ID: 1033430291

View in Genome Browser
Species Human (GRCh38)
Location 7:141283004-141283026
Sequence TAGAGGAAGCATTATTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033430291_1033430296 -8 Left 1033430291 7:141283004-141283026 CCAACCTAATAATGCTTCCTCTA 0: 1
1: 0
2: 1
3: 12
4: 196
Right 1033430296 7:141283019-141283041 TTCCTCTAATCTATGAGGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 154
1033430291_1033430295 -9 Left 1033430291 7:141283004-141283026 CCAACCTAATAATGCTTCCTCTA 0: 1
1: 0
2: 1
3: 12
4: 196
Right 1033430295 7:141283018-141283040 CTTCCTCTAATCTATGAGGGAGG No data
1033430291_1033430298 14 Left 1033430291 7:141283004-141283026 CCAACCTAATAATGCTTCCTCTA 0: 1
1: 0
2: 1
3: 12
4: 196
Right 1033430298 7:141283041-141283063 GACTATTACTATCCCCGTTTTGG 0: 1
1: 0
2: 1
3: 8
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033430291 Original CRISPR TAGAGGAAGCATTATTAGGT TGG (reversed) Intronic
909151648 1:72013210-72013232 CAGAGGCAGCATTATTTTGTGGG + Intronic
909352399 1:74670403-74670425 TAGAGGTAGCATTGCTAGGAAGG - Intronic
910013900 1:82497490-82497512 TACAGGAAGCATGATTGGGGAGG + Intergenic
910182682 1:84503371-84503393 AGGATGAAGAATTATTAGGTTGG - Intronic
910753420 1:90659337-90659359 TAGAGGAAACAATATGAGTTTGG - Intergenic
911155250 1:94629869-94629891 TAGAGGATGCAGTCTTAGGGCGG - Intergenic
915171871 1:153983629-153983651 GAGAGGAAGAATTATTCCGTTGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
917205036 1:172563050-172563072 TACAGGAAGCATGGTTAGGGAGG - Intronic
917983402 1:180289567-180289589 TAGAAGTAGAATTACTAGGTTGG - Intronic
918679919 1:187341132-187341154 TAGAGGAAGTATTACTGGGGAGG + Intergenic
919162270 1:193845925-193845947 CAGTGGAAGAACTATTAGGTAGG - Intergenic
921507257 1:215987373-215987395 TATAGGAACCCTTATTATGTAGG - Intronic
921555957 1:216599555-216599577 TAGAGTGAACATTATTAAGTGGG - Intronic
922819384 1:228473645-228473667 TAGAGTAAGAAATGTTAGGTAGG - Intergenic
924257011 1:242192691-242192713 AAGAGAAAACATGATTAGGTGGG + Intronic
1071392159 10:85186619-85186641 TACAGGAAGCATTATCAAATGGG - Intergenic
1073298892 10:102458613-102458635 CTGAGGAGGAATTATTAGGTAGG + Intergenic
1077729931 11:4719453-4719475 TACAGGAGGGATTAGTAGGTAGG - Intronic
1077960717 11:7073869-7073891 TTGTGGAAGCTTCATTAGGTAGG + Intergenic
1081587896 11:44399805-44399827 TAGAGGAAGGATTTCTTGGTGGG + Intergenic
1085142002 11:74154154-74154176 TAGGGGAAGATTTCTTAGGTAGG + Intronic
1085600614 11:77853320-77853342 TACAGGAAGCATTGCTAGGGAGG + Intronic
1088192486 11:107241156-107241178 TAGAGGAAGCATAACTGGGGAGG + Intergenic
1089377403 11:118004362-118004384 TAAAGGAAGCATTATCAAGATGG + Intergenic
1089658158 11:119967120-119967142 TGGAACAAGAATTATTAGGTTGG + Intergenic
1091315589 11:134611745-134611767 TAGGGGAAGCATCATTTGCTGGG + Intergenic
1093002285 12:14010979-14011001 TAAAAGAAACATTATGAGGTTGG + Intergenic
1094237697 12:28187382-28187404 TAGAGGAAGGATTATTGGGTAGG - Intronic
1095579127 12:43775728-43775750 TAGAAAAAGAATTACTAGGTAGG + Intronic
1095693681 12:45119786-45119808 TATAGGGAGTTTTATTAGGTTGG + Intergenic
1096307222 12:50488351-50488373 GAGTGGAAGCATGATTATGTAGG + Intergenic
1097274003 12:57799114-57799136 TATGGGAAGCAGTATTAGGGTGG + Intronic
1097640861 12:62179813-62179835 ACGAGGAAGAATTATCAGGTAGG - Intronic
1100682641 12:96945046-96945068 TAGAGATAGAATTATTATGTAGG + Intronic
1102800119 12:115724810-115724832 TGAAGGAAGGAGTATTAGGTGGG + Intergenic
1104153646 12:126109366-126109388 CAGAGGAGAGATTATTAGGTTGG + Intergenic
1105397584 13:20054036-20054058 TAGAGGGAGCATTATTAATAGGG + Intronic
1106125780 13:26898989-26899011 TGCAGGAAGAATCATTAGGTTGG - Intergenic
1106236213 13:27862685-27862707 TAGAGGAGGCATTTTCAGGTTGG + Intergenic
1107195249 13:37643485-37643507 TAGAGAATGCAGTATTAGATGGG + Intronic
1107811768 13:44207297-44207319 TAAAGTAAGCATTTTTAAGTAGG + Intergenic
1108478266 13:50842803-50842825 TGGAGGAAGCGTTATTAATTTGG + Intronic
1109749885 13:66676466-66676488 TACAGGAAGTATTATTGGTTAGG - Intronic
1110277855 13:73660087-73660109 TTGAAGAAGCAGTATTAAGTGGG - Intergenic
1111584825 13:90270286-90270308 TACAGGAAGCATGATTGGGCAGG + Intergenic
1112512075 13:100018965-100018987 TATAGGAAGCATAATTGGGGAGG - Intergenic
1113226665 13:108167497-108167519 TAGAGGAAGAATATTTAGATTGG - Intergenic
1114967173 14:27976881-27976903 TAGAGGAAGCATTACTTTTTTGG - Intergenic
1115662861 14:35514133-35514155 TAGAAAAAGAATTATTTGGTAGG - Intergenic
1116388792 14:44366130-44366152 TAGAGGAAACATTATTTCTTCGG - Intergenic
1116658352 14:47676861-47676883 TACAGGAAACATTATTATCTCGG - Intergenic
1117225723 14:53656770-53656792 CAGAGGAAGCAGGACTAGGTGGG + Intergenic
1118603177 14:67484625-67484647 TAGAAGAAGCATTCATAGGCCGG + Intronic
1119290066 14:73488600-73488622 TAGAGGAAGCATGGTTGGGGAGG - Intronic
1119766442 14:77192449-77192471 TAGAGGGAGGATTGTTGGGTAGG + Intronic
1121959844 14:98249131-98249153 TTGGGGAAGCTTTATTAGGAAGG + Intergenic
1123777310 15:23592372-23592394 TATAGGAAGCATTGTCATGTAGG - Intronic
1124950386 15:34313633-34313655 GAGAGGAAGCAGTCTTATGTTGG + Intronic
1128536437 15:68494182-68494204 CAGAGGAAGCATTCTGAGGAAGG - Intergenic
1130544138 15:84842421-84842443 TAGAGGAAGCAGTTATAGATCGG + Intronic
1130799100 15:87242954-87242976 TTGAGAAAGAATTATTGGGTTGG + Intergenic
1131893818 15:97004167-97004189 TAGTGGAAGTTTTATTTGGTAGG + Intergenic
1134221800 16:12360779-12360801 AAGAGGAAGCATATTTAGGAAGG + Intronic
1137927197 16:52551320-52551342 TAGAGGAAGAATTCTTACCTGGG + Intergenic
1138388508 16:56652856-56652878 CAGAGGATGCATTTTTAGGCTGG - Intronic
1140468051 16:75197832-75197854 TAGAGGAAGCGTAGATAGGTCGG - Intergenic
1145230174 17:21168171-21168193 TAGTGGAAGAACTATTAGGAGGG + Intronic
1148444705 17:47730673-47730695 TACAGGGAGCATTATGAGGCTGG - Intergenic
1150586785 17:66525928-66525950 TATAGGAAGTATTATTAGCAAGG - Intronic
1155583203 18:27335697-27335719 TACAGGAAGCATGACTAGGGAGG + Intergenic
1155789209 18:29944328-29944350 GGGAGGAAGCATGATTTGGTAGG + Intergenic
1155928149 18:31679706-31679728 TCCAGGAAGAATTAGTAGGTAGG - Intronic
1156027798 18:32675736-32675758 TAGAAAAATAATTATTAGGTTGG - Intronic
1156544413 18:37949305-37949327 TCTATGAAGCTTTATTAGGTTGG - Intergenic
1156565180 18:38180191-38180213 TAGAAAAAGCATAATTAGGCCGG - Intergenic
1156632264 18:38984360-38984382 TACAGGAAGCCTGGTTAGGTAGG - Intergenic
1157544164 18:48536280-48536302 CAGAGGAGGCAGCATTAGGTGGG + Intergenic
1157582516 18:48781745-48781767 GAGAGGAAGCATTCTTAGTGCGG + Intronic
1158429436 18:57371926-57371948 AATTGGAAGCATTATTAGGTTGG - Intergenic
1161839065 19:6667742-6667764 TAGAGAAAGGTTTAATAGGTCGG + Intronic
1163083840 19:14964459-14964481 TAGAGGAAGCATTCATATGTTGG - Intronic
1167109142 19:47448532-47448554 TGGAGGAGGCATTAGCAGGTGGG + Intronic
926221316 2:10937422-10937444 TACAGGAAGCATGATTGGGGAGG + Intergenic
928013192 2:27629660-27629682 TAGGGGAAGCTTTGTTAGATGGG + Intronic
933428283 2:82141270-82141292 TACAGGAAGCATGACTAGGGAGG - Intergenic
936669835 2:114644312-114644334 CAGAGGAAACTATATTAGGTAGG - Intronic
938624238 2:133091143-133091165 TACAGGAAGCATGGTTAGGGAGG - Intronic
939605300 2:144247294-144247316 TATAGGAAGAATTATTAAGAGGG + Intronic
941030399 2:160504581-160504603 TAGAGGAATCATGATTTGGATGG + Intergenic
941215089 2:162696776-162696798 CAGAGGAAGCATTTTTACTTTGG - Intronic
942611204 2:177744199-177744221 AAGAGGAAGAGTTATTAAGTTGG + Intronic
943405140 2:187473267-187473289 TAGAGATAGCTTTATTAGGTAGG + Intronic
943503415 2:188721596-188721618 TAGAGGAAGCAGGATTGGGCAGG - Intergenic
943508176 2:188788403-188788425 TAGACGAATATTTATTAGGTCGG + Intronic
943631547 2:190258259-190258281 TACAGGAAGCATGATTGGGGAGG - Intronic
945229792 2:207574391-207574413 TGGAAGAAGCATTTTTAGATAGG - Intronic
945683103 2:212937282-212937304 TAGAGTAAGCATTATAATGTAGG + Intergenic
945966396 2:216191958-216191980 TAGAGGAAGCAAAATTGGTTTGG + Intronic
946974960 2:225138541-225138563 AAGAGGAAGCAGAATTGGGTAGG + Intergenic
946995173 2:225383219-225383241 TACAGGAAGCATGATTGGGGAGG - Intergenic
947052775 2:226065093-226065115 TATAGGAACTATTATTAGCTTGG - Intergenic
1169837071 20:9892162-9892184 TAGTGGAAGCAGTACTATGTGGG - Intergenic
1170127473 20:12980746-12980768 AATAGGTAACATTATTAGGTTGG + Intergenic
1171430797 20:25082155-25082177 TAGAGGAAGCTTTATAGGATTGG + Exonic
1171983914 20:31646086-31646108 GAGAGGAAGCAGGAGTAGGTTGG + Intergenic
1175653096 20:60745962-60745984 TACAGGAAGCATGGTTAGGGAGG + Intergenic
1177647959 21:23923421-23923443 TTGAGGAGGTATTCTTAGGTTGG - Intergenic
1178064920 21:28894051-28894073 AAGTGGAACCATTGTTAGGTTGG - Intergenic
949220216 3:1624322-1624344 GAGAGGAATCATTATTAGAGAGG + Intergenic
950829791 3:15861601-15861623 TAGAGGAGAGATTATTTGGTGGG - Intergenic
952331931 3:32371514-32371536 TAGAGGAAGTGTTTTTAGATAGG + Intergenic
953530313 3:43734642-43734664 TGGAAGAAGCATTATTATCTTGG + Intergenic
956609654 3:71109770-71109792 TTCAGTAAGCTTTATTAGGTTGG - Intronic
958184004 3:90096307-90096329 TTGAGGTAGCATTATTTGATAGG - Intergenic
958748349 3:98164624-98164646 TAGAGGAAGCATGGTTGGGGGGG + Intergenic
959108288 3:102091523-102091545 TGGAGGAAGCATTACTTAGTTGG - Intergenic
960330447 3:116353503-116353525 TAGAGGAACCCAAATTAGGTGGG - Intronic
962031069 3:131600733-131600755 TAGAGGAAGCCTTATTAGTCTGG - Intronic
963572703 3:147017116-147017138 TACAGGAAGCATGGTTAGGGAGG - Intergenic
965370105 3:167851644-167851666 GAGAGGAAACATTATTAACTAGG + Intergenic
965970831 3:174554520-174554542 TGGAGGAAACATTAAAAGGTGGG - Intronic
966237820 3:177721866-177721888 AAAAGCAAGCTTTATTAGGTAGG + Intergenic
972858536 4:43137973-43137995 TACAGGAAGCATGATTGGGGAGG + Intergenic
973301925 4:48594879-48594901 TAAAGGAAGGATTATTAGAGGGG - Intronic
973920113 4:55675665-55675687 TAGAGGAAGGACCATCAGGTGGG - Intergenic
977990328 4:103433218-103433240 TAGAGAGAGGATTATTAGTTTGG + Intergenic
978095253 4:104768559-104768581 TAAAGGATGCATTATTAAGTTGG - Intergenic
978930443 4:114304570-114304592 TAAAGGAAACATTAATGGGTTGG - Intergenic
980273833 4:130622263-130622285 TACATTAAGTATTATTAGGTAGG + Intergenic
980383432 4:132057324-132057346 TAGAGGAAGCATGGTTGGGGAGG - Intergenic
980448452 4:132942141-132942163 TACAGGAAGCATGATTGGGGAGG + Intergenic
981219302 4:142213081-142213103 TAGTAGAAGCAATATTATGTGGG + Intronic
984223398 4:177005414-177005436 TGGAAGAAGCGTTATTAGCTAGG + Intergenic
984283075 4:177695971-177695993 TAGATTAAGAATGATTAGGTCGG + Intergenic
984812703 4:183808663-183808685 TAGAGTAACCATTATTATCTGGG - Intergenic
986627362 5:9735000-9735022 TACAGGAAGCATTGCTAGGGAGG + Intergenic
987348712 5:17001940-17001962 TAGACCGAGCATCATTAGGTCGG - Intergenic
987466013 5:18272924-18272946 TACAGGAAGTACCATTAGGTTGG - Intergenic
987513845 5:18880290-18880312 TAGAGGAAGCAGGATTATTTTGG - Intergenic
988647069 5:33106441-33106463 TACAGGAAGCATGATTGGGAAGG + Intergenic
989595202 5:43150213-43150235 TAGAGGAAACATTATTATACTGG + Intronic
990164952 5:52984594-52984616 AAGAGAAACTATTATTAGGTTGG + Intergenic
990201998 5:53386317-53386339 GAGAGGAGGCCTTATTAGGAGGG - Intergenic
990731191 5:58811149-58811171 TACAGGATGCATTATTTGATAGG + Intronic
992959767 5:81946774-81946796 TAGAGGAAGCATGACTGGGGAGG - Intergenic
993219667 5:85075813-85075835 ATGAGGAAGCATTTTTATGTGGG + Intergenic
993588453 5:89761986-89762008 TAAAGGAATGATTATTAAGTTGG - Intergenic
993824566 5:92666644-92666666 TGGAGGATGCATTATTATGGGGG - Intergenic
994195904 5:96922875-96922897 CAGAGAAGCCATTATTAGGTAGG + Intronic
995443063 5:112213072-112213094 AAGATGAAGCATTATTTGGATGG + Intronic
996981747 5:129504193-129504215 TAGAGGAGGCATTATGAGTGGGG - Intronic
1000739280 5:164946131-164946153 AAAAGGAAGTTTTATTAGGTCGG - Intergenic
1001904853 5:175463180-175463202 GAGAGGAAGCAGGATTAGGCAGG + Intergenic
1003931766 6:10930857-10930879 AAAGGGAAGCATTCTTAGGTAGG + Intronic
1005261260 6:24063309-24063331 TAGAGGAAGCAAAATCAGCTAGG + Intergenic
1005594557 6:27367195-27367217 TCGAGGAGGCATTTTGAGGTTGG + Intergenic
1005660041 6:27988406-27988428 TAAAGAAAGAATTATTAGGCTGG - Intergenic
1005859647 6:29890366-29890388 TAGAGGAAGAATTGTGGGGTGGG - Intergenic
1005867217 6:29945161-29945183 TAGAGGAGGAATTGTGAGGTGGG - Intronic
1006278674 6:33028757-33028779 AAGAGGAAGCAGTAAAAGGTGGG + Intergenic
1007435584 6:41808328-41808350 TTGAAGAAGCATTATTGGGAGGG - Intronic
1008390482 6:50945649-50945671 TAGACAAAGCATTCTTAGATAGG + Intergenic
1010235331 6:73570496-73570518 CAGAGGAAGCATTAATGAGTAGG + Intergenic
1012627079 6:101417484-101417506 TAGAGGAGGCATGTTTAGGAGGG - Intronic
1013431491 6:110060491-110060513 CAGAGGAAACATTACCAGGTAGG - Intergenic
1016646211 6:146411457-146411479 TAGAGGAAGCCTTATGAGCTTGG + Intronic
1017996161 6:159533329-159533351 TAGAAAAACCATTATTAAGTAGG - Intergenic
1018614298 6:165671607-165671629 TAGAGGCAGCTTTAATAGCTAGG + Intronic
1021275180 7:18641349-18641371 TAGAGGAAGGAGCATTATGTTGG - Intronic
1022255419 7:28651875-28651897 TAGAGGAAGCACCGCTAGGTAGG + Intronic
1024428557 7:49259593-49259615 TAGATCAAGCATTAATAGATTGG - Intergenic
1024654322 7:51436486-51436508 TAGAGAAAACATTATTATGGAGG - Intergenic
1024810235 7:53202461-53202483 TAGAGGAAGCAGTTTTAGTATGG - Intergenic
1028210941 7:88073631-88073653 AAGAGGAAAGATTATTAGGTTGG + Intronic
1030205469 7:106948539-106948561 TAAAGGAAGTATTAATAGTTTGG - Intergenic
1031545139 7:123043399-123043421 AAGAGGAGGCATTACTAGATAGG + Intergenic
1033430291 7:141283004-141283026 TAGAGGAAGCATTATTAGGTTGG - Intronic
1035037784 7:155906664-155906686 TAGAGACAGCTTTATCAGGTGGG + Intergenic
1036532264 8:9602757-9602779 TAAATGAAACATTATTAAGTTGG - Intronic
1037026163 8:14040656-14040678 TGGAGGAAGCGTTTTTAGGAGGG + Intergenic
1037807008 8:22063645-22063667 TAGAGAAAGCAGCATAAGGTGGG - Intronic
1038075736 8:24071555-24071577 GAGAGAAAGCATAATTAGATTGG - Intergenic
1038210671 8:25516712-25516734 TAGATTAAGCATTATAAGGGGGG - Intergenic
1042399499 8:68330201-68330223 TAGAGGAAACATTATGAAGTGGG + Intronic
1043280749 8:78462857-78462879 AAGAGGAAGCATGAGTAGGATGG - Intergenic
1043284656 8:78514392-78514414 TACAGGAAGCATGATTGGGGAGG - Intergenic
1044776262 8:95692206-95692228 AACATGAAGTATTATTAGGTTGG - Intergenic
1046213705 8:111114573-111114595 TGGAGCAAGCCTTGTTAGGTTGG + Intergenic
1050139303 9:2501006-2501028 TTGAAGAAGCATTAATAGTTTGG - Intergenic
1053086877 9:35232475-35232497 TATAGGAAGCAATATAAGCTGGG - Intronic
1055920544 9:81455538-81455560 TAAAGAAAGCATTATAAGGCTGG + Intergenic
1057252149 9:93512183-93512205 TAGAGGAACATTTGTTAGGTTGG + Intronic
1057933770 9:99219811-99219833 TAGAGGAAAAATTATTGGCTTGG - Intronic
1058598484 9:106642988-106643010 TAGAGGAATCCTTGTTAGGTGGG + Intergenic
1058850262 9:109005036-109005058 TAAAAGAAGGACTATTAGGTGGG - Intronic
1187044339 X:15631351-15631373 TAAAGGAAGCATTCTGAAGTAGG + Intronic
1188127810 X:26391818-26391840 TAGAGAAAGTATTAATAGCTGGG - Intergenic
1189407825 X:40741564-40741586 TAAATGAAGAAATATTAGGTTGG - Intergenic
1189790324 X:44597567-44597589 TATAGGAAGCATTACTGGGGAGG - Intergenic
1194665589 X:96674111-96674133 GAGATGAAGAATTATTAGCTTGG - Intergenic
1195724566 X:107900992-107901014 TAGAGGAAGGATTATGAGGATGG + Intronic
1196986277 X:121275787-121275809 TACAGGAAGCATGACTAGGGAGG - Intergenic
1198197107 X:134373809-134373831 AAGAGGAAGAATTGTTAGGATGG + Intronic
1198488624 X:137114902-137114924 TAGAGGGAGAAGAATTAGGTTGG - Intergenic
1199802367 X:151264314-151264336 TACAGGAAGCATGGTTGGGTAGG - Intergenic
1202171951 Y:22059313-22059335 TAGAGAAAGAAAAATTAGGTGGG - Intergenic
1202219411 Y:22527059-22527081 TAGAGAAAGAAAAATTAGGTGGG + Intergenic
1202323767 Y:23669022-23669044 TAGAGAAAGAAAAATTAGGTGGG - Intergenic
1202547004 Y:26001032-26001054 TAGAGAAAGAAAAATTAGGTGGG + Intergenic