ID: 1033434158

View in Genome Browser
Species Human (GRCh38)
Location 7:141317390-141317412
Sequence CTGATGCACCTGCAGCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 385}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033434158_1033434161 25 Left 1033434158 7:141317390-141317412 CCACCTGGCTGCAGGTGCATCAG 0: 1
1: 0
2: 0
3: 40
4: 385
Right 1033434161 7:141317438-141317460 GATGAGCAAGCAAGAAGGTCAGG No data
1033434158_1033434160 20 Left 1033434158 7:141317390-141317412 CCACCTGGCTGCAGGTGCATCAG 0: 1
1: 0
2: 0
3: 40
4: 385
Right 1033434160 7:141317433-141317455 TAGCTGATGAGCAAGCAAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033434158 Original CRISPR CTGATGCACCTGCAGCCAGG TGG (reversed) Intronic
900233887 1:1577415-1577437 CAGATGCAGCTGCTCCCAGGAGG - Intergenic
900953878 1:5875092-5875114 CTGCTGCGCCTGCAGACAAGAGG + Exonic
900973302 1:6003208-6003230 CTGGAGCCCCTGCAGCCAGCAGG - Intronic
901780284 1:11589782-11589804 CTGACCCACCTCCAGCCTGGGGG - Intergenic
901784238 1:11614055-11614077 CAGATGCAGCTGAAACCAGGAGG - Intergenic
902248531 1:15138072-15138094 CTGGGGCCCCAGCAGCCAGGAGG + Intergenic
902270086 1:15297697-15297719 CTCATGCAACTGCAGTCAGCCGG + Intronic
903180182 1:21601428-21601450 CTGATGGACCTGCGGCCGTGAGG + Intronic
905010159 1:34741823-34741845 CTGGAGGACCTGGAGCCAGGTGG + Intronic
905307716 1:37030960-37030982 CTGCTGGACTTGGAGCCAGGAGG - Intronic
905693013 1:39956322-39956344 CAGCTGCGCCTGCAGCCAGCTGG + Intronic
905947513 1:41916537-41916559 CTAAGACACCTGCAGGCAGGAGG - Intronic
906505804 1:46378756-46378778 CTCATGTATCTGCAGTCAGGTGG + Intergenic
907761706 1:57367919-57367941 CGGCTGCAGCTGCACCCAGGAGG - Intronic
908624626 1:66027185-66027207 CTGAGGCCTCTGCAGCCATGTGG - Intronic
908624907 1:66029118-66029140 CTGAGGCCTCTGCAGCCATGTGG - Intronic
910929387 1:92427855-92427877 CTGAGGCACTTGAACCCAGGAGG + Intergenic
911099030 1:94079334-94079356 CTGATTCACCTGCAGCACGAAGG - Exonic
914842773 1:151262202-151262224 CTGCTGGGCCTGCAGCCTGGTGG - Exonic
915204631 1:154261020-154261042 CTGGTGTAACTGTAGCCAGGAGG - Exonic
916501070 1:165387296-165387318 CTGAGGCAGGTGGAGCCAGGAGG - Intergenic
916681600 1:167109743-167109765 CTGGTTGACCTCCAGCCAGGAGG - Intronic
916721457 1:167487439-167487461 CTGATGCCCCTTCCTCCAGGTGG + Intronic
917539731 1:175901156-175901178 CTGATTCACCTGGAGAGAGGAGG - Intergenic
917789446 1:178490175-178490197 CATCGGCACCTGCAGCCAGGAGG + Intergenic
922674049 1:227540379-227540401 GTGAGGCCCCTGCAGGCAGGAGG - Intergenic
923629687 1:235641736-235641758 CTGATGCACGTGGAGCCAACAGG - Intronic
924452690 1:244192544-244192566 GTGATGCAGCTGCAACCAGCTGG - Intergenic
1062760547 10:13501-13523 CTGAGGCCCCTGCGGACAGGAGG + Intergenic
1063505406 10:6593624-6593646 CTGATGCAGCTGGAGCTGGGTGG - Intergenic
1064408218 10:15083267-15083289 CTGATGCACCTTCCTGCAGGAGG + Intronic
1064628310 10:17283698-17283720 CTGATGCCTCTCCAGCCATGTGG + Intergenic
1065918425 10:30370882-30370904 CTGAGGCACATGCAGAGAGGAGG + Intronic
1066367671 10:34792662-34792684 GAGCTGCACCTGCACCCAGGAGG + Intronic
1066495636 10:35939200-35939222 CTTGTGCACCTGCAGTCAGGTGG - Intergenic
1067249460 10:44574837-44574859 CAGATGCACCTTCAGGAAGGAGG - Intergenic
1067431785 10:46250163-46250185 CCCATGCACCTGCAGGCAGGTGG + Intergenic
1067441639 10:46312015-46312037 CTCATGCGCCTGCAGGCAAGTGG - Intronic
1068463780 10:57360396-57360418 CTGAGGCCCCTACAGCCATGTGG + Intergenic
1069591960 10:69647695-69647717 CTGATGAAGCTTCAGCCTGGGGG + Intergenic
1072290410 10:93959852-93959874 CTGCTGGGCCTGCAGCCGGGTGG + Intergenic
1074105793 10:110388895-110388917 ATGATCCAGCTGCCGCCAGGGGG + Intergenic
1075002507 10:118808897-118808919 CTGCTCCACCGCCAGCCAGGTGG + Intergenic
1075033615 10:119043819-119043841 CTGAGGCACTTGAACCCAGGAGG + Intronic
1075042452 10:119119101-119119123 CTGAGGCACTTGAACCCAGGAGG - Intronic
1075162717 10:120038810-120038832 CTCATGCACCTGGAGGTAGGGGG - Intergenic
1076182389 10:128420440-128420462 CTGAGGCCTCTGCAGCCATGTGG - Intergenic
1076255737 10:129023098-129023120 TGGATGCAAATGCAGCCAGGAGG - Intergenic
1076584146 10:131533709-131533731 CTGGAGCACCTGCAGGCCGGGGG + Intergenic
1076645149 10:131948658-131948680 CTGATGCTCCTGAGGCCAGCCGG - Intronic
1076948608 10:133667042-133667064 CTGCGGCAGGTGCAGCCAGGAGG - Exonic
1076949592 10:133670341-133670363 CTGCGGCAGGTGCAGCCAGGAGG - Intronic
1076950576 10:133673640-133673662 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076951566 10:133676950-133676972 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076952556 10:133680260-133680282 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076953539 10:133683559-133683581 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076955512 10:133743221-133743243 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076956502 10:133746531-133746553 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076957490 10:133749840-133749862 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076958474 10:133753139-133753161 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076959463 10:133756449-133756471 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076960447 10:133759748-133759770 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1076962875 10:133780836-133780858 GTGAGGCCCCTGCAGCCATGTGG + Intergenic
1077358367 11:2128897-2128919 GTCGTGCACCTGAAGCCAGGGGG - Intergenic
1079759589 11:24311370-24311392 CTGAGGCCTCTGCAGCCATGTGG + Intergenic
1079966733 11:26989143-26989165 CTGATGCACCTTCTGCAACGTGG - Intergenic
1083681818 11:64354910-64354932 CTGAGGCTCCTGCAGGGAGGAGG - Intronic
1083681857 11:64355041-64355063 CTGAGGCTCCTGCAGGAAGGAGG - Intronic
1084211890 11:67628243-67628265 CTCATCTACCTGCAGGCAGGAGG + Exonic
1085479014 11:76806391-76806413 CTGAGGCTCCTTCAGCCAGGAGG + Intergenic
1088748614 11:112824940-112824962 CTGTTGCACCTCCTGTCAGGGGG + Intergenic
1089124763 11:116169094-116169116 CTGCTCCTGCTGCAGCCAGGAGG + Intergenic
1089822648 11:121241881-121241903 CAGCTGCAGCTGCACCCAGGAGG + Intergenic
1090019083 11:123111227-123111249 CTGAGGCACTTGAACCCAGGAGG - Intronic
1090481622 11:127073939-127073961 CAGATGCTCCTGCAGCAAGTAGG - Intergenic
1090498424 11:127237508-127237530 CTGAAGCACCTACAGGCATGTGG + Intergenic
1090825627 11:130383526-130383548 CTGATGCAAATGCAGACAGGTGG + Intergenic
1091630706 12:2158584-2158606 CTGATTTACCCGCAGCCATGTGG + Intronic
1092161078 12:6315884-6315906 CTGCTGAACCTGCAGCGAGTGGG + Exonic
1092291557 12:7162477-7162499 CTGATGCACCTTCACCCTGGGGG + Intergenic
1092537402 12:9402951-9402973 CGGAGGCACCCGCAGCGAGGCGG + Intergenic
1094420416 12:30264697-30264719 CTGAGGCATCCCCAGCCAGGTGG + Intergenic
1094514046 12:31117769-31117791 CGGAGGCACCCGCAGCGAGGCGG + Intergenic
1095098764 12:38161290-38161312 CTGGTGGAGCTGCAGCAAGGCGG + Intergenic
1095396868 12:41771783-41771805 CAGAGGCACCTGCAGGCATGAGG + Intergenic
1096613878 12:52820671-52820693 CTGACCCACCTCCAGCCAGCTGG + Intergenic
1097078672 12:56413475-56413497 CTGCTGTAGCTGCACCCAGGAGG + Intergenic
1097684128 12:62676441-62676463 TGGCTGCACCTGCACCCAGGAGG - Intronic
1097836125 12:64274226-64274248 GTGATGCAGCTGCAGGGAGGGGG + Intronic
1098290957 12:68956351-68956373 CAGCTGCAGCTGCACCCAGGAGG + Intronic
1098836902 12:75434441-75434463 GTGAGGCCCCTCCAGCCAGGTGG - Intergenic
1101271435 12:103149739-103149761 CTGATGCCTCCGCAGCCAAGTGG + Intergenic
1102009958 12:109612112-109612134 CTGAGGTGCCTGCCGCCAGGTGG - Intergenic
1102039636 12:109792561-109792583 CTTATGCACCTGCAGACCTGAGG - Intronic
1104928771 12:132327642-132327664 CTGATTCAGCTGGAGCCACGAGG - Intronic
1106143130 13:27027569-27027591 ATGATGCAGGTGCAGACAGGAGG + Intergenic
1106379432 13:29222685-29222707 CAGCTGCAGCTGCACCCAGGAGG - Intronic
1108933853 13:55863546-55863568 CTGAGGCCTCTGCAGCCATGTGG + Intergenic
1109179797 13:59200119-59200141 CTCATGCATCTGCAGTCAGCAGG + Intergenic
1110468965 13:75836594-75836616 CAGATCCAATTGCAGCCAGGTGG + Intronic
1113788225 13:113014128-113014150 CTGCAGCACCTGCAGCCACCAGG - Intronic
1113812884 13:113153195-113153217 CGGGTGCAGATGCAGCCAGGAGG + Intergenic
1113989315 13:114347651-114347673 GTGAGGCCCCTGCAGCCATGTGG + Intergenic
1114604410 14:23985130-23985152 CTTCTGCACCTGCCACCAGGAGG - Intronic
1114609895 14:24032933-24032955 CTTCTGCACCTGCTGCCAGAAGG - Intergenic
1115129271 14:30034216-30034238 GTGATGTAACTGCAGCCAGGTGG - Intronic
1119728622 14:76937317-76937339 CTGCTGCATCTCCAGCCAGCTGG - Intergenic
1121972860 14:98374732-98374754 CTGATGGACATGTAGCAAGGTGG + Intergenic
1122802759 14:104239776-104239798 CTGCTGCCCCTCTAGCCAGGAGG + Intergenic
1123135128 14:106021177-106021199 CTGTGGCTCCTGCAGCCACGTGG - Intergenic
1123145777 14:106128804-106128826 CTGTGGCTCCTGCAGCCACGTGG - Intergenic
1123159851 14:106267892-106267914 CTGTGGCTCCTGCAGCCACGTGG - Intergenic
1202849526 14_GL000225v1_random:8280-8302 CTGCGGCATGTGCAGCCAGGAGG - Intergenic
1202851517 14_GL000225v1_random:23256-23278 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1202852401 14_GL000225v1_random:29959-29981 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1202853474 14_GL000225v1_random:36252-36274 CTGTGGCAGGTGCAGCCAGGAGG - Intergenic
1202854580 14_GL000225v1_random:42695-42717 CTGCCGCAGGTGCAGCCAGGAGG - Intergenic
1202858378 14_GL000225v1_random:65029-65051 CTGCAGCAGGTGCAGCCAGGAGG + Intergenic
1202860860 14_GL000225v1_random:80147-80169 CTGTGGCAGGTGCAGCCAGGAGG + Intergenic
1202865311 14_GL000225v1_random:113746-113768 CTGCAGCAGGTGCAGCCAGGAGG - Intergenic
1202865611 14_GL000225v1_random:115086-115108 CTGTGGCAAGTGCAGCCAGGAGG + Intergenic
1202868394 14_GL000225v1_random:137159-137181 CTGCGACACGTGCAGCCAGGAGG + Intergenic
1123585680 15:21759047-21759069 CTGTGGCTCCTGCAGCCACGTGG - Intergenic
1123622322 15:22201635-22201657 CTGTGGCTCCTGCAGCCACGTGG - Intergenic
1124650358 15:31469450-31469472 CTCAGGCAGCTGCACCCAGGAGG + Intergenic
1124820742 15:33043885-33043907 CAGCTGCAGCTGCACCCAGGAGG - Intronic
1125753154 15:42044343-42044365 CTGCTGTACCTTCAGCCTGGGGG - Intronic
1126184779 15:45821461-45821483 CTGATTGGCCTCCAGCCAGGAGG + Intergenic
1126795787 15:52259806-52259828 CTGTTGGACTTGCACCCAGGTGG - Intronic
1127810454 15:62560875-62560897 CCGAGGCAGCTGGAGCCAGGAGG + Intronic
1127955083 15:63846296-63846318 CTGAGGCCTCTGCAGCCATGTGG + Intergenic
1128773917 15:70304190-70304212 ATGATGCACATGCAGCCAACTGG - Intergenic
1129037317 15:72658535-72658557 CTGAGGCACATGCAGAGAGGAGG - Intronic
1129057041 15:72827396-72827418 CTCTTGCACTTGCAGCCAGCTGG - Intergenic
1129212570 15:74078690-74078712 CTGAGGCACATGCAGAGAGGAGG + Intronic
1129262747 15:74377966-74377988 GTGATGGGCCTGCAGCCAGCTGG - Intergenic
1129268862 15:74409191-74409213 GTGATGCTCACGCAGCCAGGGGG + Intergenic
1129397829 15:75262389-75262411 CTGAGGCACATGCAGAGAGGAGG - Intronic
1129401440 15:75286670-75286692 CTGAGGCACATGCAGAGAGGAGG - Intronic
1129729707 15:77923011-77923033 CTGAGGCACATGCAGAGAGGAGG + Intergenic
1129799869 15:78405796-78405818 CGGCTGCAGCTGCACCCAGGAGG - Intergenic
1130244455 15:82231931-82231953 CTGAAACACCGGAAGCCAGGAGG - Intronic
1130651261 15:85763353-85763375 CAGAGGCGCCTGCAGGCAGGCGG + Intronic
1131025507 15:89138018-89138040 CTGGTGGACCTGAAGCCAGCAGG - Intronic
1131188100 15:90292548-90292570 CAGAGGCAGCTGCAGCCTGGGGG + Intronic
1132312351 15:100866437-100866459 CTCATCCAGCTGCAGTCAGGTGG + Intergenic
1132433563 15:101779176-101779198 CTGAGGCACATGCAGCGAGGAGG + Intergenic
1132563191 16:608130-608152 CTGAGGCCTCTGCAGCCATGCGG - Intronic
1132592663 16:733088-733110 CTTGGGGACCTGCAGCCAGGTGG - Intronic
1132686774 16:1165545-1165567 CAGATGCACCGGAGGCCAGGTGG - Intronic
1133109238 16:3535898-3535920 CAGATGCACCTGCAGTTTGGAGG + Intronic
1136693329 16:32052995-32053017 CTGTGGCTCCTGCAGCCATGTGG + Intergenic
1136793820 16:32996218-32996240 CTGTGGCTCCTGCAGCCATGTGG + Intergenic
1139693618 16:68657128-68657150 CAGAGGCAGCTGCAGCCTGGAGG - Intronic
1141418804 16:83898769-83898791 CTGATGCACCGGGAGGCTGGAGG + Intergenic
1142024155 16:87803536-87803558 CCCATGCACTTGCAGTCAGGTGG - Intergenic
1142173836 16:88635896-88635918 CCGCAGCACCTGCCGCCAGGAGG - Intergenic
1142272948 16:89100538-89100560 CTGCTGCACCTTCAGTCATGAGG - Intronic
1203096082 16_KI270728v1_random:1257911-1257933 CTGTGGCTCCTGCAGCCATGTGG + Intergenic
1142900206 17:3007020-3007042 CAGATGAACCTTCTGCCAGGAGG + Intronic
1143109320 17:4544638-4544660 GTCCAGCACCTGCAGCCAGGAGG + Exonic
1143265412 17:5633309-5633331 CTGATGTCCCTGCAGCCCAGTGG + Intergenic
1144327168 17:14193543-14193565 CTGAGGCGCCTGCAGCCTGGTGG + Intronic
1144476056 17:15590406-15590428 CTGAGGCGCCTGCAGCCTGGTGG + Intronic
1144814603 17:18025250-18025272 CAGCTGCATCTGTAGCCAGGAGG - Intronic
1145959143 17:28876299-28876321 CTCCTGCACATGCAGCCAGATGG + Intergenic
1147765604 17:42833636-42833658 CTGATCCACCTTCAGCAACGAGG - Exonic
1150375080 17:64674257-64674279 CCAGTGCACCTGCAGCCTGGGGG + Intergenic
1151460194 17:74249790-74249812 CCTGTGCAGCTGCAGCCAGGTGG + Intronic
1151979343 17:77499394-77499416 CAGCAGCACCTGCAGCCCGGTGG - Exonic
1152608259 17:81303646-81303668 CTGAGAGACCTGCAGCCAGCTGG + Intergenic
1152790167 17:82274374-82274396 CCCATGCACCTGCAGCCTGGGGG - Intergenic
1152864274 17:82712932-82712954 AAGCTGCACCTGCACCCAGGAGG + Intergenic
1152952020 17:83243065-83243087 GTGAGGCCCCTGCAGCCATGTGG + Intergenic
1152953454 18:13855-13877 CTGAGGCCCCTGCGGACAGGAGG + Intergenic
1155120802 18:22816770-22816792 CTGCTGCAGCTGCACCCAGGAGG + Intronic
1158365923 18:56735645-56735667 CTGATGCACCTAAAGACAGTTGG + Intronic
1160081079 18:75727641-75727663 CTCATGAAGCAGCAGCCAGGGGG - Intergenic
1160684087 19:425381-425403 CTGTGGCACCTGCAGACGGGCGG - Intronic
1160982694 19:1823563-1823585 AGGACTCACCTGCAGCCAGGCGG + Exonic
1161133162 19:2603669-2603691 CAGAAGCCCCTGCAGCTAGGAGG + Intronic
1161451115 19:4345929-4345951 CTGGTGCAGCCGGAGCCAGGTGG - Exonic
1161467197 19:4437626-4437648 CTGATGCTTCTGCACCCAAGGGG + Intronic
1162585261 19:11554342-11554364 CTCATCCACCTGCAGACATGGGG - Exonic
1162919209 19:13890262-13890284 CTGATGACCCTCCAGACAGGGGG - Exonic
1163469574 19:17488615-17488637 CTGATGGTAATGCAGCCAGGGGG - Intronic
1163819227 19:19486746-19486768 CTGATCCCCCTGCAGCCAGCCGG + Intronic
1165769156 19:38368337-38368359 CAGATGCCCCTTCAGCCAGGAGG + Intronic
1166000511 19:39874967-39874989 CTGAGGCACTTGAACCCAGGAGG - Intronic
1166315147 19:41985420-41985442 CTGCTGCACCTACCCCCAGGTGG - Exonic
1166544783 19:43627487-43627509 CTGCTGGTCCTGCAGGCAGGAGG - Intronic
1166674427 19:44731281-44731303 CTGAGGCACTTGAATCCAGGAGG - Intergenic
1168540202 19:57203731-57203753 CTCAGGGACCAGCAGCCAGGGGG - Intronic
1168728005 19:58601283-58601305 GTGAGGCCCCTGCAGCCATGTGG + Intergenic
924998302 2:384140-384162 CTGATGCAGCAGGAGCCGGGTGG + Intergenic
925508173 2:4593339-4593361 CTGAGGAACCTTCTGCCAGGAGG + Intergenic
926893383 2:17658263-17658285 CTCATGCAGTTGCAGTCAGGTGG + Intergenic
927613670 2:24566963-24566985 CAGTTGCAGCTGCACCCAGGAGG + Intronic
927694353 2:25230244-25230266 CTGGTGCACCGGCAGACTGGGGG - Exonic
928144942 2:28764829-28764851 GAGATTCACCTGAAGCCAGGAGG + Intronic
928202734 2:29260742-29260764 GTGAATCACCTGAAGCCAGGAGG + Intronic
928253813 2:29704829-29704851 CTGATGCGCCTGGAGCTGGGAGG - Intronic
929014459 2:37481216-37481238 AGGCTGCACCTGCATCCAGGAGG - Intergenic
929981182 2:46681770-46681792 CTGAGGCACATACAGCGAGGGGG + Intergenic
930309808 2:49726362-49726384 CTGAGGCCTCTGCAGCCATGTGG - Intergenic
931052367 2:58428676-58428698 CTGCTGCTGCTGCAGCCAGGGGG + Intergenic
933543607 2:83680285-83680307 CTCATGCAGCTGCAGTCAGATGG - Intergenic
935200648 2:100853742-100853764 CAGGGGCATCTGCAGCCAGGTGG + Intronic
936290272 2:111217462-111217484 CAGCTGCAGCTGCACCCAGGAGG + Intergenic
936570545 2:113609722-113609744 GTGAGGCCCCTGCAGCCATGTGG - Intergenic
936683914 2:114805162-114805184 CTGAGGCCTCTGCAGCCATGTGG + Intronic
937071410 2:119066593-119066615 CTGAGGCCCATGCAGCCAGGAGG + Intergenic
937227485 2:120378054-120378076 CCTGTGCACCTGCAGCCATGCGG - Intergenic
938156262 2:128942887-128942909 CTGATGCAACTCAAGCCAGAGGG + Intergenic
941376353 2:164735762-164735784 TTGATGCACCTGAAGGCAGTTGG + Intronic
941440465 2:165528991-165529013 CAGCTGCAACTGCACCCAGGAGG - Intronic
942103908 2:172613966-172613988 CAGCTGCAGCTGCACCCAGGAGG - Intergenic
942446080 2:176079993-176080015 CTGCTGCCGCTGCCGCCAGGGGG - Exonic
942535409 2:176957857-176957879 CTCATGCATCTGCAGTCAGCTGG + Intergenic
943782038 2:191835932-191835954 CTGGTGCACCTGGAGCACGGCGG + Exonic
946284189 2:218690443-218690465 CTGAAACACCTGCAGGCTGGGGG - Exonic
946700048 2:222403335-222403357 CTGCTACACCAGCAGTCAGGTGG - Intergenic
947668932 2:231924851-231924873 CTGAGGCAGCTGCAGCCTGGTGG - Intronic
947992944 2:234501124-234501146 CTGAAGCTCCTGAAGCCAGGTGG + Intergenic
948293662 2:236845590-236845612 CAGCTGCAGCTGCATCCAGGAGG + Intergenic
948604732 2:239127730-239127752 CTGCTGTTCCTGCTGCCAGGCGG + Intronic
948640173 2:239370694-239370716 CTGGTGCACCTGCAGCCCTGCGG + Intronic
948946247 2:241221466-241221488 CTGATGCACAAGAACCCAGGAGG - Intronic
949088269 2:242176928-242176950 GTGAGGCCCCTGCAGCCATGTGG + Intergenic
1169758275 20:9066366-9066388 CTCATGCAGCTGCAGACATGCGG - Intergenic
1170475406 20:16709414-16709436 CTCATGCATCTGCAGTCAGTTGG + Intergenic
1170554015 20:17501464-17501486 CTGAGGCACCTGAACCCGGGAGG + Intronic
1170698072 20:18678254-18678276 CTGGTGCACCTGCAGACAGAGGG - Intronic
1170749209 20:19130485-19130507 GAGCTGCACCTGCAGCCAGGAGG - Intergenic
1171313630 20:24166884-24166906 CTGAGGCACCAGGGGCCAGGAGG - Intergenic
1171387265 20:24778800-24778822 CTCATGCACCTGCTGTCAGCAGG - Intergenic
1171892582 20:30729213-30729235 CTGAACCACCTTCAGCCAAGTGG - Intergenic
1172871075 20:38135893-38135915 CTGATGCGCCCGCAGCCGTGAGG - Intronic
1173051891 20:39571443-39571465 CGACTGCACCTGCTGCCAGGAGG - Intergenic
1174454197 20:50638137-50638159 CAGAACCACCTGGAGCCAGGAGG + Intronic
1174472641 20:50771908-50771930 CAGAACCACCTGGAGCCAGGAGG - Intergenic
1174662117 20:52222363-52222385 CTGAGGCCTCTGCAGCCATGTGG - Intergenic
1175526866 20:59640417-59640439 CAGATGCCCCTGGGGCCAGGCGG + Intronic
1175743792 20:61439395-61439417 CTCATGCACCTGCACTCAGTGGG + Intronic
1175791854 20:61744921-61744943 CTGAAGAAGCTGCAACCAGGCGG + Intronic
1175825385 20:61933944-61933966 CAGATGCACCTGCTGCCCTGTGG - Intronic
1176008986 20:62881693-62881715 CTGAAGCAGCTGCAGCCGAGCGG - Exonic
1176115513 20:63430290-63430312 CTGCTGCCCCTGGGGCCAGGAGG - Intronic
1176868746 21:14071154-14071176 CTGGTGGAGCTGCAGCAAGGCGG - Intergenic
1179103787 21:38380243-38380265 CTGCTGCACCTGCTGTCAGAGGG + Exonic
1179433062 21:41338306-41338328 CAGATGCACCTGCTGCTTGGCGG - Intronic
1179537920 21:42064101-42064123 CTGATTCACCAGCAGCCTTGGGG - Intronic
1180263432 21:46692889-46692911 GTGAGGCCCCTGCAGCCATGTGG + Intergenic
1181463042 22:23096554-23096576 CTGAGGCAGCTCCAGCAAGGTGG + Intronic
1181918364 22:26299037-26299059 GTGATGGACCTGCACTCAGGTGG + Exonic
1182358771 22:29734793-29734815 CTGATGCCTCCGCAGCCAGTCGG - Intronic
1182938383 22:34249046-34249068 CTGAGGCCTCTGCAGCCATGTGG + Intergenic
1184986830 22:48141526-48141548 CTGCTGCAGCTCCAGCCAGCCGG - Intergenic
1185063212 22:48617835-48617857 CTTGTGCACCTCCAGGCAGGGGG - Intronic
1185202913 22:49518902-49518924 CTGATGCACATGCAGCCCAGTGG + Intronic
1185210029 22:49565474-49565496 CTGATGCACATGCTGGCAGGGGG + Intronic
1185275132 22:49947476-49947498 CTGGTGCACCAGAAGCCACGAGG - Intergenic
1185339773 22:50286090-50286112 GAGATGCACCTGCATCCAGAGGG + Exonic
1185429662 22:50801250-50801272 GTGAGGCCCCTGCAGCCATGTGG + Intergenic
949528343 3:4928561-4928583 CTCATGCAGCTGCAGTCAGCTGG + Intergenic
949749357 3:7333030-7333052 TTGATTGACCTCCAGCCAGGAGG - Intronic
949888605 3:8715240-8715262 CTCTTGGAGCTGCAGCCAGGAGG - Intronic
950533649 3:13567308-13567330 GTGATGCACCTGAAGGCAGGAGG + Intronic
950941410 3:16896887-16896909 CTGATTCAATTGCAGCCAGGTGG - Intronic
952666361 3:35909502-35909524 CTGAGGCCTCTGCAGCCATGTGG - Intergenic
952826332 3:37528109-37528131 ATGATGGACCTTCAGCCAGATGG - Intronic
956815417 3:72903934-72903956 CAGATGCACCTAGATCCAGGTGG + Intronic
959006539 3:101026613-101026635 CTGATTGGCCTCCAGCCAGGAGG + Intergenic
959040260 3:101414350-101414372 CTGGTGCACCTGCTGCAGGGAGG - Intronic
959693634 3:109225943-109225965 CTTATGCACATGCATCCAGAAGG - Intergenic
959715697 3:109430923-109430945 CTGGTGGACCTCCTGCCAGGAGG + Intergenic
961523130 3:127479609-127479631 CTGACCCACATGCAGCCAGCTGG + Intergenic
963124529 3:141802886-141802908 CTGATGAACCAGCAGCCAGCTGG + Intronic
966840031 3:184081071-184081093 CAGCTGCAGCTGCACCCAGGAGG - Intergenic
967845311 3:194038206-194038228 CAGAAGCAACTGCAGCCAGATGG - Intergenic
967968736 3:194984155-194984177 CTGATGCAGCTGGAGGCTGGGGG + Intergenic
968006884 3:195249155-195249177 GTGCGGCACCAGCAGCCAGGGGG + Intronic
968087259 3:195879381-195879403 CTTATTCACTTGCAGCCTGGTGG + Intronic
968268480 3:197381002-197381024 CTCATGCACCTGCAGTCAGCTGG - Intergenic
968624799 4:1622349-1622371 CAGATCCACCTTCAGCCGGGGGG - Intronic
968994710 4:3938314-3938336 GTCCTGCACCTGCAGCCAGCTGG - Intergenic
970539240 4:17060711-17060733 CTGAGGCATCTCCAGCCATGTGG - Intergenic
970674753 4:18436224-18436246 CTGGTGTAGCTGTAGCCAGGAGG + Intergenic
971444882 4:26732528-26732550 ATGATGCATGTGCAGCAAGGGGG + Intronic
971793510 4:31198713-31198735 CTGAGGCCTCTGCAGCCATGTGG - Intergenic
972106358 4:35493996-35494018 CAGCTGCAGCTGCACCCAGGAGG - Intergenic
972149018 4:36065294-36065316 CTGCTGTAGCTGCAGCCATGAGG - Intronic
974145256 4:57938197-57938219 CTGATGCCTCCGCAGCCACGTGG + Intergenic
974624063 4:64399638-64399660 TTGAAGCTCCAGCAGCCAGGAGG - Intronic
974679977 4:65147868-65147890 ATGAGGCATCTGCAGCCATGTGG - Intergenic
975463578 4:74683634-74683656 GTCATGCAACTGCTGCCAGGAGG + Intergenic
976405406 4:84656830-84656852 CTGAGGCCTCTCCAGCCAGGTGG - Intergenic
976511192 4:85911119-85911141 CAGCTGCACCTGCACCCAGGAGG + Intronic
977905742 4:102475797-102475819 TTGATTCACCTCCAGTCAGGAGG - Intergenic
978159336 4:105527133-105527155 CTGAGGGAGCTGCAGCCTGGAGG + Intergenic
978654655 4:111051233-111051255 CTGATGCCTCTCCAGCCATGTGG + Intergenic
980159242 4:129139199-129139221 CTGCAGCAGCTGCAGCCAGCAGG + Intergenic
981834160 4:149035910-149035932 CTGATGCCTCTCCAGCCACGAGG + Intergenic
983006267 4:162489450-162489472 CTGAGGCCCCACCAGCCAGGTGG + Intergenic
985070015 4:186158531-186158553 CTGATGCAGCTGTGGCCAAGGGG + Intronic
985379469 4:189377165-189377187 CTCATTCACCTGCAGGCAGCTGG + Intergenic
985446313 4:190022752-190022774 CTGCGGCAGGTGCAGCCAGGAGG + Intergenic
985452060 4:190067826-190067848 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985453045 4:190071123-190071145 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985454034 4:190074416-190074438 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985455022 4:190077709-190077731 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985456011 4:190081009-190081031 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985456994 4:190084303-190084325 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985457981 4:190087596-190087618 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985458970 4:190090896-190090918 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985463223 4:190173665-190173687 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
985466095 4:190198131-190198153 GTGAGGCCCCTGCAGCCATGTGG + Intergenic
985467789 5:13474-13496 GTGAGGCCCCTGCAGCCATGTGG - Intergenic
985585954 5:734354-734376 CTGATTGGCCTCCAGCCAGGAGG - Intronic
985644239 5:1077616-1077638 CGGAGGGACCTGCAGGCAGGAGG + Intronic
987999482 5:25330670-25330692 CTGGTGCAGCTGCAGCCACCCGG + Intergenic
992546062 5:77815033-77815055 CTCATGCAGTTGCAGTCAGGTGG - Intronic
993799768 5:92318626-92318648 CTGAGGCATCTCCAGCCATGTGG + Intergenic
995312812 5:110732460-110732482 CTGAGGCCTCTGCAGCCATGTGG - Intronic
995911803 5:117196587-117196609 CTAATGCACCTGCAGGCGAGGGG + Intergenic
996405706 5:123100133-123100155 CTGAAGCACCTGCAGTAAGGAGG + Intronic
997626720 5:135336146-135336168 ATGAGGCACCTGCTGCCAGGTGG + Intronic
999424527 5:151475745-151475767 CTGCAGCACCTGCAGCCATGAGG - Intronic
1002072495 5:176688458-176688480 CGGTTGCAGCTGCACCCAGGAGG + Intergenic
1002167731 5:177358658-177358680 GTGGGGCAGCTGCAGCCAGGGGG - Intronic
1002746048 5:181474466-181474488 GTGAGGCCCCTGCAGCCATGTGG + Intergenic
1003637085 6:7842244-7842266 CTTGTGCAGCTGCAACCAGGTGG + Intronic
1004299028 6:14440492-14440514 CTGATGCTCCTGCTGCAATGGGG - Intergenic
1004897460 6:20162365-20162387 CTGAGGCACCTCCAGGCAGATGG - Intronic
1005021572 6:21423711-21423733 CAGCTGCAGCTGCACCCAGGAGG + Intergenic
1005118119 6:22360857-22360879 CTGTTGCACTTGCAGTGAGGTGG + Intergenic
1005228132 6:23666731-23666753 CTGAGGCCTCTGCAGCCATGTGG + Intergenic
1005495639 6:26385349-26385371 GTGATGCACCTGCCACCACGAGG - Exonic
1006099717 6:31679118-31679140 GTGATGCAGCTGCTGCCAGCTGG + Exonic
1012752679 6:103183802-103183824 CAGCTGCAGCTGCACCCAGGAGG - Intergenic
1013366625 6:109442196-109442218 ATGATGGATCTGCAGGCAGGAGG - Exonic
1015281542 6:131440178-131440200 CTCATGCACCTGCAGTCATCTGG + Intergenic
1016495896 6:144661386-144661408 GAGAAGCAACTGCAGCCAGGAGG - Intronic
1017112933 6:150949633-150949655 CTGCTTCACATGCATCCAGGTGG + Intronic
1018029033 6:159827491-159827513 CTGTTCCAGCTGCAGCCATGTGG + Intergenic
1018345023 6:162891378-162891400 CTCATGCACCTGAAGCAAGCTGG + Intronic
1018725756 6:166612349-166612371 CTCATGCACCAGCTGCAAGGAGG - Intronic
1018917497 6:168145780-168145802 CTGAGGCACCTGGAGCTGGGAGG + Intergenic
1018932753 6:168252611-168252633 CTGAAGGACCTGGAGCCAGCTGG - Intergenic
1019506580 7:1394481-1394503 ATCATGCAGCTGCAGCCAGGTGG - Intergenic
1019628027 7:2031201-2031223 CTGGTGCAGCTGCAGGCAGAGGG - Intronic
1024455809 7:49605240-49605262 TTGGTGGACCTCCAGCCAGGAGG - Intergenic
1025757284 7:64357088-64357110 CTGAGGCTCCTGCAGGCAGGAGG - Intergenic
1026875457 7:73876819-73876841 CAAATGCACCTGCAGCCGTGTGG - Intergenic
1028044954 7:86106795-86106817 CTGAGGCCCCTTCAGCCATGTGG + Intergenic
1028120016 7:87046773-87046795 CTGAGGCCTCTGCAGCCATGTGG + Intronic
1028136656 7:87230157-87230179 CAGCTGCAGCTGCACCCAGGAGG - Intergenic
1033434158 7:141317390-141317412 CTGATGCACCTGCAGCCAGGTGG - Intronic
1033834993 7:145299830-145299852 CTGAGGCACCCCCAGCCATGTGG - Intergenic
1034732668 7:153401275-153401297 CTGATGCACCTGCTTCCAGTAGG + Intergenic
1035848083 8:2886537-2886559 CTGACGACCCTGCAGCCCGGCGG + Intergenic
1036847228 8:12178482-12178504 GTCCTGCACCTGCAGCCAGCTGG - Intergenic
1036868595 8:12420803-12420825 GTCCTGCACCTGCAGCCAGCTGG - Intergenic
1037019113 8:13946175-13946197 CTGATGCACTTGGATTCAGGTGG + Intergenic
1037244579 8:16818221-16818243 CAGAACCACCTGCTGCCAGGTGG + Intergenic
1037814268 8:22103579-22103601 TTGGTGCAGCTGCAGCCAGGAGG + Exonic
1038585761 8:28787757-28787779 CTGATGCAGATGCAGACAGCAGG - Intronic
1039853024 8:41387668-41387690 CTGAGGCCCCTCCAGCCATGTGG + Intergenic
1040380330 8:46865665-46865687 CTGAGGCCCCTGCAGGTAGGAGG + Intergenic
1040610403 8:48977400-48977422 CTGCTGCTCCTGGAGGCAGGCGG + Intergenic
1041956293 8:63560318-63560340 CAGCTGCAGCTGCATCCAGGAGG + Intergenic
1042242970 8:66683121-66683143 CTGGAGCACATGCAACCAGGTGG + Intronic
1042659925 8:71143045-71143067 CTGAAGAAGCTGCAGCCTGGAGG + Intergenic
1044450785 8:92334019-92334041 CTGAGGCAACTCCAGCCATGTGG + Intergenic
1044740628 8:95322846-95322868 CTTATGAAACTGCAGCCAGATGG - Intergenic
1047490056 8:125366892-125366914 CTGGTGTCCCTGCAGGCAGGTGG - Exonic
1047523103 8:125610653-125610675 CTTGTGCATCTGCAGTCAGGTGG - Intergenic
1048772625 8:137912008-137912030 GTGAGGCACCTGCAGCCAGATGG - Intergenic
1048824718 8:138412828-138412850 CTGATGCAAGTGTTGCCAGGTGG - Intronic
1049028694 8:140015958-140015980 CTGTGGAACATGCAGCCAGGTGG - Intronic
1049373590 8:142278983-142279005 CATATGCACCTCCAGCCAGCTGG - Intronic
1049504102 8:142985688-142985710 CAGATGCACCTGCTGCCTGTGGG - Intergenic
1050146071 9:2568932-2568954 CTTATGCATCTTCAGCCAGCTGG - Intergenic
1051141528 9:13984543-13984565 CTGATGCAGCTGCAGTTAGCTGG - Intergenic
1053015512 9:34659857-34659879 CTGGAGCACCTGGAGCCCGGAGG + Exonic
1053455048 9:38227219-38227241 CAGCTGCAGCTACAGCCAGGAGG + Intergenic
1054356241 9:64066523-64066545 CTGAACCACCTTCAGCCAAGTGG + Intergenic
1055416700 9:76091708-76091730 GTGCTGGACCTGCAGGCAGGGGG - Intronic
1056495098 9:87148485-87148507 CAGCTGCGCCTGCAGCCAGGCGG + Intergenic
1057510932 9:95678926-95678948 CAGCTGCATCTGCATCCAGGAGG + Intergenic
1057846848 9:98532502-98532524 CAGGTGATCCTGCAGCCAGGAGG + Intronic
1057880698 9:98790749-98790771 ATGATGCATCTGCATCCATGTGG - Intronic
1058894409 9:109387112-109387134 GCCATGCACCTGCACCCAGGTGG - Intronic
1060114906 9:120932229-120932251 TTGTGGCTCCTGCAGCCAGGGGG + Intergenic
1060877206 9:127091975-127091997 CTGCAGCACCTGCAGCCAGCAGG + Intronic
1060884001 9:127137776-127137798 CTGCTGGACCTGCAGCCTGGTGG + Intronic
1061388180 9:130302760-130302782 GGGATGCACCAGCAGCCAGGAGG - Intronic
1061815631 9:133193025-133193047 CTGAGGCACTTGAACCCAGGAGG - Intergenic
1061887401 9:133598808-133598830 CTGAGGCACCAGCAAACAGGTGG + Intergenic
1061950105 9:133931382-133931404 CAGAAGCACCTGCGCCCAGGGGG + Intronic
1062075926 9:134589960-134589982 CTGGTGCCCCTGCCCCCAGGAGG - Intergenic
1062413627 9:136437184-136437206 GTGGTGCACCAGCAGGCAGGTGG - Intronic
1203736382 Un_GL000216v2:143109-143131 CTGCGGCACGTGCAGCCAGGAGG - Intergenic
1203739031 Un_GL000216v2:162417-162439 CTGCAGCAGGTGCAGCCAGGAGG + Intergenic
1203580519 Un_KI270745v1:40520-40542 GTGAGGCCCCTGCAGCCATGTGG + Intergenic
1185762331 X:2698257-2698279 GAGATTCACCTGCACCCAGGAGG - Intronic
1187440413 X:19312955-19312977 CTGCTGCACTTGCTTCCAGGAGG - Intergenic
1189023789 X:37370579-37370601 CAGTTGCAGCTGCACCCAGGAGG - Intronic
1189370086 X:40421074-40421096 CTCATGCAGCTGCAGTCAGCTGG + Intergenic
1193643849 X:84043817-84043839 CTGATTGACCTCCTGCCAGGAGG + Intergenic
1194181467 X:90715856-90715878 CTGGTTGACCTCCAGCCAGGAGG - Intergenic
1194244599 X:91494992-91495014 ATCAGGCACATGCAGCCAGGTGG + Intergenic
1195356324 X:104043163-104043185 GTGAGGCAACTGCAGCCAAGGGG + Intergenic
1197467338 X:126820973-126820995 CTGATGCACTGGCAGGCTGGAGG + Exonic
1198804130 X:140476392-140476414 CTGAGGCCTCTGCAGCCATGTGG + Intergenic
1200528091 Y:4297771-4297793 CTGGTTGACCTCCAGCCAGGAGG - Intergenic
1200563576 Y:4736305-4736327 ATCAGGCACATGCAGCCAGGTGG + Intergenic
1200844961 Y:7822643-7822665 CTCTTGTACCTGGAGCCAGGAGG - Intergenic
1200973988 Y:9187934-9187956 CTTGTGCACCTGCACCCATGAGG - Intergenic
1201175561 Y:11306811-11306833 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1201176824 Y:11314812-11314834 CTGCGGCAGGTGCAGCCAGGAGG - Intergenic
1201177953 Y:11321449-11321471 CTGCAGCAGGTGCAGCCAGGGGG - Intergenic
1202136891 Y:21675691-21675713 CTTGTGCACCTGCACCCATGAGG + Intergenic
1202266715 Y:23027628-23027650 CTGAGGCCCTTGCAGGCAGGAGG - Intergenic
1202419708 Y:24661373-24661395 CTGAGGCCCTTGCAGGCAGGAGG - Intergenic
1202451078 Y:25008711-25008733 CTGAGGCCCTTGCAGGCAGGAGG + Intergenic