGATGGCAGAAGG - Intronic
1141248070 16:82329334-82329356 CTGCTATGTTTGAGGGAAAGTGG + Intergenic
1141248070 16:82329334-82329356 CTGCTATGTTTGAGGGAAAGTGG + Intergenic
1141809557 16:86365872-86365894 TTGGAATATTTGAGGAAAGATGG - Intergenic
1141809557 16:86365872-86365894 TTGGAATATTTGAGGAAAGATGG - Intergenic
1145256690 17:21328276-21328298 ATGAGATATTTGAGGGAAAATGG - Intergenic
1145256690 17:21328276-21328298 ATGAGATATTTGAGGGAAAATGG - Intergenic
1145319921 17:21759672-21759694 ATGAGATATTTGAGGGAAAATGG + Intergenic
1145319921 17:21759672-21759694 ATGAGATATTTGAGGGAAAATGG + Intergenic
1146243374 17:31252271-31252293 CTGCAACATTTGGGAGAAGAAGG - Intronic
1146243374 17:31252271-31252293 CTGCAACATTTGGGAGAAGAAGG - Intronic
1147455974 17:40538396-40538418 CTGAAATGTTTGGGGGAAGAAGG + Intergenic
1147455974 17:40538396-40538418 CTGAAATGTTTGGGGGAAGAAGG + Intergenic
1148583898 17:48763147-48763169 ATCCAATATTTCAGGCAAGAAGG - Intronic
1148583898 17:48763147-48763169 ATCCAATATTTCAGGCAAGAAGG - Intronic
1150942666 17:69710025-69710047 CTGTAATTTTTATGGGAAGAGGG + Intergenic
1150942666 17:69710025-69710047 CTGTAATTTTTATGGGAAGAGGG + Intergenic
1152105332 17:78325373-78325395 CTTCTTTATTTCAGGGAAGAGGG + Intergenic
1152105332 17:78325373-78325395 CTTCTTTATTTCAGGGAAGAGGG + Intergenic
1160898471 19:1414336-1414358 CTGAAATATTTGAGAGTAGCTGG + Intronic
1160898471 19:1414336-1414358 CTGAAATATTTGAGAGTAGCTGG + Intronic
1162453668 19:10769548-10769570 CTGCACTCTTTGAAGGGAGATGG + Intronic
1162453668 19:10769548-10769570 CTGCACTCTTTGAAGGGAGATGG + Intronic
1164286525 19:23822189-23822211 CTGCAATGATTGAGGGAAGGTGG - Intronic
1164286525 19:23822189-23822211 CTGCAATGATTGAGGGAAGGTGG - Intronic
1165840803 19:38788274-38788296 CTGCAAAATTGGTGGGAAGATGG + Intergenic
1165840803 19:38788274-38788296 CTGCAAAATTGGTGGGAAGATGG + Intergenic
1167342040 19:48922009-48922031 CTCCCAGATCTGAGGGAAGAGGG + Intronic
1167342040 19:48922009-48922031 CTCCCAGATCTGAGGGAAGAGGG + Intronic
1167342052 19:48922046-48922068 CTCCCAGATCTGAGGGAAGAGGG + Intronic
1167342052 19:48922046-48922068 CTCCCAGATCTGAGGGAAGAGGG + Intronic
1167666902 19:50827587-50827609 CTCCTAGATTTGGGGGAAGACGG - Intronic
1167666902 19:50827587-50827609 CTCCTAGATTTGGGGGAAGACGG - Intronic
926219001 2:10922777-10922799 CTGCACTTTCTGAGGAAAGAGGG + Intergenic
926219001 2:10922777-10922799 CTGCACTTTCTGAGGAAAGAGGG + Intergenic
926254688 2:11181108-11181130 CTGAAATATTTGAGTAAAAAAGG - Exonic
926254688 2:11181108-11181130 CTGAAATATTTGAGTAAAAAAGG - Exonic
926605500 2:14894645-14894667 CTGCCATATTGAAGGGAAGGAGG + Intergenic
926605500 2:14894645-14894667 CTGCCATATTGAAGGGAAGGAGG + Intergenic
928791399 2:34959810-34959832 CTGGATTATTTGTGGGAAAAGGG - Intergenic
928791399 2:34959810-34959832 CTGGATTATTTGTGGGAAAAGGG - Intergenic
929849481 2:45571012-45571034 ATGAGATATTTGAGGGAAAAGGG + Intronic
929849481 2:45571012-45571034 ATGAGATATTTGAGGGAAAAGGG + Intronic
930241931 2:48944696-48944718 CCTAAACATTTGAGGGAAGACGG - Intergenic
930241931 2:48944696-48944718 CCTAAACATTTGAGGGAAGACGG - Intergenic
930307089 2:49688192-49688214 CTTTAACATTTGGGGGAAGATGG - Intergenic
930307089 2:49688192-49688214 CTTTAACATTTGGGGGAAGATGG - Intergenic
930460752 2:51671764-51671786 CTGCAAAATTTGATGGGGGAGGG - Intergenic
930460752 2:51671764-51671786 CTGCAAAATTTGATGGGGGAGGG - Intergenic
930582024 2:53223346-53223368 CTGAAATAAGTGAGGGACGAAGG - Intergenic
930582024 2:53223346-53223368 CTGAAATAAGTGAGGGACGAAGG - Intergenic
931711774 2:64993974-64993996 CTGAAATAAATGAGGGTAGATGG + Intronic
931711774 2:64993974-64993996 CTGAAATAAATGAGGGTAGATGG + Intronic
934656974 2:96121504-96121526 CTGGAAGGTTTGAAGGAAGATGG - Intergenic
934656974 2:96121504-96121526 CTGGAAGGTTTGAAGGAAGATGG - Intergenic
937458991 2:122069392-122069414 CTGTAATAATTGAGGGAGGGTGG - Intergenic
937458991 2:122069392-122069414 CTGTAATAATTGAGGGAGGGTGG - Intergenic
938705174 2:133917522-133917544 CACCATTATTTGAGGGAAGTGGG + Intergenic
938705174 2:133917522-133917544 CACCATTATTTGAGGGAAGTGGG + Intergenic
940012823 2:149072873-149072895 CTGAGACATTTGAGTGAAGATGG + Intronic
940012823 2:149072873-149072895 CTGAGACATTTGAGTGAAGATGG + Intronic
940458952 2:153938151-153938173 CTTGAATATGTGAGGGTAGAGGG + Intronic
940458952 2:153938151-153938173 CTTGAATATGTGAGGGTAGAGGG + Intronic
941045593 2:160671759-160671781 GTGCAGTACTTGAGGGAAGGTGG + Intergenic
941045593 2:160671759-160671781 GTGCAGTACTTGAGGGAAGGTGG + Intergenic
941370690 2:164659710-164659732 CTGCCATCTTTTAGGGAATAAGG + Intronic
941370690 2:164659710-164659732 CTGCCATCTTTTAGGGAATAAGG + Intronic
943587017 2:189752757-189752779 CTCCAAGATCTGAAGGAAGAAGG + Intronic
943587017 2:189752757-189752779 CTCCAAGATCTGAAGGAAGAAGG + Intronic
945803958 2:214467395-214467417 CTGCAAAAGTTGAGGAAACAGGG - Intronic
945803958 2:214467395-214467417 CTGCAAAAGTTGAGGAAACAGGG - Intronic
946944734 2:224808973-224808995 CTGAAGTATTTGAGGGAGCAAGG + Intronic
946944734 2:224808973-224808995 CTGAAGTATTTGAGGGAGCAAGG + Intronic
1169182619 20:3583227-3583249 TTGCAATTTTGGAGGGAAGAAGG - Intronic
1169182619 20:3583227-3583249 TTGCAATTTTGGAGGGAAGAAGG - Intronic
1169584526 20:7066164-7066186 TTGGAATATTTCATGGAAGAAGG - Intergenic
1169584526 20:7066164-7066186 TTGGAATATTTCATGGAAGAAGG - Intergenic
1169642793 20:7773632-7773654 TTGCAATATTTGAAGTAAAATGG - Intergenic
1169642793 20:7773632-7773654 TTGCAATATTTGAAGTAAAATGG - Intergenic
1170069714 20:12352939-12352961 CTCCAAGGATTGAGGGAAGAAGG + Intergenic
1170069714 20:12352939-12352961 CTCCAAGGATTGAGGGAAGAAGG + Intergenic
1171064664 20:22002893-22002915 CTGCCATATTAGAGGCAACATGG + Intergenic
1171064664 20:22002893-22002915 CTGCCATATTAGAGGCAACATGG + Intergenic
1172629015 20:36365965-36365987 CTGTAAAATTGGAGGGGAGAGGG + Intronic
1172629015 20:36365965-36365987 CTGTAAAATTGGAGGGGAGAGGG + Intronic
1175290450 20:57871711-57871733 CTGGAATATTTGTGGGAAAAAGG - Intergenic
1175290450 20:57871711-57871733 CTGGAATATTTGTGGGAAAAAGG - Intergenic
1175785860 20:61711499-61711521 CTGCTAGCTTTGAGGGTAGAAGG - Intronic
1175785860 20:61711499-61711521 CTGCTAGCTTTGAGGGTAGAAGG - Intronic
1179284368 21:39964111-39964133 CTGCACCATTTTAGGGGAGAGGG - Intergenic
1179284368 21:39964111-39964133 CTGCACCATTTTAGGGGAGAGGG - Intergenic
1181333386 22:22111835-22111857 CTGCATTATCTCAGGGAAAAAGG - Intergenic
1181333386 22:22111835-22111857 CTGCATTATCTCAGGGAAAAAGG - Intergenic
1181333477 22:22112638-22112660 CTGCATTATCTCAGGGAAAAAGG + Intergenic
1181333477 22:22112638-22112660 CTGCATTATCTCAGGGAAAAAGG + Intergenic
1181913745 22:26262381-26262403 CAGAAATCTTTGAGGGAAAAAGG + Intronic
1181913745 22:26262381-26262403 CAGAAATCTTTGAGGGAAAAAGG + Intronic
1182782857 22:32881637-32881659 CAGCTAGCTTTGAGGGAAGATGG - Intronic
1182782857 22:32881637-32881659 CAGCTAGCTTTGAGGGAAGATGG - Intronic
1182930023 22:34164585-34164607 CTGAAATCTATGAAGGAAGAGGG - Intergenic
1182930023 22:34164585-34164607 CTGAAATCTATGAAGGAAGAGGG - Intergenic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
1183461810 22:37955605-37955627 TAGCAATATTTGGGGGCAGATGG + Intronic
1183461810 22:37955605-37955627 TAGCAATATTTGGGGGCAGATGG + Intronic
1183914091 22:41102724-41102746 TGGAAAGATTTGAGGGAAGATGG + Intronic
1183914091 22:41102724-41102746 TGGAAAGATTTGAGGGAAGATGG + Intronic
1185223419 22:49640251-49640273 CTGCAAGATCTGAGGAGAGAGGG - Intronic
1185223419 22:49640251-49640273 CTGCAAGATCTGAGGAGAGAGGG - Intronic
950771622 3:15315881-15315903 CTGAAATATTTCAGGGTAAAGGG - Intronic
950771622 3:15315881-15315903 CTGAAATATTTCAGGGTAAAGGG - Intronic
950952333 3:17013665-17013687 CTGCATTATTTGAGAGCAGAAGG + Intronic
950952333 3:17013665-17013687 CTGCATTATTTGAGAGCAGAAGG + Intronic
951090051 3:18561889-18561911 CTGTAATAGTTGAGTCAAGAAGG - Intergenic
951090051 3:18561889-18561911 CTGTAATAGTTGAGTCAAGAAGG - Intergenic
954462254 3:50633996-50634018 CAGCAAAATTTGAGAGCAGAAGG - Intronic
954462254 3:50633996-50634018 CAGCAAAATTTGAGAGCAGAAGG - Intronic
954724361 3:52595077-52595099 TTGCAATGTTGGAGGAAAGAAGG + Intronic
954724361 3:52595077-52595099 TTGCAATGTTGGAGGAAAGAAGG + Intronic
957127429 3:76179812-76179834 CTTGAATATTTGATGGAAGGGGG + Intronic
957127429 3:76179812-76179834 CTTGAATATTTGATGGAAGGGGG + Intronic
957722479 3:84021258-84021280 CCCCAATATGTGAAGGAAGAGGG + Intergenic
957722479 3:84021258-84021280 CCCCAATATGTGAAGGAAGAGGG + Intergenic
959022889 3:101208085-101208107 AAGCACTATTTGAGGAAAGAGGG - Intergenic
959022889 3:101208085-101208107 AAGCACTATTTGAGGAAAGAGGG - Intergenic
960291953 3:115896805-115896827 CTTTCAAATTTGAGGGAAGAGGG + Intronic
960291953 3:115896805-115896827 CTTTCAAATTTGAGGGAAGAGGG + Intronic
960366062 3:116774128-116774150 CTGCTATATTAAAGGGAAGAAGG + Intronic
960366062 3:116774128-116774150 CTGCTATATTAAAGGGAAGAAGG + Intronic
961075445 3:123977755-123977777 CTGAAAATTTTGAGGGAAGATGG - Intronic
961075445 3:123977755-123977777 CTGAAAATTTTGAGGGAAGATGG - Intronic
961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG + Intronic
961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG + Intronic
961500392 3:127328464-127328486 CTGGAAAATTGGAGGAAAGAGGG + Intergenic
961500392 3:127328464-127328486 CTGGAAAATTGGAGGAAAGAGGG + Intergenic
962033052 3:131621590-131621612 CTGCAGTATCTGAGGGATAATGG - Intronic
962033052 3:131621590-131621612 CTGCAGTATCTGAGGGATAATGG - Intronic
962966049 3:140355549-140355571 CTGCTAAATTTCAGGGATGAAGG + Intronic
962966049 3:140355549-140355571 CTGCTAAATTTCAGGGATGAAGG + Intronic
963341757 3:144044004-144044026 ATGCTGTATTTGAGGCAAGAAGG - Intronic
963341757 3:144044004-144044026 ATGCTGTATTTGAGGCAAGAAGG - Intronic
964204196 3:154152888-154152910 CTGTAATATTGGAGAAAAGATGG - Exonic
964204196 3:154152888-154152910 CTGTAATATTGGAGAAAAGATGG - Exonic
964811535 3:160669683-160669705 TTGCACTATTGGAGGTAAGAGGG + Intergenic
964811535 3:160669683-160669705 TTGCACTATTGGAGGTAAGAGGG + Intergenic
964879355 3:161406412-161406434 CTGCAACATGTTAGGAAAGATGG - Intergenic
964879355 3:161406412-161406434 CTGCAACATGTTAGGAAAGATGG - Intergenic
965387323 3:168060325-168060347 CTGCAGTAATTGAGGCATGAGGG + Intronic
965387323 3:168060325-168060347 CTGCAGTAATTGAGGCATGAGGG + Intronic
965545482 3:169911292-169911314 CTGAAACATTTGATGAAAGATGG - Intergenic
965545482 3:169911292-169911314 CTGAAACATTTGATGAAAGATGG - Intergenic
966952700 3:184837141-184837163 TTGCAATATCTGAGGGTAGTGGG - Intronic
966952700 3:184837141-184837163 TTGCAATATCTGAGGGTAGTGGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968108869 3:196025750-196025772 CTACAATATTTAGGTGAAGAAGG - Intergenic
968108869 3:196025750-196025772 CTACAATATTTAGGTGAAGAAGG - Intergenic
968292839 3:197552293-197552315 CTGCAATAATCCAGGCAAGAAGG - Intronic
968292839 3:197552293-197552315 CTGCAATAATCCAGGCAAGAAGG - Intronic
969193715 4:5544088-5544110 CTGAAATCTATGAGAGAAGAGGG + Intronic
969193715 4:5544088-5544110 CTGAAATCTATGAGAGAAGAGGG + Intronic
969328928 4:6461767-6461789 CAGCACTTTCTGAGGGAAGAGGG - Intronic
969328928 4:6461767-6461789 CAGCACTTTCTGAGGGAAGAGGG - Intronic
969652588 4:8476677-8476699 CTGCAGTATTTCTGGGGAGAGGG - Intronic
969652588 4:8476677-8476699 CTGCAGTATTTCTGGGGAGAGGG - Intronic
970978776 4:22072976-22072998 CAGCAATATCTGAGAGCAGAAGG - Intergenic
970978776 4:22072976-22072998 CAGCAATATCTGAGAGCAGAAGG - Intergenic
971166712 4:24190960-24190982 CTGCCCTATTTTATGGAAGAGGG - Intergenic
971166712 4:24190960-24190982 CTGCCCTATTTTATGGAAGAGGG - Intergenic
971301652 4:25446908-25446930 CTCCAAGATTTCAGGGAAGTGGG + Intergenic
971301652 4:25446908-25446930 CTCCAAGATTTCAGGGAAGTGGG + Intergenic
971929033 4:33054189-33054211 CTGAACTATTTGAGTGTAGAAGG - Intergenic
971929033 4:33054189-33054211 CTGAACTATTTGAGTGTAGAAGG - Intergenic
974163557 4:58171008-58171030 CTGCAACATTTTATGCAAGAGGG + Intergenic
974163557 4:58171008-58171030 CTGCAACATTTTATGCAAGAGGG + Intergenic
974977166 4:68905658-68905680 CTGCAAAATTTAAGGGAAGGCGG - Intergenic
974977166 4:68905658-68905680 CTGCAAAATTTAAGGGAAGGCGG - Intergenic
974988512 4:69058507-69058529 CTGCAAAGTTTAAGGGAAGGCGG + Intronic
974988512 4:69058507-69058529 CTGCAAAGTTTAAGGGAAGGCGG + Intronic
975394326 4:73857243-73857265 GTCCAATATTTGAGGGCAGGAGG - Intergenic
975394326 4:73857243-73857265 GTCCAATATTTGAGGGCAGGAGG - Intergenic
975671498 4:76785487-76785509 TTTTAATCTTTGAGGGAAGATGG - Intergenic
975671498 4:76785487-76785509 TTTTAATCTTTGAGGGAAGATGG - Intergenic
977149282 4:93489234-93489256 CTGAAAAAATTGAAGGAAGACGG + Intronic
977149282 4:93489234-93489256 CTGAAAAAATTGAAGGAAGACGG + Intronic
977615426 4:99083097-99083119 CTGCAGTTTTGCAGGGAAGATGG + Intronic
977615426 4:99083097-99083119 CTGCAGTTTTGCAGGGAAGATGG + Intronic
978214966 4:106188968-106188990 CTGCATTATTTTATGGAAAAGGG - Intronic
978214966 4:106188968-106188990 CTGCATTATTTTATGGAAAAGGG - Intronic
979408274 4:120341696-120341718 ATGAAATATTTTGGGGAAGAGGG + Intergenic
979408274 4:120341696-120341718 ATGAAATATTTTGGGGAAGAGGG + Intergenic
980049407 4:128024168-128024190 CTGCATTATTTCATGGCAGAAGG + Intronic
980049407 4:128024168-128024190 CTGCATTATTTCATGGCAGAAGG + Intronic
980192633 4:129544448-129544470 CTGGAATATTATAGGTAAGAAGG + Intergenic
980192633 4:129544448-129544470 CTGGAATATTATAGGTAAGAAGG + Intergenic
980273190 4:130614336-130614358 CAGCAACATGTGAGTGAAGAAGG - Intergenic
980273190 4:130614336-130614358 CAGCAACATGTGAGTGAAGAAGG - Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
982332220 4:154193275-154193297 CTGCATTATTTGAAGGATGAAGG - Intergenic
982332220 4:154193275-154193297 CTGCATTATTTGAAGGATGAAGG - Intergenic
982887352 4:160798293-160798315 CTGGTATATTTGAGGTCAGATGG - Intergenic
982887352 4:160798293-160798315 CTGGTATATTTGAGGTCAGATGG - Intergenic
984784717 4:183556904-183556926 CTGGAAGATTTGATGGTAGATGG + Intergenic
984784717 4:183556904-183556926 CTGGAAGATTTGATGGTAGATGG + Intergenic
986732746 5:10647540-10647562 TTGCAATATTTGGGGGCAGTGGG + Intronic
986732746 5:10647540-10647562 TTGCAATATTTGGGGGCAGTGGG + Intronic
988195146 5:27995617-27995639 ATGCAAAATTTAAGGGTAGAAGG - Intergenic
988195146 5:27995617-27995639 ATGCAAAATTTAAGGGTAGAAGG - Intergenic
989482397 5:41947194-41947216 CTGGAATATTTGAGGTACAAAGG + Intergenic
989482397 5:41947194-41947216 CTGGAATATTTGAGGTACAAAGG + Intergenic
993544246 5:89191406-89191428 AGGCAATATTTGAGATAAGAGGG + Intergenic
993544246 5:89191406-89191428 AGGCAATATTTGAGATAAGAGGG + Intergenic
994827807 5:104738124-104738146 ATGCTATTTTTGAGGGAAAATGG + Intergenic
994827807 5:104738124-104738146 ATGCTATTTTTGAGGGAAAATGG + Intergenic
996266873 5:121551896-121551918 CTGATATATTTCAGGGAAAAGGG + Intergenic
996266873 5:121551896-121551918 CTGATATATTTCAGGGAAAAGGG + Intergenic
996273193 5:121633648-121633670 CTGGAATATTTGGAGGAAGCAGG - Intergenic
996273193 5:121633648-121633670 CTGGAATATTTGGAGGAAGCAGG - Intergenic
996897280 5:128500378-128500400 CTATATCATTTGAGGGAAGAGGG - Intronic
996897280 5:128500378-128500400 CTATATCATTTGAGGGAAGAGGG - Intronic
998384459 5:141748463-141748485 CTGCAATGTTTGAGGTATGCAGG - Intergenic
998384459 5:141748463-141748485 CTGCAATGTTTGAGGTATGCAGG - Intergenic
1000435274 5:161200251-161200273 AAGCATGATTTGAGGGAAGAAGG - Intergenic
1000435274 5:161200251-161200273 AAGCATGATTTGAGGGAAGAAGG - Intergenic
1000867238 5:166528817-166528839 GTGAAATATTTGAGGAAAGGGGG - Intergenic
1000867238 5:166528817-166528839 GTGAAATATTTGAGGAAAGGGGG - Intergenic
1002659615 5:180782799-180782821 CTTCAATATTTAAAGGAAAAAGG + Intergenic
1002659615 5:180782799-180782821 CTTCAATATTTAAAGGAAAAAGG + Intergenic
1003396095 6:5753220-5753242 CTGCAAACTTTGAAGAAAGATGG + Intronic
1003396095 6:5753220-5753242 CTGCAAACTTTGAAGAAAGATGG + Intronic
1003605393 6:7555452-7555474 CTGAAATATTTGGGGGTAGAAGG + Intronic
1003605393 6:7555452-7555474 CTGAAATATTTGGGGGTAGAAGG + Intronic
1006757242 6:36426947-36426969 CTACAATATTGGAGGGGAAAAGG - Intronic
1006757242 6:36426947-36426969 CTACAATATTGGAGGGGAAAAGG - Intronic
1007610564 6:43146286-43146308 CAGGAATCTTTGAGGGCAGAGGG + Intronic
1007610564 6:43146286-43146308 CAGGAATCTTTGAGGGCAGAGGG + Intronic
1008876451 6:56334892-56334914 CTGCTATATTTGATGGTAGAAGG - Intronic
1008876451 6:56334892-56334914 CTGCTATATTTGATGGTAGAAGG - Intronic
1008904482 6:56661438-56661460 CTGTAAAGCTTGAGGGAAGATGG - Intronic
1008904482 6:56661438-56661460 CTGTAAAGCTTGAGGGAAGATGG - Intronic
1009856363 6:69269884-69269906 TTGTAATATTTGATGGAAGAAGG - Intronic
1009856363 6:69269884-69269906 TTGTAATATTTGATGGAAGAAGG - Intronic
1010003466 6:70971196-70971218 CTGCCAGAATTAAGGGAAGAGGG - Intergenic
1010003466 6:70971196-70971218 CTGCCAGAATTAAGGGAAGAGGG - Intergenic
1010082286 6:71877844-71877866 CTGCACTACTTGAGGGACCAAGG + Intergenic
1010082286 6:71877844-71877866 CTGCACTACTTGAGGGACCAAGG + Intergenic
1010161257 6:72859555-72859577 CTGGAATAAGTGAGGGAAGCAGG - Intronic
1010161257 6:72859555-72859577 CTGGAATAAGTGAGGGAAGCAGG - Intronic
1011818785 6:91225391-91225413 GAGCAAAATTTGTGGGAAGAAGG - Intergenic
1011818785 6:91225391-91225413 GAGCAAAATTTGTGGGAAGAAGG - Intergenic
1012175972 6:96085337-96085359 CTGCCATCTATGAGGGAAGAGGG - Intronic
1012175972 6:96085337-96085359 CTGCCATCTATGAGGGAAGAGGG - Intronic
1012961266 6:105624597-105624619 TTACAATATTTGATGGAAGTTGG + Intergenic
1012961266 6:105624597-105624619 TTACAATATTTGATGGAAGTTGG + Intergenic
1013219121 6:108061394-108061416 CTGCTATAGTTTAGGCAAGAAGG - Intronic
1013219121 6:108061394-108061416 CTGCTATAGTTTAGGCAAGAAGG - Intronic
1013232766 6:108171737-108171759 CTCCAAGAGTTGAGGCAAGAAGG - Intronic
1013232766 6:108171737-108171759 CTCCAAGAGTTGAGGCAAGAAGG - Intronic
1013454020 6:110313698-110313720 CTTCAAGATTGGAGGGAGGATGG - Intronic
1013454020 6:110313698-110313720 CTTCAAGATTGGAGGGAGGATGG - Intronic
1014920320 6:127206933-127206955 TTGCAATATCTGATGAAAGAGGG - Intergenic
1014920320 6:127206933-127206955 TTGCAATATCTGATGAAAGAGGG - Intergenic
1014966837 6:127764570-127764592 CTGCATTATTTTAGGAAATAAGG - Intronic
1014966837 6:127764570-127764592 CTGCATTATTTTAGGAAATAAGG - Intronic
1017973848 6:159337011-159337033 ATGTTATATTTTAGGGAAGATGG - Intergenic
1017973848 6:159337011-159337033 ATGTTATATTTTAGGGAAGATGG - Intergenic
1021487478 7:21183232-21183254 CTGCAATATTTGGTAGTAGAGGG + Intergenic
1021487478 7:21183232-21183254 CTGCAATATTTGGTAGTAGAGGG + Intergenic
1022168464 7:27797368-27797390 CTGGAATATTTAAAGGAAAAGGG + Intronic
1022168464 7:27797368-27797390 CTGGAATATTTAAAGGAAAAGGG + Intronic
1022576266 7:31499994-31500016 CTGCAATGTCTCAGGGAAGTTGG - Intergenic
1022576266 7:31499994-31500016 CTGCAATGTCTCAGGGAAGTTGG - Intergenic
1023137666 7:37069068-37069090 CTGCAATCTTAGAGGAATGAAGG - Intronic
1023137666 7:37069068-37069090 CTGCAATCTTAGAGGAATGAAGG - Intronic
1024520047 7:50297577-50297599 CTGCAGCATTTTAGGAAAGAGGG + Intergenic
1024520047 7:50297577-50297599 CTGCAGCATTTTAGGAAAGAGGG + Intergenic
1027870208 7:83696907-83696929 CTGAAATATTGGTGGGTAGATGG + Intergenic
1027870208 7:83696907-83696929 CTGAAATATTGGTGGGTAGATGG + Intergenic
1027943765 7:84719507-84719529 CTGCTTTATTTTAGGGGAGAGGG + Intergenic
1027943765 7:84719507-84719529 CTGCTTTATTTTAGGGGAGAGGG + Intergenic
1030100681 7:105942414-105942436 GTGCAATAATTGAGGACAGAGGG + Intronic
1030100681 7:105942414-105942436 GTGCAATAATTGAGGACAGAGGG + Intronic
1033244985 7:139710306-139710328 CTGGAATAAATAAGGGAAGATGG - Intronic
1033244985 7:139710306-139710328 CTGGAATAAATAAGGGAAGATGG - Intronic
1033425070 7:141236534-141236556 CTGCAATATTTGAGGGAAGATGG - Intronic
1033425070 7:141236534-141236556 CTGCAATATTTGAGGGAAGATGG - Intronic
1033797762 7:144868465-144868487 CTGAAATATTTGAGGAGGGAAGG - Intergenic
1033797762 7:144868465-144868487 CTGAAATATTTGAGGAGGGAAGG - Intergenic
1034818428 7:154195233-154195255 CTGCCATATTTCAAGGAGGAAGG - Intronic
1034818428 7:154195233-154195255 CTGCCATATTTCAAGGAGGAAGG - Intronic
1037517998 8:19652938-19652960 CTGGAAAATTTGAGGGTAGAGGG - Intronic
1037517998 8:19652938-19652960 CTGGAAAATTTGAGGGTAGAGGG - Intronic
1038156900 8:24999971-24999993 CTGCACCAGTTCAGGGAAGAGGG - Intergenic
1038156900 8:24999971-24999993 CTGCACCAGTTCAGGGAAGAGGG - Intergenic
1038317122 8:26495193-26495215 ATGTAATATTTGAGGGTAGAGGG + Intronic
1038317122 8:26495193-26495215 ATGTAATATTTGAGGGTAGAGGG + Intronic
1039536245 8:38316512-38316534 TTGCAAAATTTGGGGGAAAATGG - Intronic
1039536245 8:38316512-38316534 TTGCAAAATTTGGGGGAAAATGG - Intronic
1041746199 8:61211512-61211534 CTGAAATGTTTGTGGGATGAAGG + Intronic
1041746199 8:61211512-61211534 CTGAAATGTTTGTGGGATGAAGG + Intronic
1041926293 8:63240777-63240799 TTCCCATATTTGAGGGAAAAGGG + Intergenic
1041926293 8:63240777-63240799 TTCCCATATTTGAGGGAAAAGGG + Intergenic
1042337791 8:67646752-67646774 GGGGAAGATTTGAGGGAAGAGGG + Intronic
1042337791 8:67646752-67646774 GGGGAAGATTTGAGGGAAGAGGG + Intronic
1042725714 8:71874355-71874377 ATGCAATATTTGAGGACACATGG + Intronic
1042725714 8:71874355-71874377 ATGCAATATTTGAGGACACATGG + Intronic
1042756802 8:72223159-72223181 CTGCAGAACTTGAGGGTAGATGG + Intergenic
1042756802 8:72223159-72223181 CTGCAGAACTTGAGGGTAGATGG + Intergenic
1043400312 8:79877957-79877979 CTGCAATATGGAAGGCAAGAAGG - Intergenic
1043400312 8:79877957-79877979 CTGCAATATGGAAGGCAAGAAGG - Intergenic
1044484072 8:92729415-92729437 CTACTATATTTTTGGGAAGATGG - Intergenic
1044484072 8:92729415-92729437 CTACTATATTTTTGGGAAGATGG - Intergenic
1046558358 8:115805748-115805770 CAGCAATATTTCAGGGAAGGTGG - Intronic
1046558358 8:115805748-115805770 CAGCAATATTTCAGGGAAGGTGG - Intronic
1046695997 8:117340313-117340335 CTGCAGTATGCCAGGGAAGAAGG + Intergenic
1046695997 8:117340313-117340335 CTGCAGTATGCCAGGGAAGAAGG + Intergenic
1047205417 8:122799256-122799278 CTGCAAGGTTTGAGGGAAGTGGG + Intronic
1047205417 8:122799256-122799278 CTGCAAGGTTTGAGGGAAGTGGG + Intronic
1048518950 8:135136414-135136436 CTGAATGATGTGAGGGAAGAGGG + Intergenic
1048518950 8:135136414-135136436 CTGAATGATGTGAGGGAAGAGGG + Intergenic
1049937761 9:516059-516081 CAATAATATTTAAGGGAAGATGG - Intronic
1049937761 9:516059-516081 CAATAATATTTAAGGGAAGATGG - Intronic
1050755275 9:8994921-8994943 CTGCAACATTTGGGGAAAAATGG + Intronic
1050755275 9:8994921-8994943 CTGCAACATTTGGGGAAAAATGG + Intronic
1051228012 9:14922850-14922872 ATTCAATCTTTGAGGCAAGAGGG + Intergenic
1051228012 9:14922850-14922872 ATTCAATCTTTGAGGCAAGAGGG + Intergenic
1052163876 9:25297244-25297266 CTGCAAAAATTCAGGGAAGGGGG + Intergenic
1052163876 9:25297244-25297266 CTGCAAAAATTCAGGGAAGGGGG + Intergenic
1053550563 9:39075115-39075137 CTGCAATATTTTTGGTAATAGGG - Intronic
1053550563 9:39075115-39075137 CTGCAATATTTTTGGTAATAGGG - Intronic
1053814672 9:41895214-41895236 CTGCAATATTTTTGGTAATAGGG - Intronic
1053814672 9:41895214-41895236 CTGCAATATTTTTGGTAATAGGG - Intronic
1054615924 9:67292227-67292249 CTGCAATATTTTTGGTAATAGGG + Intergenic
1054615924 9:67292227-67292249 CTGCAATATTTTTGGTAATAGGG + Intergenic
1055266998 9:74505353-74505375 CTGAAATATTTTGGGGAAGATGG - Intronic
1055266998 9:74505353-74505375 CTGAAATATTTTGGGGAAGATGG - Intronic
1055494178 9:76838205-76838227 CTCAAATATTTTATGGAAGAAGG + Intronic
1055494178 9:76838205-76838227 CTCAAATATTTTATGGAAGAAGG + Intronic
1055558897 9:77502991-77503013 CTGGAATATATGAGGCAATAAGG + Intronic
1055558897 9:77502991-77503013 CTGGAATATATGAGGCAATAAGG + Intronic
1058011712 9:99985171-99985193 CTGCAATAGTTGTGGTAGGATGG - Intronic
1058011712 9:99985171-99985193 CTGCAATAGTTGTGGTAGGATGG - Intronic
1059263532 9:113003606-113003628 ATGCTATATTTAAGGGAATAAGG + Intergenic
1059263532 9:113003606-113003628 ATGCTATATTTAAGGGAATAAGG + Intergenic
1059860530 9:118455877-118455899 CTACAAGATGTGAGGGAAGCAGG - Intergenic
1059860530 9:118455877-118455899 CTACAAGATGTGAGGGAAGCAGG - Intergenic
1060991673 9:127853335-127853357 CTGACAGATTTGGGGGAAGAGGG - Intronic
1060991673 9:127853335-127853357 CTGACAGATTTGGGGGAAGAGGG - Intronic
1061471470 9:130829653-130829675 TTGAAGTATTTGAGGGAAAATGG + Intronic
1061471470 9:130829653-130829675 TTGAAGTATTTGAGGGAAAATGG + Intronic
1186600260 X:11029160-11029182 CTGAGCTATATGAGGGAAGATGG + Intergenic
1186600260 X:11029160-11029182 CTGAGCTATATGAGGGAAGATGG + Intergenic
1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG + Intronic
1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG + Intronic
1191870660 X:65742341-65742363 CTACAATATGTGAGGGTAGTAGG - Intergenic
1191870660 X:65742341-65742363 CTACAATATGTGAGGGTAGTAGG - Intergenic
1193126188 X:77872713-77872735 CTGTAAAATTTCAGGAAAGAAGG - Intronic
1193126188 X:77872713-77872735 CTGTAAAATTTCAGGAAAGAAGG - Intronic
1193500457 X:82267616-82267638 TTGTAATTTTTGAGGAAAGAAGG + Intergenic
1193500457 X:82267616-82267638 TTGTAATTTTTGAGGAAAGAAGG + Intergenic
1193663212 X:84282258-84282280 GTGTAATATTTCAGGGAAGCAGG + Intergenic
1193663212 X:84282258-84282280 GTGTAATATTTCAGGGAAGCAGG + Intergenic
1194183807 X:90746315-90746337 ATGCAAGTTTTGAGGGGAGAGGG + Intergenic
1194183807 X:90746315-90746337 ATGCAAGTTTTGAGGGGAGAGGG + Intergenic
1194584682 X:95717882-95717904 CTTCAATATTTAAGGGGAAAAGG + Intergenic
1194584682 X:95717882-95717904 CTTCAATATTTAAGGGGAAAAGG + Intergenic
1194851917 X:98880937-98880959 CTGCCATATTCCTGGGAAGAGGG + Intergenic
1194851917 X:98880937-98880959 CTGCCATATTCCTGGGAAGAGGG + Intergenic
1197632857 X:128882119-128882141 CTTAAATATTTGTTGGAAGAAGG + Intergenic
1197632857 X:128882119-128882141 CTTAAATATTTGTTGGAAGAAGG + Intergenic
1197922368 X:131609016-131609038 CTGTAAGCTTTGAGGGAAGCAGG - Intergenic
1197922368 X:131609016-131609038 CTGTAAGCTTTGAGGGAAGCAGG - Intergenic
1199365881 X:146982174-146982196 CTGTATTATTTGAAGGTAGATGG - Intergenic
1199365881 X:146982174-146982196 CTGTATTATTTGAAGGTAGATGG - Intergenic
1200530403 Y:4328265-4328287 ATGCAAGTTTTGAGGGGAGAGGG + Intergenic
1200530403 Y:4328265-4328287 ATGCAAGTTTTGAGGGGAGAGGG + Intergenic