ID: 1033436795

View in Genome Browser
Species Human (GRCh38)
Location 7:141340126-141340148
Sequence TTGGCTTTGAATATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2011
Summary {0: 2, 1: 25, 2: 253, 3: 625, 4: 1106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033436795 Original CRISPR TTGGCTTTGAATATGGAGGA AGG Intronic
Too many off-targets to display for this crispr