ID: 1033435324

View in Genome Browser
Species Human (GRCh38)
Location 7:141328531-141328553
Sequence GGGTCTAACCCAGGAACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033435318_1033435324 12 Left 1033435318 7:141328496-141328518 CCACTGAAAGTGTAACTGGGTCA 0: 1
1: 0
2: 1
3: 6
4: 103
Right 1033435324 7:141328531-141328553 GGGTCTAACCCAGGAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033435324 Original CRISPR GGGTCTAACCCAGGAACAGA AGG Intronic
No off target data available for this crispr