ID: 1033435370

View in Genome Browser
Species Human (GRCh38)
Location 7:141328980-141329002
Sequence ATAAAGAAGGCCAATCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 303}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033435370_1033435379 30 Left 1033435370 7:141328980-141329002 CCTTCCTGATTGGCCTTCTTTAT 0: 1
1: 0
2: 1
3: 19
4: 303
Right 1033435379 7:141329033-141329055 TCTTTAGATCAATTGCCCTTAGG 0: 1
1: 0
2: 0
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033435370 Original CRISPR ATAAAGAAGGCCAATCAGGA AGG (reversed) Intronic
901725731 1:11240476-11240498 CTAAAGAAGGACATTCAAGATGG - Exonic
902821406 1:18945521-18945543 ATAAAGATAGCCAATTAAGAGGG + Intronic
905773467 1:40653382-40653404 ATACAGATGGCCAAGCTGGAAGG + Intronic
908043304 1:60140143-60140165 ACAAAGAAGGGCAATCACGTAGG + Intergenic
908267961 1:62397091-62397113 AAAAAGAAGCCAAGTCAGGAGGG + Intergenic
912370760 1:109172391-109172413 ATAAAGAAGGGCCCTCTGGAGGG + Intronic
913153599 1:116071090-116071112 ATAAAGAAGAACAAACAGAAGGG + Intergenic
917276733 1:173339093-173339115 ATAAAGAACCACAATCAGGCAGG + Intergenic
918292793 1:183125036-183125058 ATAAAGAAGGACAGTCATGGTGG + Intronic
918748211 1:188234162-188234184 ATAAAGACGGCCAAGAAGCAAGG - Intergenic
919079014 1:192847814-192847836 TTAAAGAAGGCCTCTCAGAAAGG + Intergenic
919242284 1:194930393-194930415 ATAAATAAGGTAAATCAGGGTGG + Intergenic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
922770428 1:228179165-228179187 ATAAACAAGGCCCAGCAGAAAGG + Exonic
924124957 1:240840567-240840589 ACAAAGAAGGCCAGTGAGGCCGG - Intronic
1062771277 10:103717-103739 ATAATGAATGCCAATCAACAGGG - Intergenic
1064211899 10:13366773-13366795 AAAAAGAAGGCCAAGCACGGTGG - Intergenic
1065086354 10:22182417-22182439 ATAAAAAAGACCATTCAGAAAGG - Intergenic
1065119807 10:22517255-22517277 ATTAAAAAGACCAATCAGGCTGG + Intergenic
1065826646 10:29578593-29578615 ATAAAGAAGAACATTTAGGAAGG - Intronic
1065934361 10:30507723-30507745 ATAAATAAGGCCAATAAATAAGG - Intergenic
1066373474 10:34836968-34836990 AAAAAGAAGGCCAAGCATGGTGG - Intergenic
1067337992 10:45379703-45379725 AGAAAGGAGGCCACCCAGGATGG + Intronic
1067451265 10:46383525-46383547 ATAATGAAGGCGTATGAGGAAGG + Intronic
1067585977 10:47476231-47476253 ATAATGAAGGCGTATGAGGAAGG - Exonic
1067824837 10:49563316-49563338 ATAAAGAAGCCCCTTGAGGAGGG - Intergenic
1067998947 10:51309023-51309045 AAAAAGACAGCCAAGCAGGAAGG + Intronic
1068437664 10:57013658-57013680 ATATAGAAGGCCAATCATGGTGG + Intergenic
1069217541 10:65841043-65841065 ATGAAGTAGGCCAAGCAGGGTGG + Intergenic
1069282029 10:66666598-66666620 ATAAAGGAGAGCAATTAGGATGG - Intronic
1069435029 10:68373477-68373499 ATGAAGCAGGCCAAGCATGATGG + Intronic
1070092542 10:73302277-73302299 ATAAAGAAGGCCAGGGAGGGAGG + Intronic
1071492556 10:86145760-86145782 ATAAAGAACACAAATGAGGAAGG - Intronic
1072375786 10:94814246-94814268 TTAAAGAAACTCAATCAGGAGGG - Intronic
1072389662 10:94969897-94969919 TTAAAGAAACTCAATCAGGAGGG - Intronic
1073758332 10:106604652-106604674 AAAAACAAGGACAATAAGGAAGG - Intronic
1074656154 10:115589901-115589923 ATAAAGAAGAGCAATGAAGATGG - Intronic
1075937378 10:126354169-126354191 ATGAGGAAGGCAAATCTGGAAGG - Intronic
1076284524 10:129280213-129280235 ACAGAGAAAGCCAAACAGGATGG + Intergenic
1076440686 10:130479368-130479390 AGGAAGACAGCCAATCAGGAGGG - Intergenic
1079271288 11:18988310-18988332 AAAAAGAAGGGTAATGAGGATGG + Intergenic
1080514388 11:33006602-33006624 AGCAAGAAGACCAATTAGGAAGG + Intergenic
1080650203 11:34216428-34216450 GTAAAGGAAGCCAATCAGAAAGG - Intronic
1081438453 11:43054407-43054429 ATTATGAAGGCCAGTCAGTAGGG + Intergenic
1081933750 11:46890306-46890328 ATCGAGAGGGCCAATCTGGATGG - Exonic
1083037859 11:59657079-59657101 AAAAGGAAGGCCAATTTGGAAGG - Intronic
1085735867 11:79038504-79038526 AGAAAGAAGGCCAGTGAAGAGGG - Intronic
1088391687 11:109321512-109321534 ATAAATAAGGCCAGTCATGGTGG - Intergenic
1091176629 11:133564126-133564148 AAAAAGGAGGCCACACAGGAGGG - Intergenic
1092551266 12:9502856-9502878 ATAAAGAAAGTTAATCAAGACGG - Intergenic
1093810982 12:23491710-23491732 AAAAAAAAGGCCAATCATGGTGG - Intergenic
1094520541 12:31183477-31183499 ATAAAGAAAGTTAATCAAGATGG + Intergenic
1095038293 12:37418348-37418370 AGAAAAGAGGCCACTCAGGATGG + Intergenic
1095257854 12:40061266-40061288 AAAAAGAAGGGCAATCAGTCTGG + Intronic
1095458555 12:42416627-42416649 ATAAAGGGTGCAAATCAGGAAGG + Intronic
1095636356 12:44438498-44438520 ATTAAGAGGGCCAAGGAGGATGG - Intergenic
1096554149 12:52393165-52393187 ATAATGAGGGCCAAACAGCATGG - Intergenic
1096894797 12:54810689-54810711 ACAAAGAAGGCCATTAATGATGG - Intergenic
1096956864 12:55534889-55534911 ATAGAGAAGGACCATCAGGTGGG - Intergenic
1097247044 12:57612413-57612435 ATAGAGGAGGCCAGTGAGGAGGG - Intronic
1098033329 12:66277243-66277265 ATATGGGAGGCCAATCAGGAAGG - Intergenic
1100497408 12:95138644-95138666 ATAAAGAAGGCCAGTGTGGTGGG - Intronic
1100864516 12:98842649-98842671 ATAAATAAGGCCATTCCTGAAGG + Intronic
1101024143 12:100584253-100584275 TTAATTCAGGCCAATCAGGAAGG + Intronic
1101344501 12:103873690-103873712 AAAAAGAAGGCCAATGTGGCTGG + Intergenic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1103750698 12:123158313-123158335 AAAAATAAGGCCAAGCATGATGG + Intronic
1104504083 12:129314271-129314293 ATAAAAAAGTCAACTCAGGATGG - Intronic
1104620714 12:130310726-130310748 ATAAGGAAGGACAAGCTGGAAGG + Intergenic
1105680342 13:22719493-22719515 ATGAAGATGGCCAATCAGAGGGG - Intergenic
1106630280 13:31464993-31465015 ATAGAGAATGGCAAGCAGGAAGG + Intergenic
1106853746 13:33824153-33824175 ACACAGAAGGCAAAACAGGAAGG - Intronic
1107061530 13:36164652-36164674 AAAAAGAAGGCCAATGGGGTTGG - Intergenic
1108469776 13:50756317-50756339 ATAGGGAAGGCCCATCAGGTAGG + Intronic
1108618849 13:52161507-52161529 ACAAAGAAGGCCAGGCACGATGG + Intergenic
1109011305 13:56948826-56948848 ATTTAGAAGGCCAATCTGGGAGG - Intergenic
1109966012 13:69697347-69697369 ATAAAGATGGGAAATCAGTAAGG + Intergenic
1110195995 13:72789144-72789166 ATAAAGAAGTACAGTAAGGAAGG - Intronic
1111686539 13:91508406-91508428 ATAAAGGAGGGCAGACAGGATGG + Intronic
1115835481 14:37397595-37397617 ATAGGGAAGGCCCATCAGGTGGG + Intronic
1115996934 14:39204245-39204267 ATAAGGAAGGCCCATCAGGTGGG - Intergenic
1116049021 14:39781124-39781146 ATAGAGAAGGCCCATCAGATGGG + Intergenic
1116126773 14:40798296-40798318 ATAAAGAAGGGCAATCTGCCAGG + Intergenic
1116636501 14:47403088-47403110 GAAAAGAAGGCCACTCAGCATGG - Intronic
1118342563 14:64907179-64907201 ATAAAGCAAGCCAATGAGGTAGG + Intergenic
1118388462 14:65276556-65276578 ATAAAGAAGACCAGACTGGAGGG - Intergenic
1118434291 14:65755420-65755442 ATAAATAAGCCAACTCAGGAAGG - Intergenic
1119412510 14:74442464-74442486 AGAAAGAAGGCCAGTGAGGTGGG + Intergenic
1120829672 14:88986822-88986844 ATACAGAAGGACTCTCAGGAGGG - Intergenic
1123132112 14:105995757-105995779 ATAATGAAGGCCCAGCAGAATGG + Intergenic
1123582346 15:21726883-21726905 ATAATGAAGGCCCAGCAGAATGG + Intergenic
1123618996 15:22169479-22169501 ATAATGAAGGCCCAGCAGAATGG + Intergenic
1124363116 15:29053432-29053454 ATAATGAGGACCAATGAGGAGGG - Intronic
1124405609 15:29389164-29389186 AAAAAGAATGCAAGTCAGGAAGG + Intronic
1124557146 15:30736495-30736517 ATAGGGAAGGCCCATCAGGTGGG - Intronic
1124674118 15:31669252-31669274 ATAGGGAAGGCCCATCAGGTGGG + Intronic
1125528360 15:40394053-40394075 GTACAGAAGCCCAACCAGGATGG - Exonic
1126567121 15:50112423-50112445 AAAAAGCAGGCCAAGGAGGAAGG + Intronic
1131938190 15:97531195-97531217 ATAAAGAAGGAAAATGAGGTAGG + Intergenic
1132784676 16:1649458-1649480 ATAAATAAGGCCAAACAGTGAGG - Intronic
1134634670 16:15783312-15783334 ATAAGGAAGGGAAAGCAGGAGGG - Intronic
1135859905 16:26046504-26046526 ATAAAGAAGGGAAATAAAGATGG - Intronic
1137275065 16:46927952-46927974 ATAAAAAAGGCCCCTCAGGTAGG + Intronic
1137893730 16:52188697-52188719 ACAAATAAGGCCAAACAGAAAGG + Intergenic
1139127887 16:64103306-64103328 ATACAGAAGGACAAGCGGGATGG - Intergenic
1139140350 16:64254991-64255013 AGAAAGAAAGGCAAACAGGAAGG + Intergenic
1139201363 16:64980849-64980871 ATAAAGAAATCCAAGCAAGAAGG + Intronic
1139713849 16:68797097-68797119 ATAAAATAGGCCAAGCATGATGG + Intronic
1140502245 16:75443799-75443821 ATCAAGAAGGCCAAGCATGATGG + Intronic
1140805722 16:78530418-78530440 AAAAAGAAGACAAAGCAGGAAGG + Intronic
1142364378 16:89642174-89642196 ATAATGAAGACCTATCAGGATGG + Intergenic
1143178181 17:4968421-4968443 ATAAATAAGGCAAGTCAGGAGGG + Exonic
1143934070 17:10463773-10463795 AAAAAGAAGGTAAATCGGGAAGG + Intronic
1146269065 17:31472634-31472656 ATCAAGAAGGCGAAGCAGAAGGG + Intronic
1146534394 17:33637661-33637683 AGAAAGAAAGCAAATAAGGAAGG + Intronic
1146664064 17:34685194-34685216 AGAAAGAAGTCCAAGAAGGAGGG - Intergenic
1147462194 17:40580400-40580422 ACATAGAAGGGGAATCAGGAAGG + Intergenic
1147768718 17:42853408-42853430 AGAAAGAAGGAAAATCAGGGAGG - Intronic
1148893431 17:50824485-50824507 AGAGAGAAGGCCAATAAGGCTGG + Intergenic
1149337363 17:55649679-55649701 GTAAAGAAGCCCACTCAGAAGGG + Intergenic
1149770880 17:59319935-59319957 AAAAAGAAGGCCGAGCACGATGG - Intergenic
1149977511 17:61280895-61280917 ATACAGCAGGCCAATCAGTTGGG - Intronic
1150512188 17:65766445-65766467 ATCATGAAGGCAAATCAGAAAGG + Intronic
1151624002 17:75265323-75265345 AAAAAGAAGGCCAGGCACGATGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153871408 18:9323995-9324017 ATAGAAAAGGCCAAGCAAGAAGG - Intergenic
1154144074 18:11851617-11851639 ATTAAAAAGGCCATTCAGAAGGG + Exonic
1156681465 18:39594106-39594128 AGAAAGAAAGCAAATTAGGAAGG - Intergenic
1157964460 18:52192294-52192316 ATAAAGCAGGCAATTCAGTATGG + Intergenic
1158239959 18:55366046-55366068 ATAAAGAAGGCCTATCCACATGG - Intronic
1159051957 18:63428427-63428449 AAAAAGAAGGCCAGGCACGATGG - Intergenic
1161928440 19:7319109-7319131 AAAAAGGAGGCCAAGCATGATGG - Intergenic
1162188716 19:8927760-8927782 GTAAAGAAGGACAATTATGATGG + Intronic
1163168590 19:15515014-15515036 AAAAAAAAGACCAAACAGGAAGG + Intronic
1167451350 19:49571688-49571710 AGAAAAAAGGCCAATCAGGCTGG + Intronic
1168497717 19:56868064-56868086 AAAATGAAGGTAAATCAGGAGGG + Intergenic
925343325 2:3151547-3151569 ATAGGGAAGGCCCATCAGGTGGG - Intergenic
926564673 2:14456193-14456215 AAAAAAAAGGAAAATCAGGAAGG + Intergenic
932270386 2:70403837-70403859 GCAAAGAAGGACAATCAGGTGGG - Intergenic
932842399 2:75095702-75095724 ATAATGAAGACCAGTCATGAGGG - Intronic
933369738 2:81399276-81399298 AAAAAGAATGCCTATCAGGCAGG - Intergenic
939588978 2:144040312-144040334 ATAAAGTAAGACAATCATGAGGG - Intronic
939687773 2:145221080-145221102 AGAAAGCAGGCAAAGCAGGAAGG - Intergenic
940817727 2:158314582-158314604 AGAAAGAATGCAAACCAGGATGG - Intronic
941565618 2:167102341-167102363 ATAAAGATGGCCAGTGAGAAAGG - Intronic
941619826 2:167764723-167764745 ATAATGAATGCAAATAAGGAAGG + Intergenic
941940228 2:171028875-171028897 ATGAAGAAGGCAAAAAAGGATGG + Intronic
942452243 2:176115860-176115882 ATAATGGAGGGCAAACAGGAAGG - Intronic
942887199 2:180940040-180940062 AGAAAGGAGGCCAATGTGGAGGG - Intergenic
944648171 2:201801136-201801158 ATCAAATAGGCAAATCAGGAAGG - Intronic
947452167 2:230218935-230218957 ATAAAGAAGGCCAGGCATGGTGG + Intronic
948531213 2:238606792-238606814 ATAGAGAAGGACCATCAGGTGGG - Intergenic
1169325908 20:4676343-4676365 ATAAAGAAAGCCACTCAGCCTGG - Intergenic
1169798512 20:9492058-9492080 TTAAAGAATGCCAATCAAAAAGG + Intergenic
1171351212 20:24504685-24504707 TCAAAGAAGGCCAGTCACGAGGG + Intronic
1171544175 20:25988095-25988117 AGAAAAGAGGCCACTCAGGATGG - Intergenic
1171846833 20:30282528-30282550 AGAAAAGAGGCCACTCAGGATGG - Intergenic
1173619782 20:44428306-44428328 GTAGAGAAGGTCGATCAGGATGG - Intronic
1181192602 22:21152376-21152398 AAAAAAACTGCCAATCAGGAAGG - Intergenic
1183456983 22:37928191-37928213 AAAAAGAAGGCCAAGCATGGTGG - Intronic
1184328970 22:43813565-43813587 ATAAAGAAGGCAAATGGGGAGGG - Intergenic
950617946 3:14177534-14177556 AGAAAGGAGGCCAATAAGGAGGG + Intronic
950764592 3:15264018-15264040 AAAAAGAAGGCCACAGAGGAAGG + Intronic
951129248 3:19022423-19022445 AGAAAGAAGGTCAAACAGGAAGG - Intergenic
951352656 3:21625316-21625338 CCAAAGGAGGACAATCAGGAAGG + Intronic
951617643 3:24566334-24566356 AGCAAGAAGGCCAATGAAGATGG - Intergenic
952322347 3:32289841-32289863 AAAAAGGAGGCCAGTCATGATGG + Intronic
952415294 3:33084578-33084600 ATAAAGAAGGCAAATCGCAATGG + Intronic
952421701 3:33137476-33137498 ATACAAATGGCCAATCATGAAGG - Intronic
953291468 3:41668119-41668141 ATAAAGAAGTCCATTCTGCAGGG + Intronic
953443230 3:42937777-42937799 ATCCAGAAAGCCATTCAGGAAGG - Exonic
953721637 3:45360987-45361009 AAAAAGAAGGCCAAGCATGGTGG - Intergenic
954265013 3:49465137-49465159 ATAAAGAAGGCCAGTCGCGGTGG + Intergenic
954484142 3:50830875-50830897 ATAAAAATAGCCAACCAGGAGGG - Intronic
954962391 3:54577885-54577907 AAAAGGAAAGCCAACCAGGAAGG + Intronic
955749440 3:62172800-62172822 ATAGAGAATACCAATCAGGCAGG - Intronic
956013430 3:64856054-64856076 ATAAAGAAGGCTTATTATGAAGG - Intergenic
957361440 3:79164524-79164546 ATAAAGCAGGCAAATGAGGATGG - Intronic
960070790 3:113427864-113427886 ATATACAATGCCAAGCAGGATGG + Intronic
960374784 3:116886200-116886222 ATAATGAAGGCCAATGAAGAGGG - Intronic
961489770 3:127246759-127246781 ATAAGTAAGGCCAACCATGAGGG + Intergenic
961624874 3:128254908-128254930 ATTAAGAATGAAAATCAGGATGG + Intronic
963781024 3:149486840-149486862 ATAATGAGGGCCAATGAGGAGGG + Intronic
964917469 3:161854427-161854449 ATAGGGAAGGCCCATCAGGTGGG + Intergenic
966840513 3:184083651-184083673 AGAAAGAAGGCGTCTCAGGAAGG + Intergenic
968323187 3:197789844-197789866 ATAAAGTAGGACAAACTGGAAGG - Intergenic
969154382 4:5197132-5197154 ATGAAGAAGGACAATAGGGAGGG + Intronic
971258614 4:25035653-25035675 AGCTAGAAGGCCAGTCAGGATGG + Intergenic
974305766 4:60137576-60137598 ATACAGAAAGCAAATCAGGCCGG - Intergenic
975033987 4:69658587-69658609 ATAGGGAAGGCCCATCAGGTGGG - Intergenic
975071684 4:70147667-70147689 ATAAGGAAAGCAGATCAGGAAGG + Intronic
976267676 4:83200357-83200379 ATTAAGAAGGCAAAACAGGCTGG + Intergenic
976369925 4:84275942-84275964 ATAAAGAAATTCAATAAGGATGG + Intergenic
976497479 4:85746947-85746969 TTAAAACAGGCCAATCAGGCTGG - Intronic
977048147 4:92092229-92092251 AAAAGGAAGGCCACTCAGGGTGG - Intergenic
977396819 4:96481428-96481450 ATAAAGAAGTCAATTCAGCAAGG - Intergenic
979357003 4:119716023-119716045 GTAAAGAAAGACAATCAGGTTGG - Intergenic
980165334 4:129219791-129219813 ATAAAGCAGCCCAAAAAGGAAGG + Intergenic
980173164 4:129313486-129313508 AGAGAGAAGCCCAATTAGGAGGG - Intergenic
980651012 4:135714434-135714456 ATAAAGAAGGAAAATTAGGCTGG - Intergenic
981910581 4:149976737-149976759 ATGAAGGAGCCAAATCAGGATGG + Intergenic
982288334 4:153757354-153757376 ATAATGAAAGCCAATCGGGGTGG - Intronic
984153183 4:176160247-176160269 AGAAAGAAGGCCAGGGAGGAGGG - Intronic
986128271 5:4903964-4903986 ATAAAGAAGAGAAATCATGAAGG - Intergenic
987196347 5:15530284-15530306 ATAGAGAAGGGTAACCAGGATGG - Intronic
988292186 5:29301324-29301346 ATAAAGAAGACTAATCGGGCCGG - Intergenic
988783878 5:34548266-34548288 AAAAAAAGGGCAAATCAGGAGGG + Intergenic
992055806 5:72988141-72988163 GTTAAGAAGGCCAAACAGGCCGG + Intronic
992552183 5:77869361-77869383 ATAAAGAAGGAGAATCAATAGGG - Intergenic
993023840 5:82624077-82624099 ATAAAGTAAGCAAATCTGGAAGG - Intergenic
993387379 5:87275862-87275884 ATGAAGAAGGCCAAGCTGGCTGG - Intronic
994530223 5:100959348-100959370 ATAAAGGAGGCAATTCAGTAAGG + Intergenic
994805292 5:104439379-104439401 ATTAAGAAAACCAATAAGGAAGG + Intergenic
995601556 5:113802916-113802938 ATTAAGAAAGGCAAACAGGAAGG - Intergenic
996051738 5:118942520-118942542 AAAAAAAAGGCCAAGCATGATGG + Intronic
996517718 5:124391763-124391785 AAAAAGAAGGAAAATCAGGCCGG + Intergenic
996615098 5:125431994-125432016 TTAAAGAAGGCCAAGAACGATGG - Intergenic
998142075 5:139705679-139705701 ACAAAGCAGCCCAATCAGAAGGG + Intergenic
999477733 5:151916706-151916728 ATAAAGGAGGTGAATCAAGATGG - Intronic
999955770 5:156700008-156700030 AGAAAGAAGTCCAATCTGGTTGG + Intronic
1000112549 5:158122896-158122918 ATAAAGCAGGCCAAGGAGTAAGG - Intergenic
1001177132 5:169480864-169480886 ATAAGGAAGGACCATCAGGTGGG + Intergenic
1001224462 5:169931858-169931880 ATAGAGAAGGGCAGGCAGGAGGG - Intronic
1001596014 5:172899194-172899216 AGGAAGAAGGCCAATCAGCCAGG + Intronic
1002829864 6:809924-809946 ATAAAGTAGAACAATTAGGATGG + Intergenic
1003581963 6:7347959-7347981 ATAGGGAAGGCCCATCAGGTAGG - Intronic
1004589576 6:17036322-17036344 ATTAAGAAACTCAATCAGGAGGG - Intergenic
1005118972 6:22369628-22369650 ATAACTAAGTCAAATCAGGAAGG - Intergenic
1006129952 6:31863066-31863088 ATCAAAAAGCCCAATAAGGATGG - Intergenic
1006644890 6:35509234-35509256 ATAAAGAAGAGCAATCAAAAGGG - Exonic
1007639287 6:43324702-43324724 ATAAAAACGGCCAATAAGGCCGG + Intronic
1008228674 6:48956013-48956035 ACAGAGAAGACCAAACAGGAAGG - Intergenic
1008256145 6:49302885-49302907 ATAAGGAAGGCCCATCAGGTGGG - Intergenic
1008928744 6:56914911-56914933 CTAAGGAAGGCAAATGAGGAAGG + Intronic
1010082509 6:71880704-71880726 AGAAAGTAGGCCAATGAGGCAGG - Intergenic
1010151091 6:72732979-72733001 ATAAAGAAGTGAAAACAGGAAGG + Intronic
1010722591 6:79300793-79300815 GTAAAAAGGGCGAATCAGGAGGG - Intergenic
1010867588 6:80998393-80998415 ATAAATAAGCACAATAAGGAAGG + Intergenic
1010917015 6:81632697-81632719 ATGAAGCAGGCCAATCAGAATGG + Intronic
1012061180 6:94483826-94483848 ATAACAAAGGAAAATCAGGAGGG - Intergenic
1014228106 6:118871627-118871649 ATAAAGAAGGCCAGGCACGGTGG + Intronic
1014284980 6:119487119-119487141 ATAAGGAAGGACCATCAGGTGGG - Intergenic
1014305065 6:119729994-119730016 AAAAGGAAGGCTAATGAGGAAGG - Intergenic
1014748738 6:125231203-125231225 ATTAGGAAGGCCATGCAGGAAGG - Intronic
1016239205 6:141908706-141908728 ATAAAGAAGGACCAGCAGGCAGG + Intergenic
1016288760 6:142504852-142504874 AAAAAGAAGGCCAGGCAGGGTGG - Intergenic
1016323560 6:142874691-142874713 AAAAAGAAGGACACTCAGGAGGG + Intronic
1017248768 6:152257243-152257265 ATAAAGCAGGCCACCCACGATGG + Intronic
1017267822 6:152471325-152471347 ATCAATAAAGCCAGTCAGGATGG + Intronic
1017758577 6:157550669-157550691 ACAAAGAGGGACATTCAGGAGGG - Intronic
1020495714 7:8850975-8850997 TTAAAAATGGCCAATAAGGAAGG + Intergenic
1022094306 7:27129591-27129613 AAATAGAAGGCCAAGGAGGAGGG + Intronic
1022266424 7:28759715-28759737 ATAGAGAATGCAAAACAGGAAGG + Intronic
1022555763 7:31294225-31294247 ATTAAGAAGGCCAGTCATGGTGG - Intergenic
1023133929 7:37032117-37032139 ACAAAGGAAGCCAATCAGTAGGG - Intronic
1023292941 7:38686635-38686657 AGAAAGAAGGGCTATGAGGAGGG + Exonic
1024669278 7:51577422-51577444 ATAGGGAAGGCCCATCAGGTGGG + Intergenic
1025985464 7:66446797-66446819 ATAAACAAGGACAATAAGGCCGG - Intergenic
1026195471 7:68169585-68169607 ATACAGAAGGCAAATAAGCACGG + Intergenic
1028286229 7:89005019-89005041 AAAATGAAGGCCACTCAGAATGG - Intronic
1030289514 7:107858407-107858429 ATGAAGGAGCCCAATCAGGCGGG - Intergenic
1031332701 7:120485735-120485757 ATAAATAAGACCCATTAGGAAGG - Intronic
1031425772 7:121603815-121603837 ATAAAGAAGGCTAAGGGGGATGG - Intergenic
1031849994 7:126851795-126851817 ATAAAGCAGGGTAATCTGGAGGG - Intronic
1033344155 7:140514268-140514290 AAAAAGTCGGCCAATCATGATGG - Intergenic
1033435370 7:141328980-141329002 ATAAAGAAGGCCAATCAGGAAGG - Intronic
1034713364 7:153217064-153217086 AGACAGATGGCCAAGCAGGAGGG - Intergenic
1035839607 8:2796260-2796282 AAAAAAAAGGCCTATCAAGAAGG + Intergenic
1037541036 8:19871602-19871624 CTAAAGAAGGCCAGGCAGGGTGG + Intergenic
1039957311 8:42217559-42217581 ACCAACAAGGCCAATCACGATGG + Intergenic
1041263924 8:56045670-56045692 AAAAAGAGGGCAAATCTGGAAGG - Intergenic
1041293733 8:56333397-56333419 ATAGAGAAGGACCATCAGGTGGG + Intergenic
1043444659 8:80307430-80307452 CTAAAGAAAGCCAAACAGGCTGG + Intergenic
1043766722 8:84144204-84144226 ATAATGAAGGACAAGCATGATGG - Intergenic
1044278165 8:90326153-90326175 CAAATGAAGGCTAATCAGGAAGG - Intergenic
1044423872 8:92029075-92029097 ATCAAGAGAGACAATCAGGAAGG + Intronic
1044729750 8:95220357-95220379 AGAGAGAAGGGCAAGCAGGAAGG - Intergenic
1044954771 8:97468504-97468526 ATGAAGAGAGCCAATCAGAATGG - Intergenic
1045210305 8:100090777-100090799 ATAAAGAAAGTCAGTCAGGTTGG + Intronic
1045359532 8:101419886-101419908 ATAAAGAAGGAAAAAAAGGAAGG + Intergenic
1045397900 8:101779636-101779658 ATAAAAAAGGGCAATCCGTAAGG - Intronic
1047763822 8:127973689-127973711 AAAAAGAAGGCCAAACACGGTGG + Intergenic
1049239807 8:141531449-141531471 ATAAAGACGGCCAAGCCGGCCGG - Intergenic
1049321176 8:141997251-141997273 AAGAAGAAGGCCAATCCTGAGGG + Intergenic
1050112496 9:2231415-2231437 AAAGAGAAGTCCCATCAGGAAGG - Intergenic
1050778426 9:9298632-9298654 ATAAAGAAGCTGAAGCAGGAGGG + Intronic
1050873713 9:10610184-10610206 ATAAAAATGGCAAAGCAGGATGG - Intronic
1051012266 9:12431759-12431781 ATAAAAAAGTCAAATCAAGAAGG - Intergenic
1051925662 9:22321912-22321934 ATAGAGAAGGCCCATCAGGAAGG - Intergenic
1051961655 9:22772104-22772126 ATAAAGAAGGCAAATCAATTAGG - Intergenic
1052099653 9:24429808-24429830 ATAAAGTATGCCAAGGAGGATGG - Intergenic
1054172490 9:61854906-61854928 AGAAAAGAGGCCACTCAGGATGG - Intronic
1054665050 9:67725895-67725917 AGAAAAGAGGCCACTCAGGATGG + Intergenic
1055519656 9:77067976-77067998 AAAAAGAAGGCCAGTCATGGCGG - Intergenic
1056699028 9:88887012-88887034 ATAGAGAAGGCCCATCAGGCGGG + Intergenic
1056785826 9:89591936-89591958 AGAAACAAGGCCACCCAGGATGG - Intergenic
1056839324 9:89985939-89985961 ATAAAGCAGGCCATTTAGGAGGG - Intergenic
1058485256 9:105437105-105437127 ATAAAAAAGCCCCATTAGGATGG - Intronic
1059726077 9:117009427-117009449 AAACAGAAGCCCATTCAGGATGG + Intronic
1060136532 9:121160868-121160890 ATTCAGAAGGCCAAGCAGGGAGG + Intronic
1060769370 9:126320269-126320291 TTAAAGAGGGCCAAAAAGGAAGG + Intergenic
1060957298 9:127651620-127651642 ATAAAGAAGGTCAAGAAGAAGGG + Exonic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1062700454 9:137899057-137899079 AAAAAGAAGGCCAGGCAGGGTGG - Intronic
1186541582 X:10406451-10406473 ATAAAAAAGGCCAGGCAGGGTGG - Intergenic
1187344146 X:18447672-18447694 ATCAAGAAGCCCACACAGGAGGG - Intronic
1188158331 X:26769591-26769613 AGAAATAAGGCAAATGAGGAAGG + Intergenic
1188323915 X:28775752-28775774 ATAAATAAGGCCAATGTGGTTGG - Intronic
1188732436 X:33666857-33666879 ACAAAGAATGCAAAACAGGAAGG + Intergenic
1190882010 X:54498210-54498232 ACAAAGAAGGACAAACAGGTTGG - Intergenic
1191080657 X:56506158-56506180 GTAAAGAAGGACCATCAGGTGGG - Intergenic
1191225709 X:58040668-58040690 ATAGAGGAGGCCATGCAGGATGG - Intergenic
1191814906 X:65232655-65232677 ATAAAGGAGGACAAGAAGGAAGG + Intergenic
1192607735 X:72537001-72537023 ATAAGGGAGGCCAATCTGGGAGG - Intronic
1193077024 X:77365058-77365080 ATAGAGAAGGACCATCAGGTGGG - Intergenic
1193785996 X:85760434-85760456 ATAGCGAAGGCCCATCAGGTTGG + Intergenic
1194713689 X:97265680-97265702 AAAAAGAAGGCCAATATGGCTGG + Intronic
1195136046 X:101908328-101908350 ATATAGAAGGCAAAGCAAGATGG + Intronic
1196118522 X:112023315-112023337 AAAAAGAAGGCCAAAAAGAAAGG - Intronic
1196675733 X:118418785-118418807 ATAAGGAAGGCCCATCAGGTGGG + Intronic
1197754863 X:129986234-129986256 TTAGAAAAGGCCAATAAGGAAGG + Intronic
1198153600 X:133934808-133934830 ATAAAGAAGTCCAGGCATGATGG - Intronic
1199521497 X:148741241-148741263 ATAGAGAAGGACCATCAGGTGGG + Intronic