ID: 1033437872

View in Genome Browser
Species Human (GRCh38)
Location 7:141350380-141350402
Sequence CAGACCTTACATTCTAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 846
Summary {0: 1, 1: 4, 2: 41, 3: 179, 4: 621}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033437872_1033437880 4 Left 1033437872 7:141350380-141350402 CCCCCACTAGAATGTAAGGTCTG 0: 1
1: 4
2: 41
3: 179
4: 621
Right 1033437880 7:141350407-141350429 GAGGGACATTGTTTTGTTCAGGG 0: 1
1: 0
2: 1
3: 30
4: 253
1033437872_1033437879 3 Left 1033437872 7:141350380-141350402 CCCCCACTAGAATGTAAGGTCTG 0: 1
1: 4
2: 41
3: 179
4: 621
Right 1033437879 7:141350406-141350428 GGAGGGACATTGTTTTGTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033437872 Original CRISPR CAGACCTTACATTCTAGTGG GGG (reversed) Intronic
901358139 1:8670436-8670458 GAGAGATTACAATCTAGTGGGGG + Intronic
901574113 1:10186164-10186186 CCGGGCTTACATTCTAGTGGGGG - Intergenic
901615728 1:10538083-10538105 CAGAGCTTAAATTCTAGTGGAGG + Intronic
902058331 1:13620677-13620699 TAGAGCTTACATTCTAATGCTGG + Intergenic
902183883 1:14710779-14710801 CAGAACTTTCATTCCACTGGAGG - Intronic
902883466 1:19388268-19388290 TAAAACTTACATTCTAGTGAGGG - Intronic
903002514 1:20276337-20276359 TGGAGCTTACATTTTAGTGGAGG - Intergenic
903040909 1:20529591-20529613 GTGAGCTTACATTCTATTGGAGG - Intergenic
903208885 1:21804166-21804188 TAGAACTTACATTCCAGTGGAGG - Intergenic
903256405 1:22104405-22104427 CGGGACTTACATTCTAGTAGGGG + Intergenic
903314196 1:22488277-22488299 TGGAGCTTACATTCTAGTGAAGG + Intronic
903398197 1:23019093-23019115 AAGAACTTACAGTCTAATGGGGG - Intergenic
903468702 1:23569479-23569501 CAGACCTTACAATCTGAGGGTGG - Intergenic
903488248 1:23707557-23707579 TGGAGCTTACATTCTAATGGAGG + Intergenic
903491778 1:23734321-23734343 CAGAGCTTATATTCTAGGGGTGG + Intergenic
904064117 1:27735347-27735369 AAGAGCTCACATTCTAGTCGGGG - Intronic
904115869 1:28161376-28161398 AGGAGCTTACATTCTAGTTGGGG + Intronic
904220708 1:28966507-28966529 TGGAGTTTACATTCTAGTGGGGG + Intronic
904245706 1:29186470-29186492 GCGAGCTTACATTCCAGTGGTGG - Intergenic
904391598 1:30189627-30189649 GGGACCTTAGAGTCTAGTGGAGG - Intergenic
904718783 1:32490448-32490470 CAAACCTTTCATTGTAGTGCTGG + Exonic
905213749 1:36392312-36392334 CGGAGCTTATATCCTAGTGGGGG - Intronic
905252868 1:36660806-36660828 ATGAGCTTACATTCTAGTGGAGG + Intergenic
905554403 1:38870943-38870965 GAGAGGTTAAATTCTAGTGGAGG + Intronic
905898983 1:41568141-41568163 CAGAGCTTACAGTCTGGTGGAGG + Intronic
906634895 1:47402819-47402841 CAGGGCTCACATTCTAGTGGGGG + Intergenic
906853628 1:49280831-49280853 AATACTTTACATTTTAGTGGGGG + Intronic
907014950 1:51003615-51003637 CACACCTTGACTTCTAGTGGAGG + Intergenic
907776284 1:57518995-57519017 CAAGGCTTACATTTTAGTGGGGG - Intronic
907804739 1:57806894-57806916 TGGAGCTTACATTTTAGTGGGGG - Intronic
907889830 1:58626157-58626179 CAAAACTTACATTGTAGTTGGGG - Intergenic
908285852 1:62599559-62599581 CAGAGCTTACATTTTAGTGCAGG - Intronic
908338383 1:63150533-63150555 TGGACTTTACATTCTAGTGGGGG + Intergenic
908497842 1:64712867-64712889 TGGAGCTTATATTCTAGTGGGGG + Intergenic
908509881 1:64843099-64843121 CAGAACCTACATTTTACTGGGGG - Intronic
908621042 1:65979840-65979862 CAGGGCTTTTATTCTAGTGGAGG + Intronic
908664338 1:66473457-66473479 AGGATCTTACATTCTAGTGTAGG + Intergenic
909272223 1:73637836-73637858 CAGAGCTTATATTCCAATGGAGG - Intergenic
909501931 1:76344498-76344520 TAGAGTTTACATTCTAGTGGTGG - Intronic
909548524 1:76873383-76873405 CAGTACTTAGATTCTAGTTGGGG - Intronic
909847716 1:80416908-80416930 CAGAGCCTATATTTTAGTGGGGG + Intergenic
909936844 1:81561245-81561267 TTGAGCTTAAATTCTAGTGGGGG - Intronic
909996012 1:82280026-82280048 TAGAGCTTACATTCTAGTCAAGG - Intergenic
910181080 1:84484001-84484023 CAGAGCTTACATTCTAGGAAGGG + Intronic
910200788 1:84696347-84696369 CTGAGTTTATATTCTAGTGGAGG - Intergenic
910227861 1:84954831-84954853 TGGAGCTCACATTCTAGTGGGGG + Intronic
910234568 1:85022538-85022560 TAAAGCTTACATTCTAGTGGAGG + Intronic
910274594 1:85435496-85435518 TGGAGCTTACATGCTAGTGGGGG + Intronic
910608873 1:89118003-89118025 TAGAGCTTACATTCTAATGATGG + Intronic
910647820 1:89532261-89532283 CAGAACTTATATTCTGGTGGGGG - Intronic
910836910 1:91523186-91523208 CAGAGCTTAAATTCTAGTGAGGG + Intronic
910871960 1:91842179-91842201 CGGAGCTTACATTTTAGTGGGGG + Intronic
911285878 1:95991617-95991639 TAGAGCTGGCATTCTAGTGGAGG + Intergenic
911617915 1:100035551-100035573 CAGAGCTTACATTCTAGTGGGGG - Intergenic
911856755 1:102887385-102887407 GAGACTTTACAATCTAGTTGTGG - Intronic
912165042 1:107033063-107033085 TGGAGCTTACATTCTGGTGGAGG - Intergenic
912516289 1:110218568-110218590 GGGACCTTACATTCTAGTGGAGG - Intronic
912889683 1:113516239-113516261 CAGACCTTACATTCAAATCTTGG + Intronic
913038197 1:114995694-114995716 TAGAGCTTACATTCTGGTGAGGG + Intergenic
913075958 1:115340472-115340494 GAGAGCTTATGTTCTAGTGGGGG + Intergenic
913228490 1:116721188-116721210 TGGAACTTACATTCTAGTGGAGG + Intergenic
915033130 1:152901289-152901311 TAGAGCTTTCATTCCAGTGGGGG - Intergenic
915036352 1:152928984-152929006 CAGAGCTTACATCCTGGTGGGGG - Intergenic
915072867 1:153286798-153286820 CAGAGCTGACATTCTAGTTGGGG + Intergenic
915162687 1:153931201-153931223 AAGAGCTTACATTCTTGTGGGGG - Intronic
915274913 1:154781833-154781855 CAGAGCTTACATTTCAGGGGAGG + Intronic
915468189 1:156110230-156110252 TGGAGCTGACATTCTAGTGGAGG - Intronic
915526926 1:156481530-156481552 ACCACCCTACATTCTAGTGGAGG + Intronic
915599933 1:156915738-156915760 GGGAGCTTACAGTCTAGTGGGGG - Exonic
915604227 1:156940623-156940645 TTGAGCTTACATTCTAGGGGAGG + Intronic
916143333 1:161718817-161718839 TGGAGCTTACATTCTAATGGGGG + Intergenic
916447385 1:164885935-164885957 TAGAGCATACATTCTAGAGGTGG - Intronic
916473117 1:165142918-165142940 TGGACCTCACATTCCAGTGGGGG + Intergenic
916499132 1:165371446-165371468 CAGACCTTATCTTCTAGTAAGGG - Intergenic
916682400 1:167116429-167116451 AGGTCCTTACATTCTAGTAGGGG + Intronic
917185287 1:172347078-172347100 CAGACCTTACATTCAAATGGGGG - Intronic
917328920 1:173862151-173862173 AAGCGCTTACATTCTTGTGGGGG + Intergenic
917839041 1:178962781-178962803 TAGAGCTTACCTTCTAGTGAAGG + Intergenic
917958432 1:180124060-180124082 AAGAGCTTACATTCCAGTGTAGG + Intergenic
917962087 1:180153766-180153788 TGGAACTTACATTCCAGTGGGGG - Intergenic
918067554 1:181111635-181111657 TGGAGCTTAAATTCTAGTGGGGG - Intergenic
918138851 1:181702930-181702952 CAGAGCTTACATTATACTGCAGG - Intronic
918391423 1:184067392-184067414 GGGAACTTACTTTCTAGTGGAGG - Intronic
918479260 1:184960570-184960592 TACAGCTTACATTCTAGTGGTGG + Intronic
919041497 1:192394152-192394174 TGGAGCTTACATTCTATTGGAGG + Intergenic
919266701 1:195276661-195276683 CAGAGCTTAGATTCTAGCAGAGG + Intergenic
919494937 1:198252804-198252826 AGGAACTTACATTCTAGTGAGGG - Intronic
919540445 1:198838954-198838976 AGGAGCTTACATTCTAGTGGGGG + Intergenic
919963970 1:202502586-202502608 CGGAATTTACATTCTAGTGGGGG + Intronic
920153503 1:203929124-203929146 GGGAGCTTACATCCTAGTGGTGG + Intergenic
920286368 1:204882598-204882620 CAGAGCCTACCTTCCAGTGGGGG - Intronic
920669557 1:207992753-207992775 CTGTCCTCACATTCTAGTGAAGG - Intergenic
920700513 1:208214977-208214999 CAGATCTTATAATCTAGTAGGGG - Intronic
920779397 1:208974008-208974030 CATACCTTACAATATAGTGAGGG + Intergenic
920970492 1:210739440-210739462 CAAACCATGCAGTCTAGTGGGGG - Intronic
921121395 1:212140548-212140570 CTCATGTTACATTCTAGTGGAGG - Intergenic
921145929 1:212356342-212356364 CAGAGCTTACGTTCTAATGGAGG - Intronic
921498892 1:215876013-215876035 AAGAACTTATAATCTAGTGGAGG - Intronic
921581960 1:216905579-216905601 CAGACCTCAATGTCTAGTGGAGG - Intronic
922052117 1:222001738-222001760 CTGATATTACATTTTAGTGGAGG - Intergenic
922376344 1:224971500-224971522 TAGAACTTAGATTCTAATGGAGG + Intronic
922629593 1:227092278-227092300 CAGAGCTTATATTCTGGTAGAGG + Intronic
922931887 1:229396495-229396517 CAGACCTTGTGTTCTAGTGTAGG + Intergenic
923009337 1:230075666-230075688 TGGAGCTTTCATTCTAGTGGGGG + Intronic
923274428 1:232384196-232384218 CAGTCCTCACATTCTAGTCTGGG + Intergenic
923303746 1:232668851-232668873 CAGAGTTTACATTCTATTTGGGG + Intergenic
923336116 1:232971645-232971667 TGGAGCTTACATTCTAATGGAGG + Intronic
923508758 1:234630641-234630663 CAGAGCTTACATTTTAGTTGGGG - Intergenic
923575025 1:235150745-235150767 CACAGCTTACAGTCTGGTGGAGG + Intronic
923613468 1:235516417-235516439 CGGAGCTTCCATTCTAGTGGGGG + Intergenic
923806512 1:237263845-237263867 CAGAACTTGCATTCTAGTGGGGG + Intronic
923840350 1:237664365-237664387 AGGAGCTTACATTCTAATGGGGG + Intronic
924475975 1:244382172-244382194 CAGGGCTGACATTCTGGTGGGGG + Intronic
924561329 1:245157983-245158005 TGGAGCTTAGATTCTAGTGGAGG + Intronic
924599045 1:245472091-245472113 CAGATCTTACATTCTGATAGAGG + Intronic
1064592823 10:16912423-16912445 AGGAGCTCACATTCTAGTGGGGG + Intronic
1064596374 10:16949348-16949370 CAGACCTTGTCTTCTAGTGCAGG + Intronic
1064727371 10:18294483-18294505 TAGAGCTTACATTCTAGGGAAGG + Intronic
1064988086 10:21231200-21231222 TGGAACTTACATTCCAGTGGAGG + Intergenic
1065061288 10:21903791-21903813 TGGAGCTTACATTCTACTGGGGG + Intronic
1065897038 10:30172499-30172521 TGGAGCTTACATTCTAGTAGTGG - Intergenic
1066029189 10:31400166-31400188 AAGCCTTTATATTCTAGTGGAGG - Intronic
1066031774 10:31434933-31434955 TGGAGCTTACATTTTAGTGGGGG + Intronic
1066443229 10:35458597-35458619 CAGAAATTACATTCCAGTGTGGG + Intronic
1067009781 10:42700255-42700277 GGGAGCTTACATTCTAGTGGGGG + Intergenic
1067309233 10:45096572-45096594 GGGACCTTACAATCTAGTTGAGG - Intergenic
1067313939 10:45143045-45143067 AGGAGCTTACATTCTAGTGGGGG - Intergenic
1068073585 10:52225996-52226018 CATGACTTACATGCTAGTGGAGG - Intronic
1068494010 10:57762241-57762263 CAGAGCTTACATTTTAGTGAGGG - Intergenic
1068984187 10:63091841-63091863 CAGAGCTTACATTATAGTGTGGG + Intergenic
1069893267 10:71665144-71665166 TAAAGCTTATATTCTAGTGGTGG + Intronic
1069938660 10:71937943-71937965 GAGAGCTTACAGTCTAGTGGGGG - Intergenic
1070043531 10:72806595-72806617 TGGACCTTGCATTCTAGTGGTGG + Intronic
1070221462 10:74450391-74450413 AAGAGTTTACAATCTAGTGGAGG - Intronic
1070575473 10:77674008-77674030 AAGAGCTTACATTCTAGTCGGGG + Intergenic
1070733848 10:78850206-78850228 TAGAGCTTACACTCCAGTGGAGG - Intergenic
1071063442 10:81601736-81601758 GAGAGTTTACCTTCTAGTGGGGG + Intergenic
1071201343 10:83222853-83222875 CTGACCTCACATTATAGTGTCGG - Intergenic
1071767580 10:88685935-88685957 CAGAGCTTACATTTTAGTGGTGG + Intergenic
1071810805 10:89178822-89178844 TAGAACTTACATCATAGTGGGGG - Intergenic
1071947937 10:90669045-90669067 CAGAGTTTATAATCTAGTGGGGG - Intergenic
1071969924 10:90893807-90893829 AAAAGCTTACATTTTAGTGGGGG - Intronic
1071979469 10:90988835-90988857 AGGAGCTCACATTCTAGTGGGGG - Intergenic
1072350016 10:94547783-94547805 CAGAGCTAACATTCCAGTGTAGG + Intronic
1072802493 10:98402813-98402835 CAGGGCTTACATTCTACTTGGGG - Intronic
1073489378 10:103842755-103842777 TAGAGCTTACATTCTGGTGTGGG - Intronic
1073496494 10:103896278-103896300 CAGAACTTAAATTCTGATGGAGG + Intronic
1073517652 10:104091660-104091682 TAGAGCTTACCTTCTGGTGGAGG + Intergenic
1073606175 10:104897929-104897951 CAGCTCATTCATTCTAGTGGAGG + Intronic
1074350919 10:112736317-112736339 CATAGCTTACAATCTAGTGGTGG - Intronic
1074792034 10:116899167-116899189 TGGAGCTTACATTCCAGTGGGGG + Intronic
1074817873 10:117156778-117156800 AAGAACTTACAGTCTAGTGATGG - Intergenic
1074876067 10:117614306-117614328 CAGGGTTTACATTCTAGTGGTGG + Intergenic
1075303942 10:121350877-121350899 CAGACTTTACATTCTAGTAGGGG - Intergenic
1075805986 10:125189206-125189228 CGGAACTCACATTCTCGTGGCGG - Intergenic
1076314144 10:129528916-129528938 TGGAGCTTACATTCTAGTGAAGG + Intronic
1077978616 11:7275975-7275997 TAGAGCTTACATTCTAGTTGGGG - Intronic
1078396734 11:10988118-10988140 CAGAGCTTACATTCTAGAGGAGG - Intergenic
1078476511 11:11634811-11634833 AAGAACTTATATTCTAGTGAGGG - Intergenic
1078572396 11:12470605-12470627 CAAAACTTACATTCTGGTGAGGG + Intronic
1078607156 11:12786736-12786758 TGGAGCTTACATTCTAGTGGGGG + Intronic
1078719679 11:13872733-13872755 CAGAATTTATAGTCTAGTGGGGG + Intergenic
1078829502 11:14966058-14966080 ATGGGCTTACATTCTAGTGGGGG - Intronic
1078838531 11:15055534-15055556 AGGAGCTTACATTCTAGTGAAGG + Intronic
1078867774 11:15313910-15313932 CAGAGCTTATATTCTAGTAAGGG - Intergenic
1079057354 11:17217859-17217881 TTGAGCTTACATTCTAGTGTGGG - Intronic
1079132378 11:17754731-17754753 TGGACCTTACATTCTAGAGGGGG + Intronic
1079335022 11:19563707-19563729 CAGATCTTCCATTGTAGTGGCGG - Intronic
1079840439 11:25391590-25391612 CAGATCTTACATGCTAGGGTAGG - Intergenic
1080551136 11:33375214-33375236 TGGAGCTGACATTCTAGTGGGGG - Intergenic
1080745177 11:35102372-35102394 AGGCACTTACATTCTAGTGGGGG - Intergenic
1080932851 11:36830811-36830833 TTGAGCTTACATTCTAGTGGAGG + Intergenic
1081474401 11:43411503-43411525 TAGACCTTACAGTCCAGTGTGGG - Intronic
1081562177 11:44227803-44227825 AGGAGCTTACATTCTAGTGAAGG - Intronic
1081764582 11:45600735-45600757 TGGAGCTTATATTCTAGTGGGGG - Intergenic
1082978645 11:59100460-59100482 CAGAAATTACATTCTTGTGAGGG - Intergenic
1084023184 11:66430562-66430584 CAGACCTTACACTGAAGTTGTGG + Intergenic
1085068435 11:73519426-73519448 CAGAGTTTACACTCTAGAGGAGG + Intronic
1085794690 11:79528191-79528213 CAGAGCTCACATTCCAGTGAAGG - Intergenic
1086208013 11:84283718-84283740 CTGAGCTTACAGTTTAGTGGAGG - Intronic
1086284751 11:85234102-85234124 CAGAGCTTACCCTCTAGTAGGGG + Intronic
1086338444 11:85823131-85823153 TGGAACTTATATTCTAGTGGAGG - Intergenic
1086994422 11:93340095-93340117 TGGAGCTTACAGTCTAGTGGAGG + Intronic
1087896159 11:103589215-103589237 GAGACCTCATAGTCTAGTGGGGG + Intergenic
1088517630 11:110656023-110656045 TAGAATTTACGTTCTAGTGGAGG - Intronic
1088669524 11:112127904-112127926 AGGAACTTACATTCTAGTAGGGG - Intronic
1088759257 11:112913651-112913673 CAGATATTACAGTCTGGTGGGGG + Intergenic
1088879983 11:113965499-113965521 TAGAGCTTACATTCTAGTGGAGG + Intergenic
1089507458 11:118973254-118973276 GGAACCTTACATTCTACTGGGGG + Intronic
1089580855 11:119481342-119481364 CAGAGATTACATCCTAATGGGGG - Intergenic
1089676017 11:120090187-120090209 TGGAACTTACATTCTAGTTGGGG - Intergenic
1089758408 11:120704578-120704600 CAGAGCTTACATTCTAGTAGAGG - Intronic
1089802953 11:121052265-121052287 TAGAGCTTACATGCTAGTTGGGG + Intronic
1089857162 11:121556233-121556255 TAGAGCTTAGATTTTAGTGGAGG + Intronic
1090368009 11:126224142-126224164 GGGGACTTACATTCTAGTGGAGG + Intronic
1090857750 11:130625086-130625108 CTGACCTGACATTTTTGTGGTGG - Intergenic
1091064020 11:132491757-132491779 AAGAGCTTACATCCTGGTGGAGG + Intronic
1091423921 12:369425-369447 TGGAGCTTACATTCTAGTGGAGG + Intronic
1091844459 12:3645127-3645149 CAGAACTTGTATTTTAGTGGAGG + Intronic
1093057559 12:14569889-14569911 CAGAGCTTGCATTCCAGTAGTGG + Intergenic
1093902220 12:24648758-24648780 GAGATCATACAGTCTAGTGGAGG - Intergenic
1095214439 12:39531143-39531165 TTGAGCTTACATTCTAGTGGGGG + Intergenic
1095232712 12:39760699-39760721 TGGAGTTTACATTCTAGTGGAGG - Intronic
1095250859 12:39978005-39978027 CAGAGCTTACAGTGTGGTGGGGG - Intronic
1095413328 12:41947445-41947467 CACATCTTACATGGTAGTGGGGG + Intergenic
1095479905 12:42624204-42624226 CAGAGCATACATTCTAGTTGAGG + Intergenic
1095521010 12:43066192-43066214 CAGCACTTACATTCTAGCAGAGG + Intergenic
1096185807 12:49579845-49579867 CAAAGCTTACATTCTATGGGGGG - Intronic
1096642394 12:53005050-53005072 AAGAGGTTATATTCTAGTGGGGG - Intergenic
1096844781 12:54400411-54400433 TGGAACTTACATTCTAGTGAAGG - Intronic
1097376042 12:58844223-58844245 CAGAGCTTACATGCTAGTGAAGG + Intergenic
1098177322 12:67806254-67806276 TAGAACTTACATTCTAGTGCAGG + Intergenic
1098225096 12:68313068-68313090 TTGAACTTACATTCTAGTGGAGG - Intronic
1098443705 12:70544921-70544943 CAGAGGTTACATTCTCATGGAGG + Intronic
1098823590 12:75265155-75265177 TGGAGCTTACATTCTAATGGGGG - Intergenic
1098949576 12:76625898-76625920 TGGACCTTGCATTCTAGTTGGGG + Intergenic
1099217838 12:79875304-79875326 CAGACTTTACATTCTTGGGCAGG - Intronic
1100485514 12:95022640-95022662 CAGTCCTTACAGCCAAGTGGAGG - Intronic
1101314264 12:103615022-103615044 CAAACCGTACACTCTAGTGTGGG + Intronic
1101317774 12:103644614-103644636 TGGACCTTATATTCTAGTTGGGG - Intronic
1101359267 12:104010733-104010755 ATGAGCTTACAGTCTAGTGGAGG - Intronic
1101461503 12:104900914-104900936 CTGAGCTTACATTTCAGTGGAGG - Intronic
1101656744 12:106728508-106728530 TAGAGCTTACAATCTAGTGGAGG + Intronic
1101683084 12:106987881-106987903 TGGAGCTTACATTCTAGTGGAGG + Intergenic
1101863231 12:108499806-108499828 CACAGCTTACTTTCTGGTGGAGG - Intergenic
1101943905 12:109121433-109121455 CAGATCTTACCTTCTAGTGGGGG + Intronic
1102132000 12:110538976-110538998 TGGAACTTACATCCTAGTGGAGG - Intronic
1102287084 12:111666568-111666590 CAGAGTTTAGAATCTAGTGGAGG + Intronic
1102361565 12:112292466-112292488 TGGAGCTTACATTCTTGTGGAGG - Intronic
1102562534 12:113772512-113772534 TGGAACTTACATTCTAGTGGGGG + Intergenic
1102622606 12:114208569-114208591 TAGGGCTTACATTCTAGTGCTGG + Intergenic
1102744331 12:115237035-115237057 CAGAGTTTACAATCTAGTGATGG + Intergenic
1103217141 12:119210628-119210650 TAGAACTTACATTCTAGAAGTGG - Intronic
1103373514 12:120437627-120437649 CAGACTTTATATTCTAGTGGGGG + Intergenic
1103405980 12:120675691-120675713 TGGAGCTTACATTCTAGTGAGGG - Intergenic
1103506668 12:121445664-121445686 CAGAGCTTACATTTTAGTGGAGG + Intronic
1103783994 12:123418487-123418509 TGGACCTTACATTCTAGTAGAGG - Intronic
1103930154 12:124445727-124445749 GAGGCCTGACATTCTAGTAGGGG - Intronic
1104278546 12:127352885-127352907 CAAAGCTGACATTCTAGTGGAGG - Intergenic
1104375654 12:128263999-128264021 TGGACCTTACATTCTAGTGGAGG - Intergenic
1104527875 12:129541027-129541049 TGGAACTAACATTCTAGTGGAGG + Intronic
1105588935 13:21773156-21773178 GAGAGCTTACATTCTAGTGGAGG - Intergenic
1105764110 13:23541558-23541580 TAGAACTTACATTCTAGTAAAGG - Intergenic
1106681565 13:32013691-32013713 CAGATCTTATATTCTGGTGGGGG + Intergenic
1106801305 13:33259128-33259150 AGGAGCTTCCATTCTAGTGGGGG - Intronic
1107171166 13:37343143-37343165 TAGAGATTACATTCTAGTGGAGG - Intergenic
1107777571 13:43862559-43862581 CAGAGCTTACTTTCTAGTCAGGG - Intronic
1107938196 13:45362637-45362659 CAGAGCTCACCTTCTAGTGGAGG - Intergenic
1108115037 13:47118305-47118327 TGGAGCTTACATTCTAATGGGGG + Intergenic
1108240024 13:48454550-48454572 TAGAGCTTACATTCTGGAGGAGG + Intronic
1110430034 13:75413000-75413022 CACAGCTTACCTTCCAGTGGGGG + Intronic
1110460185 13:75736600-75736622 AAGAGTTTACATTCTAGTGAAGG + Intronic
1110562567 13:76925121-76925143 TAGAACTTACATTCTAATAGAGG - Intergenic
1112661031 13:101508174-101508196 TGGAGCTTACATTCTAGTAGTGG - Intronic
1112742508 13:102491041-102491063 GAGAGCTTACAGTCTAGTAGAGG - Intergenic
1113295870 13:108957956-108957978 TAGAGCTGACATGCTAGTGGAGG + Intronic
1114392380 14:22323886-22323908 CAGACCTTACATTCTCAGTGAGG - Intergenic
1114838978 14:26239871-26239893 CAGACTTTTCATTCTAGCTGAGG - Intergenic
1115183275 14:30655060-30655082 TAGAGCTTACATTCTAGTAGGGG + Intronic
1115590319 14:34858072-34858094 TGGAGCTTACATTCTGGTGGAGG + Intronic
1115742208 14:36400089-36400111 CAGATCTTATAGTCTAGAGGTGG - Intergenic
1116715707 14:48423505-48423527 CGTATCTTACATTCTAGTTGAGG + Intergenic
1116763045 14:49038499-49038521 CAGACCTTGTATTTTAGTGGAGG - Intergenic
1117108825 14:52427448-52427470 TGGAACTTACATTCTAGTGCAGG - Intergenic
1117320958 14:54623007-54623029 CAGGGCTGACAGTCTAGTGGAGG - Intronic
1117331925 14:54721151-54721173 TAGAATTTATATTCTAGTGGGGG - Intronic
1117446288 14:55806663-55806685 CTGACCTTACCTGCTAGAGGGGG - Intergenic
1117693696 14:58337331-58337353 CAGATCTTACAGTCTAGAGGAGG - Intronic
1118056196 14:62081997-62082019 GAGAGCTTGCAGTCTAGTGGTGG + Intronic
1118075293 14:62291562-62291584 TGGACCTTATATTCTAGTGGAGG + Intergenic
1118506969 14:66423980-66424002 CAAAGCTTACATTCTAGTCGGGG - Intergenic
1118692249 14:68351461-68351483 CAAAGCTTACAGTCTAGAGGAGG + Intronic
1119215030 14:72862856-72862878 TGGAGCTTGCATTCTAGTGGGGG - Intronic
1119372769 14:74161758-74161780 CAGTCCTTACAGTTCAGTGGTGG - Intronic
1119376392 14:74197484-74197506 CAGTTTTTACATTTTAGTGGAGG + Intronic
1119731176 14:76952195-76952217 TAGAGCTTACATTCCATTGGAGG - Intergenic
1119770731 14:77219363-77219385 CAGAGCTCACCTTCTAGTGGAGG + Intronic
1120016608 14:79481125-79481147 TGGTACTTACATTCTAGTGGGGG + Intronic
1120156409 14:81098155-81098177 CTGAGCGTACATTCTGGTGGGGG + Intronic
1120536943 14:85708065-85708087 TCGAGCTTATATTCTAGTGGAGG + Intergenic
1120831978 14:89005456-89005478 TGGAGCTTACATTTTAGTGGAGG + Intergenic
1121220420 14:92280781-92280803 CGGAGCTTACATTCTAGTGGGGG + Intergenic
1121398255 14:93647265-93647287 CGGAACTTACATTCTACTTGAGG + Intronic
1121418781 14:93797854-93797876 AAGACCTCACCTTCTAATGGAGG + Intergenic
1121418996 14:93799197-93799219 TGGAGCTTACATTCTAGTGAGGG - Intergenic
1121798850 14:96756757-96756779 CTGCCCTTACTTTCTAGTGGGGG + Intergenic
1121940663 14:98067558-98067580 CAGAGCTTACAGTCTACTTGCGG + Intergenic
1122256953 14:100485350-100485372 AAGAGCTTACATTCTAGAGGAGG - Intronic
1122443436 14:101750549-101750571 CAAAACCTACATTCTAATGGGGG - Intergenic
1122680410 14:103456636-103456658 TAGAGTTTACATTCTAGTTGGGG - Intronic
1202837344 14_GL000009v2_random:87912-87934 CAGAGCATCCATTCTGGTGGAGG + Intergenic
1124095746 15:26647484-26647506 CAGATCTTACATTCAGGTGGAGG + Intronic
1125360650 15:38860977-38860999 TAGAGCTTACATTCTAGTGTGGG + Intergenic
1125413401 15:39428275-39428297 TAGGGCTTACATTCTAATGGGGG + Intergenic
1125852222 15:42914841-42914863 CAGACCTAACAGTCAAGAGGTGG - Intronic
1126441557 15:48695010-48695032 CAGAGTTTTCATTCTAGTTGGGG - Intergenic
1126804712 15:52335787-52335809 AAGAACTTACAGTCTAATGGAGG - Intronic
1127463149 15:59218217-59218239 AAGAGCTTACGTTCTAGTGAAGG + Intronic
1128260624 15:66230333-66230355 GAGGGCTTACAATCTAGTGGGGG - Intronic
1128538610 15:68509337-68509359 CAAAGCTTACATTCTGGAGGGGG + Intergenic
1128729929 15:70014213-70014235 AAGATCTTACAGTATAGTGGGGG - Intergenic
1128862000 15:71082057-71082079 TGGAACTTACATTCTAGTGAAGG + Intergenic
1129828521 15:78651627-78651649 TAGACCTTACATGATTGTGGAGG - Intronic
1130548867 15:84876583-84876605 TGGAGCTTACAGTCTAGTGGGGG + Intergenic
1130644182 15:85709321-85709343 TGGAGCTTATATTCTAGTGGGGG - Intronic
1130956136 15:88628815-88628837 CAGACCTTACAGTGCGGTGGGGG + Intronic
1131067138 15:89441773-89441795 CAGAGCTGACATTCTGGTGGAGG + Intergenic
1131350768 15:91697824-91697846 CAGACCTTACAGTCTATTGAGGG + Intergenic
1133256669 16:4521370-4521392 CACCCCTTAACTTCTAGTGGGGG - Intronic
1133492778 16:6286855-6286877 CAGATGTTGCATTCTAGTGCAGG - Intronic
1133713005 16:8419661-8419683 TGGAGCTTACAATCTAGTGGGGG + Intergenic
1133720491 16:8490072-8490094 CAGAGCTGACATTCTTGTGAAGG + Intergenic
1134347471 16:13404259-13404281 CAGAGATTACAGTCTAGTTGAGG + Intergenic
1134429892 16:14193581-14193603 TAGATCTTACAGTCTAGAGGGGG - Intronic
1134506107 16:14808457-14808479 CAGAGCTTCTATTCTAGTGAAGG - Intronic
1134574443 16:15320313-15320335 CAGAGCTTCTATTCTAGTGAAGG + Intergenic
1134727972 16:16435990-16436012 CAGAGCTTCTATTCTAGTGAAGG - Intergenic
1134939464 16:18275836-18275858 CAGAGCTTCTATTCTAGTGAAGG + Intergenic
1135331640 16:21565065-21565087 CAAAGCTTACATTCTGGTGGAGG - Intergenic
1135391341 16:22095951-22095973 CAGCGCTTATATTCTAGAGGGGG - Intronic
1135794510 16:25428415-25428437 GTGACTTTACATTCTAGTGGAGG + Intergenic
1137303157 16:47173308-47173330 TAGAGATTGCATTCTAGTGGGGG - Intronic
1137464087 16:48692206-48692228 CAGAGCTTGTATTCTAGTGGGGG - Intergenic
1137762805 16:50954170-50954192 AAGAGCTTACATTCTAATGGGGG - Intergenic
1137905798 16:52320658-52320680 TGGAGCTTACATTCTAATGGAGG - Intergenic
1137913187 16:52399613-52399635 AAGATCTTTCATTCTAGTTGGGG - Intergenic
1137933351 16:52609500-52609522 AGGAGCTGACATTCTAGTGGAGG + Intergenic
1138710648 16:58966877-58966899 CAGAGCTTACTTTCTAGTTCAGG + Intergenic
1138870759 16:60880830-60880852 TGGAAGTTACATTCTAGTGGAGG - Intergenic
1139624812 16:68178526-68178548 TAGAGCTTACATTGTAGTGGGGG + Intronic
1139833620 16:69820731-69820753 TAGACCTTACATTCTATTTGTGG - Intronic
1140089577 16:71826642-71826664 TGGAGCTGACATTCTAGTGGGGG + Intergenic
1140770012 16:78194907-78194929 CAGAACGCACATTCTACTGGAGG - Intronic
1140992995 16:80232303-80232325 CAGAACTTACAGTTTGGTGGGGG + Intergenic
1141281710 16:82635114-82635136 CAGAGCTTATAGTCTAGTGGAGG - Intronic
1142506820 17:369674-369696 TGGAACTTACATTCTAGTGATGG - Intronic
1142754891 17:2010512-2010534 TGGAGCTTACATTCTAGTTGGGG - Intronic
1143092910 17:4459787-4459809 GAGAACTTACATTCTAGTTGAGG + Intronic
1143147801 17:4787981-4788003 CAGAGGTCACATTCCAGTGGGGG + Intergenic
1143182777 17:4994140-4994162 TAGAGCTTACATTCTAGAGAGGG - Intronic
1143299308 17:5897986-5898008 ATGAGCTTACATTCTATTGGAGG + Intronic
1144154247 17:12483158-12483180 TAGAGCTTACATGCTTGTGGAGG + Intergenic
1144408531 17:14976288-14976310 TATTCCTTACATTCTAGTGGTGG - Intergenic
1145776066 17:27529904-27529926 AAGACCTCAGATTCAAGTGGGGG - Intronic
1145813278 17:27777718-27777740 TGGAGCTTACATTCTAGTGGGGG + Intronic
1146208634 17:30924757-30924779 CAGAGCTTACATTCTAGTGTGGG + Intronic
1146318129 17:31825160-31825182 CAGTGCTTACATTCAGGTGGTGG + Intergenic
1146475770 17:33161590-33161612 AAGAGCTTACATTATATTGGTGG - Intronic
1146805527 17:35862213-35862235 AGGAGGTTACATTCTAGTGGGGG - Intronic
1146895644 17:36539754-36539776 CAGAGCTTGCAATCTAGTGGAGG + Intronic
1147477275 17:40724168-40724190 TAGAGCTTACATTCTAGTGTAGG - Intergenic
1147592943 17:41696858-41696880 CAGAACTTATGTTCTAGTGGGGG - Intergenic
1148965319 17:51430008-51430030 CAGAGCTTGCATTCTGGTAGGGG + Intergenic
1149355848 17:55838540-55838562 CAGAGCTTACAATCTAGTGAGGG - Intronic
1149630633 17:58119237-58119259 TGGAACTTACATTCTAGTGGGGG - Intergenic
1150115187 17:62541265-62541287 TGGAGCTTACATTCCAGTGGGGG - Intronic
1150932764 17:69603148-69603170 TAAACCTCACAGTCTAGTGGGGG + Intergenic
1151121349 17:71796676-71796698 CAGAGCTGACATTCTAGTGGTGG - Intergenic
1151602042 17:75111951-75111973 AGGAGCTTACATTCTAGTAGGGG + Intronic
1152074076 17:78148053-78148075 TGTATCTTACATTCTAGTGGGGG + Intronic
1152358982 17:79821479-79821501 CGGTGTTTACATTCTAGTGGGGG + Intergenic
1153423879 18:4941476-4941498 TGGAGCTTACATTCTAGTTGGGG - Intergenic
1153960933 18:10139761-10139783 CAGATCTTGGAGTCTAGTGGTGG + Intergenic
1154280174 18:12995614-12995636 TAGAGCTTACATTCTAATGTGGG + Intronic
1155348449 18:24882256-24882278 AAGAGCTTACACTCTAGTGGTGG - Intergenic
1156245411 18:35293234-35293256 AAGTGCTTACATGCTAGTGGAGG + Intergenic
1156771520 18:40732852-40732874 CAGCACTTACATTCTAGTAGAGG - Intergenic
1157091660 18:44643881-44643903 CAGAGCTTACAGTCTACTGTTGG + Intergenic
1157187161 18:45550468-45550490 GAGAGCTCACAGTCTAGTGGAGG - Intronic
1157241766 18:46016563-46016585 CAGACCTCAGAGTCTAATGGAGG + Intronic
1157699943 18:49755933-49755955 CTGAGCTTACATTCAAATGGAGG - Intergenic
1157848165 18:51023473-51023495 TGGAGCTTACATTCTAGCGGGGG + Intronic
1158894134 18:61897361-61897383 CAGAACTTACATTCTAATGGAGG + Intergenic
1159141612 18:64402422-64402444 CAGAGCTTACCTTCTAGTGAGGG - Intergenic
1159244205 18:65783814-65783836 CACAGTTTACATTCTAGTGAGGG + Intronic
1159563108 18:70016867-70016889 AAGAGCTTACCTTCTAGTGTGGG + Intronic
1163082423 19:14953553-14953575 CAGAGCTTACATTCTAGTATGGG + Intronic
1164551836 19:29218639-29218661 AGGACCTTATATTTTAGTGGTGG + Intergenic
1166051768 19:40264817-40264839 TGGAGCTTACATTCCAGTGGGGG - Intronic
1166200152 19:41232149-41232171 CAGAGCTCACATTCCAGTAGGGG - Intronic
1166666044 19:44681028-44681050 CAGGACTTACAGTCCAGTGGGGG - Intronic
1166734911 19:45078477-45078499 TAGAACCTACGTTCTAGTGGGGG - Intergenic
1166820950 19:45579550-45579572 GGTACCTTACATTCTTGTGGAGG - Intronic
1167289725 19:48617717-48617739 CAGATCCTCCATTCTAGTGCTGG - Intronic
1167687689 19:50966908-50966930 CTGAACTTACTTTCTAATGGGGG - Intronic
1168487645 19:56778155-56778177 TAGAGCTTGCATTCTAATGGGGG - Intronic
925972811 2:9118923-9118945 CAGAGCTTATATTCTTGTGGGGG - Intergenic
926073649 2:9922673-9922695 AGGCCCTTACATTCTAGTGTGGG - Intronic
926184512 2:10678636-10678658 AAGACCTTTCATTCTGGTTGGGG - Intronic
926877453 2:17497335-17497357 TGGACCCTACATGCTAGTGGAGG - Intergenic
927089543 2:19700083-19700105 GGGAGCTTAAATTCTAGTGGAGG + Intergenic
927268110 2:21175611-21175633 AAAAACTTACATTCTTGTGGAGG - Intergenic
928154974 2:28868497-28868519 TAGACCTTACATTCTAGAAGGGG - Intronic
929170126 2:38923533-38923555 TAGAGCTTACATTCTAGATGAGG - Intronic
929311602 2:40432285-40432307 CAGAGCTTATATTCTAATGGTGG + Intronic
930050013 2:47207789-47207811 TGGAGCTTACTTTCTAGTGGGGG - Intergenic
931653740 2:64491278-64491300 CAGAACTTACATTCTAGTGGTGG + Intergenic
932010003 2:67966208-67966230 TGGAGTTTACATTCTAGTGGTGG - Intergenic
932556162 2:72826333-72826355 GAGGCCTTACAGTCTAGTGGGGG + Intergenic
932674902 2:73771153-73771175 TATACTTTACATTCTAGTCGGGG - Intronic
932686798 2:73877506-73877528 CAGCCCTTACATACAACTGGAGG + Intergenic
933254395 2:80064185-80064207 CAGCCCTCACATTCTACTGAAGG - Intronic
933820054 2:86103067-86103089 CAGGCCTTACATTCTATTGGAGG + Intronic
936466270 2:112753968-112753990 TAGAGCTTACACTCTAGTGGAGG - Intronic
936502996 2:113081279-113081301 TGGATCTTGCATTCTAGTGGAGG - Intergenic
936938002 2:117856855-117856877 AAGAGCTTATATTTTAGTGGGGG + Intergenic
937140962 2:119599791-119599813 CACAGTTTACATTCTAGTGGGGG - Intronic
937150832 2:119684458-119684480 CAGATTTTACATTTCAGTGGAGG - Intronic
938990490 2:136623331-136623353 TAGAACTTACACTCTAGTGGGGG - Intergenic
939000994 2:136734324-136734346 TGGAGCTTACATTCTAATGGTGG - Intergenic
939208471 2:139139966-139139988 AAAGACTTACATTCTAGTGGAGG + Intergenic
939326881 2:140702991-140703013 TTGAGCTTACAGTCTAGTGGGGG - Intronic
939546764 2:143564301-143564323 CCCACCTTACATCCTAGGGGAGG + Intronic
940574848 2:155489741-155489763 AAGAACTAACATTCTAGTAGGGG + Intergenic
941707104 2:168670846-168670868 CAGAACTTATTTTCTAGTGGAGG - Intronic
941858298 2:170252602-170252624 TGGAGCTTACATTCTAGAGGGGG + Intronic
943003770 2:182363332-182363354 AAGACATTACGTTCTACTGGAGG + Intronic
943050986 2:182913138-182913160 CAGAGCTTATAATATAGTGGAGG - Intronic
944237353 2:197452579-197452601 CAGAGCTTATATCCTAGTGGGGG - Intergenic
944281231 2:197900121-197900143 AAGAGCTTACATTTTAGTGGTGG - Intronic
944300052 2:198113428-198113450 CAGAGCTGACAGTCTAGTGGGGG + Intronic
944448499 2:199816904-199816926 AAGAACTTACATTGTAGTTGGGG - Intronic
944639533 2:201709351-201709373 TGGAGCTTACATTCTAATGGGGG - Intronic
944819196 2:203412227-203412249 TAGAGCTTACATTCTAGTACTGG - Intronic
945154228 2:206821298-206821320 CAGATCTTGCATTCTACTGGAGG + Intergenic
945776031 2:214107231-214107253 CGGACCTTATATTCTAGTGGAGG - Intronic
945781917 2:214185949-214185971 CAGAACTTACATTATAGTGGGGG - Intronic
945849197 2:214984972-214984994 TGGAGCTTACATTATAGTGGAGG - Intronic
945911002 2:215649023-215649045 AGGAACTTACATTCTAGTGAGGG - Intergenic
946153651 2:217792871-217792893 CAGACTTTACAGTCTAGTGAGGG + Intergenic
946202396 2:218078124-218078146 TGGAGCTTGCATTCTAGTGGAGG + Intronic
946565245 2:220957090-220957112 CAGAGCTTACAGTCTGGTAGAGG - Intergenic
946630520 2:221662651-221662673 AAGACTGTACAATCTAGTGGAGG - Intergenic
946812961 2:223545869-223545891 CAGTTCTTTCATTCTATTGGAGG - Intergenic
947164755 2:227250543-227250565 TAGAGCTTACATTCTCATGGGGG + Intronic
947680078 2:232022681-232022703 CAGAGCTTACAGTCTCGTGAGGG - Intronic
949005555 2:241645000-241645022 CAGATCTTACTTTATAATGGAGG - Intronic
1168860356 20:1041903-1041925 AAGAACTTACATTCCAGTGGAGG + Intergenic
1168902720 20:1378574-1378596 CACACGTACCATTCTAGTGGGGG + Intronic
1169337828 20:4771593-4771615 CAGAGCTTAGGTTCTAGTGGAGG + Intergenic
1169864228 20:10182898-10182920 TAGAGCTTACATTCTAGTGCAGG - Intergenic
1170030511 20:11939271-11939293 CAGAGCTTAATTTCTAGTGAGGG + Intergenic
1170053006 20:12167335-12167357 CAGACCTTAGAGTCTACTTGAGG - Intergenic
1170345563 20:15382819-15382841 CAGGCCCTAGATTCTAGAGGAGG + Intronic
1170843142 20:19940173-19940195 CAGAGCTTACCTTCTAGTGGTGG - Intronic
1172054664 20:32145766-32145788 TAGAGCCTATATTCTAGTGGTGG + Intronic
1172492101 20:35348045-35348067 TAGAGCTTACCTTCTAGTGGGGG - Intronic
1172531670 20:35635301-35635323 CAGAATTTATATTCTAGTGGGGG - Intronic
1172767659 20:37359326-37359348 CAAAGCTCACATTCTAGAGGGGG + Intronic
1172936590 20:38624887-38624909 TGGAAGTTACATTCTAGTGGGGG - Intronic
1173738562 20:45379093-45379115 TCAAGCTTACATTCTAGTGGAGG + Intronic
1173783478 20:45775429-45775451 CAGACCTCACAGTCCAGTTGGGG + Exonic
1174647116 20:52095782-52095804 CAGGCCTTTCATTCTTGTGAAGG + Intronic
1174711706 20:52713248-52713270 GAGAGCTTATATTCTAGTGTTGG + Intergenic
1174723628 20:52839106-52839128 TGGAGCTTACATTCTAGTGTGGG + Intergenic
1174882865 20:54300048-54300070 ATGCCCTTACATTTTAGTGGGGG + Intergenic
1175159100 20:56994849-56994871 CAAAGCTCACATTCTAGAGGAGG + Intergenic
1175321507 20:58091416-58091438 AAGACCTTACATTCTTGTTGAGG - Intergenic
1178373659 21:32048905-32048927 CAGAGCTTACATTCCAGTGACGG + Intergenic
1178550795 21:33537475-33537497 TAGAGATTATATTCTAGTGGAGG + Intronic
1178809943 21:35872401-35872423 CTGACCTTACAGTCTAGCAGGGG - Intronic
1179046022 21:37845839-37845861 CAGACCTTATATTCTGGAGCAGG - Intronic
1179156910 21:38858940-38858962 TAGAACTTACATTTTAGTGATGG + Intergenic
1179598966 21:42462733-42462755 CAGACCTCACATTTCAGTGAGGG + Intergenic
1179798049 21:43797177-43797199 CAGGCCATACGTTCTGGTGGTGG + Intronic
1181018173 22:20083300-20083322 CAGAGCTCACATTTTAGTGGGGG - Intronic
1181770106 22:25119056-25119078 TGGACCTTACATCCTAGTAGAGG - Intronic
1182303421 22:29351632-29351654 CAGAGCCTACAGTCTGGTGGTGG + Intronic
1182573975 22:31260384-31260406 TGGAATTTACATTCTAGTGGAGG - Intronic
1182722294 22:32413131-32413153 CAGCACTTACAGTCTAGTGGGGG - Intergenic
1183154434 22:36064213-36064235 TAGAGCTTACATGCTACTGGAGG - Intergenic
1183401244 22:37605959-37605981 TGGAGCTTACATTCTGGTGGGGG + Intergenic
1183674915 22:39293793-39293815 TACACCTTCCATTCTAGTGGGGG - Intergenic
1183775032 22:39958431-39958453 GGGAGCTTACATTCTAGTCGAGG - Intronic
1184058463 22:42067657-42067679 GAGATCTCACAGTCTAGTGGGGG - Intronic
949935473 3:9112485-9112507 TGGAGCTTACAGTCTAGTGGGGG + Intronic
949978049 3:9478517-9478539 TGGAGTTTACATTCTAGTGGAGG + Intronic
950211363 3:11126054-11126076 CAGAGCTTATATTCCAGTGGAGG + Intergenic
950490587 3:13302324-13302346 CAGACCTGATGTTCTAGTGGGGG - Intergenic
950683156 3:14599096-14599118 CAGAGTTTACATTCTAGAGGGGG - Intergenic
951230885 3:20178511-20178533 TAAAGCTTACATTCTAGTGCAGG + Intronic
951479571 3:23145226-23145248 TAGAACTTAAATTGTAGTGGGGG + Intergenic
951481553 3:23167271-23167293 TAGAGCTTACATTCTAGTGGGGG - Intergenic
951875790 3:27423679-27423701 CAGAATTAACGTTCTAGTGGTGG + Intronic
951890503 3:27563809-27563831 TAGAGCTTACATTCTACTGGTGG - Intergenic
954113261 3:48447637-48447659 TGGAGCTTACATTCTAGTTGAGG + Intronic
954776538 3:53024038-53024060 AGGAGCTTACATTCTAGTGAAGG + Intronic
954886985 3:53883393-53883415 CGGAGCTTACATTCTAGTGTGGG - Intergenic
955226261 3:57062930-57062952 TGGAATTTACATTCTAGTGGGGG + Intronic
955636026 3:61030595-61030617 CAAAGTTTAGATTCTAGTGGTGG + Intronic
955802858 3:62704113-62704135 TGGAGCTTACATTCTAGTAGGGG + Intronic
956294190 3:67694161-67694183 CAGAGCTTACAGTCTTGTGGAGG + Intergenic
956714414 3:72065760-72065782 TAGAGTTTATATTCTAGTGGTGG + Intergenic
956897954 3:73683057-73683079 GAGAGCTTGCATTCTAGTGAGGG + Intergenic
956960402 3:74392634-74392656 GGGAGCTTACATTCTAGTAGTGG + Intronic
957122783 3:76117732-76117754 CGAAGCTTACATTCTAGTGGGGG + Intronic
957181479 3:76884412-76884434 CAGAACTCACTTTCTAGTTGGGG + Intronic
957311646 3:78527544-78527566 CAGAGCTCACAATCTAGTGGTGG + Intergenic
957322090 3:78644302-78644324 CAGACCTTACATTATAGTGGCGG - Intronic
957549272 3:81682633-81682655 CAAACCTTATATACTACTGGTGG + Intronic
957593856 3:82234744-82234766 CAGACCTTACAATCTAATGAAGG - Intergenic
958018746 3:87972154-87972176 TAGATCTTACATTCTAATGAGGG + Intergenic
958033761 3:88147167-88147189 CAGAGCTCATATTCTACTGGGGG + Intronic
958120924 3:89286982-89287004 TAAAGCTTACATTCCAGTGGAGG - Intronic
958814810 3:98903129-98903151 AAGAACTTACATTCTGGAGGAGG + Intergenic
959108484 3:102093680-102093702 TAGACTTTACATTCTAGGGAAGG - Intergenic
959672136 3:108990657-108990679 CAGAGCTTCCATTCTAGTTGGGG - Intronic
959678578 3:109066239-109066261 TGGAGCTTACATTCTAGTGGGGG - Intronic
961207457 3:125096389-125096411 TAGAGCTTACATTCTAGTAGGGG - Intronic
961207491 3:125096906-125096928 TAGAGCTTACATTCTAGTAGGGG - Intronic
962186949 3:133270258-133270280 CTCAGCTTGCATTCTAGTGGTGG - Intronic
962218708 3:133544947-133544969 AAGAGCTCACATTCTAGTCGGGG + Intergenic
962412268 3:135151572-135151594 TAGAGCTTACTTTCTAGTGGGGG - Intronic
962645893 3:137439630-137439652 GACATCTTACATTTTAGTGGAGG - Intergenic
962645902 3:137439739-137439761 CAGATCTTACATTTTAGTGGAGG - Intergenic
963075105 3:141338864-141338886 TAGACCTGACATTCTAGTGGGGG + Intronic
963284469 3:143419685-143419707 CAGAACTCACAGTCTAGCGGGGG + Intronic
963658135 3:148085987-148086009 CAGATCTTACATTCTTTTGGAGG - Intergenic
963747881 3:149143477-149143499 CAGAGCCTTCATTCTAGTGATGG - Intronic
964004889 3:151815073-151815095 CACAGTTGACATTCTAGTGGTGG + Intronic
964112178 3:153099067-153099089 GAGAGCTTACATTCTAGAGGGGG - Intergenic
964485972 3:157185684-157185706 CAGGTTTTGCATTCTAGTGGTGG - Intergenic
964544880 3:157822835-157822857 CAGAGTTTACATTCTGGTGGGGG - Intergenic
964673977 3:159257188-159257210 AGGATTTTACATTCTAGTGGGGG + Intronic
965122128 3:164573657-164573679 TAAAACTTACATTCTAGTGAGGG - Intergenic
965715754 3:171600961-171600983 TGGAGCTTACATTCTAGTAGGGG + Exonic
965987035 3:174766820-174766842 GAGAGCTTACATTCTAGTAGGGG + Intronic
966706943 3:182926448-182926470 TGGAGCTTACATTCTAGTGTTGG - Intergenic
966961602 3:184945404-184945426 GAGAATTTACATTCTAATGGAGG + Intronic
967687961 3:192439584-192439606 CTGAGCTTACAATCTAGTGGTGG + Intronic
967912350 3:194552791-194552813 CTGACTTTATATTCTAGTAGAGG - Intergenic
969210481 4:5683572-5683594 CGGAGCTGACATTCTAGTGAGGG + Intronic
970012824 4:11479435-11479457 TGGAACTTACATTCTAGTAGAGG + Intergenic
970268968 4:14322250-14322272 AAGAGCTTATATTCTAGTGTAGG - Intergenic
970531967 4:16994117-16994139 CAGAATTTACAATCTAGTAGGGG - Intergenic
970953866 4:21787876-21787898 CAGAGCTGACATTCTAGTGGGGG + Intronic
970988713 4:22188631-22188653 CAGACCTTACATTCTAATGTGGG - Intergenic
971952380 4:33369985-33370007 TAGAGATTACATTCTAGTGTGGG - Intergenic
972169007 4:36322198-36322220 CAGAGCTTACTTTCTAGTTATGG - Intronic
972256119 4:37357665-37357687 CGGAGCTTACATTCTAATGTGGG + Intronic
972351424 4:38239567-38239589 CAGTCTTCACATTCAAGTGGAGG + Intergenic
972408416 4:38767573-38767595 AAGAGTTTGCATTCTAGTGGGGG + Intergenic
972466108 4:39358565-39358587 CAGAGCTTATATGCTAGTGAAGG + Intronic
972742059 4:41896410-41896432 CAGAGCTTACATTATAGTAGAGG - Intergenic
972954865 4:44376679-44376701 AGGACCTCACATTCTAGTGAGGG + Intronic
973340378 4:48997398-48997420 TAGAGCTCACATTCCAGTGGGGG - Intronic
973342436 4:49019149-49019171 CAGAGTTTGCATTCTAGTAGGGG + Intronic
973639767 4:52891300-52891322 CAGAGCTTATGTTTTAGTGGAGG + Intronic
973683600 4:53346677-53346699 AAGAATTTACAGTCTAGTGGAGG + Intronic
973809848 4:54558880-54558902 CAGAACTTACAGTCTACTTGGGG - Intergenic
974169859 4:58252198-58252220 CAGCTCTTACCTTGTAGTGGAGG + Intergenic
974792174 4:66706225-66706247 TGGATCTTACATTCTAGTAGGGG + Intergenic
975155984 4:71073650-71073672 TAGAGCTTACATTCCAGTGGAGG - Intergenic
975416835 4:74114264-74114286 TGGAGCTGACATTCTAGTGGGGG + Intronic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
976072243 4:81254665-81254687 GAGAGTTTACATTCTAGTTGGGG - Intergenic
976489180 4:85647915-85647937 TAAAGCTTACATTCTAGTTGGGG - Intronic
977181148 4:93876135-93876157 CAGTCCTTACATTTTAGTGTGGG - Intergenic
978604016 4:110459508-110459530 TAGAACTTACATTGTAGTTGGGG + Intronic
978824900 4:113010535-113010557 GAGAACTTACATCCTAGTTGGGG + Intronic
979163553 4:117494963-117494985 AAGAGCTTACATCCTAGTTGAGG - Intergenic
979844975 4:125496530-125496552 TAGAACTTACATTCCAGTAGAGG + Intergenic
980896094 4:138861985-138862007 CAGAGCTTACATTCTAATAAAGG + Intergenic
981345085 4:143665370-143665392 AAGAACTTACAGTCTAATGGGGG - Intronic
981547060 4:145904305-145904327 TGGAGCTTACATTCCAGTGGGGG + Intronic
981595509 4:146417093-146417115 TGGACCTTACATTCTAGTGAGGG - Intronic
981766267 4:148253806-148253828 TAGAGCTTACATTCTAGTGAGGG - Intronic
982065490 4:151650974-151650996 CAGAGCATACATTCTACTGGGGG - Intronic
982147763 4:152416074-152416096 TAGAACTTAAATTCTAGTGTGGG - Intronic
982572348 4:157066145-157066167 GAGACCTTACATTTTAGTGGAGG + Intergenic
983911440 4:173244034-173244056 CAGAACTTACAGTCTAGTGCAGG + Intronic
984498043 4:180523077-180523099 CAGAAATTATATTCTAGTAGTGG - Intergenic
984779616 4:183513463-183513485 TGGACGATACATTCTAGTGGAGG + Intergenic
985072015 4:186175631-186175653 AAGAACTTAGATTGTAGTGGAGG + Intergenic
985167198 4:187109362-187109384 CAGAGCTTACATTCTCAGGGAGG + Intergenic
985199848 4:187473874-187473896 CAGAACTTACATTCCAGTGGGGG + Intergenic
986962921 5:13237430-13237452 TGGAACTTAGATTCTAGTGGAGG - Intergenic
987014215 5:13800893-13800915 CCCTCCTTACCTTCTAGTGGAGG - Intronic
987276959 5:16372883-16372905 CAGAGCTTACTGTATAGTGGGGG - Intergenic
987686806 5:21215099-21215121 TAGACCTTATATTCTTGTGGAGG + Intergenic
987762813 5:22187697-22187719 CAGAGCTTAGATTCTAGTCTGGG - Intronic
988751734 5:34194680-34194702 CGGAACTTTCATTCTAATGGGGG - Intergenic
988921710 5:35948394-35948416 CAGAACTTACATCCTTGTGGGGG + Intergenic
988983478 5:36594948-36594970 TGGAACTTACATTCTAGTGGAGG - Intergenic
989016481 5:36940947-36940969 CAGACCTTAGAGTCCAGTAGGGG - Intronic
989428930 5:41329326-41329348 AAGAGCTTACAGTCTAGTTGGGG - Intronic
989480075 5:41920500-41920522 CAGAGCTTATATTCTAGTGGAGG + Exonic
989507713 5:42246588-42246610 AGAAGCTTACATTCTAGTGGGGG - Intergenic
989744621 5:44813776-44813798 TAGAGCTTATATTATAGTGGGGG + Intronic
989766808 5:45096166-45096188 AAGATCTTACATCCTAGTGAAGG + Intergenic
989795172 5:45460508-45460530 CAGACATTACATTCTGGTGTGGG + Intronic
990058645 5:51618760-51618782 TAGACTTTACAGTCTAGTGTGGG + Intergenic
990329894 5:54715072-54715094 TAGAACTCACATTCTATTGGGGG + Intergenic
991132128 5:63134628-63134650 CTGAGCTTAAATTCTAGTGGGGG + Intergenic
991347908 5:65689716-65689738 TAGCACTTAGATTCTAGTGGGGG + Intronic
991737058 5:69637454-69637476 CGGAACTTTCATTCTAATGGGGG - Intergenic
991739494 5:69655487-69655509 CGGAACTTTCATTCTAATGGGGG - Intergenic
991758008 5:69897692-69897714 CGGAACTTTCATTCTAATGGGGG + Intergenic
991788632 5:70217178-70217200 CGGAACTTTCATTCTAATGGGGG - Intergenic
991791069 5:70235228-70235250 CGGAACTTTCATTCTAATGGGGG - Intergenic
991813382 5:70492283-70492305 CGGAACTTTCATTCTAATGGGGG - Intergenic
991816514 5:70513564-70513586 CGGAACTTTCATTCTAATGGGGG - Intergenic
991818954 5:70531605-70531627 CGGAACTTTCATTCTAATGGGGG - Intergenic
991837411 5:70773574-70773596 CGGAACTTTCATTCTAATGGGGG + Intergenic
991881078 5:71217542-71217564 CGGAACTTTCATTCTAATGGGGG - Intergenic
991883515 5:71235563-71235585 CGGAACTTTCATTCTAATGGGGG - Intergenic
991897598 5:71421101-71421123 CAGAGCTTAGATTCTAGTCTGGG - Intergenic
992324756 5:75649886-75649908 CAGACATTACATTTCAGTGGTGG - Intronic
992800677 5:80293053-80293075 TAGAACTTACATTCTAATAGAGG + Intergenic
992983649 5:82203981-82204003 TGGAGCTTATATTCTAGTGGGGG + Intronic
993189703 5:84666589-84666611 CTGAGCTTACATTTTATTGGAGG + Intergenic
993493078 5:88575901-88575923 CAGTCCTTACACTGTAGTAGGGG - Intergenic
993916823 5:93754314-93754336 CAGAGCTTACATTCTAGTAAGGG - Intronic
993932694 5:93960474-93960496 CTGGACTTACGTTCTAGTGGAGG - Intronic
994070735 5:95599072-95599094 CAGAGCTAACATTCTAATGTGGG - Intronic
994104014 5:95925472-95925494 CAGAGCTTATATTCTAGTGAAGG - Intronic
994489947 5:100428366-100428388 AAGACCTAACATTTTAGAGGAGG + Intergenic
994851639 5:105061726-105061748 CACAGCTTACATTCCAGTTGTGG - Intergenic
995230184 5:109752487-109752509 TGGAGCTTACATTCTAATGGTGG + Intronic
995359163 5:111274348-111274370 TAAACCTTTCATTCTAGGGGAGG - Intronic
995493341 5:112715281-112715303 CTGAGCTTAAATTTTAGTGGGGG + Intronic
995500942 5:112806286-112806308 TGGAGCTTACAGTCTAGTGGGGG - Intronic
995737597 5:115318749-115318771 CAGAGCTTATGTACTAGTGGAGG - Intergenic
995848523 5:116520346-116520368 TAGAGCTTACATTCTAGTGGAGG - Intronic
995893040 5:116978284-116978306 TAGAGTTTACATTCTAGTGAAGG - Intergenic
996681951 5:126237394-126237416 AGGAGCTTACATTCTAGTGAAGG + Intergenic
996768572 5:127060897-127060919 TAGAACTTGCATTGTAGTGGAGG - Intronic
997246497 5:132354445-132354467 TGGAACTTACAGTCTAGTGGAGG - Intergenic
997326434 5:133025876-133025898 GAGAGCTTACATTCTAGTGATGG - Intronic
997570348 5:134922570-134922592 CAGAGCATACAGTATAGTGGGGG + Intronic
997948513 5:138223308-138223330 CAGACATTTTTTTCTAGTGGGGG + Intergenic
998057855 5:139094400-139094422 CAGGGCTTACATTCTAGTAGTGG + Intronic
998079695 5:139264426-139264448 TGGAGCTTACATTCTAGTGGAGG - Intronic
998210570 5:140194219-140194241 CACAGCCTACAGTCTAGTGGAGG + Intronic
998331446 5:141331362-141331384 CAGAATTTACATTCAGGTGGTGG + Exonic
998433847 5:142089875-142089897 AAGAACTTAGAATCTAGTGGGGG + Intergenic
998602985 5:143604030-143604052 AAGAGTTTACATTCTAATGGAGG + Intergenic
998652548 5:144137345-144137367 TAGAGATTAAATTCTAGTGGGGG - Intergenic
998705542 5:144755450-144755472 AAGAGCTGACAGTCTAGTGGAGG + Intergenic
998754732 5:145364467-145364489 GGGAGCTTACATTCTAATGGAGG - Intergenic
998796762 5:145828698-145828720 CAGACATTACATTGTAGTATGGG - Intronic
998804082 5:145901532-145901554 TGGAGCTTATATTCTAGTGGAGG + Intergenic
998892061 5:146756925-146756947 CAACACTTACATTCTGGTGGAGG + Intronic
998945740 5:147337685-147337707 TAGAACTTACGTCCTAGTGGGGG + Intronic
999274256 5:150318539-150318561 TGGAACTTATATTCTAGTGGGGG + Intronic
999279570 5:150356352-150356374 TAGAGCTTACAGTCTAGTGATGG - Intergenic
999477137 5:151910882-151910904 CACACCTTAACTTCTAGTGGGGG - Intronic
999525521 5:152402045-152402067 CTGAGCTTACAGTCTAGTTGGGG + Intronic
999594437 5:153186722-153186744 TGGTCCTTACATTCTAATGGGGG - Intergenic
999666865 5:153921717-153921739 TGGAACTTACATTCTAGTTGTGG + Intergenic
999709912 5:154308946-154308968 TAGAGCTTACATTCCACTGGGGG + Intronic
999917723 5:156281623-156281645 TGAACCTTACATTCTGGTGGAGG + Intronic
999931911 5:156442830-156442852 CAGGGCTTATGTTCTAGTGGAGG + Intronic
1000062588 5:157670310-157670332 CAGAGCTCAAAGTCTAGTGGGGG + Intronic
1000297144 5:159921788-159921810 CAGCCCTTTCATTCAAATGGGGG + Intronic
1000465643 5:161572683-161572705 CAGAGCTTATCTTCAAGTGGAGG - Intronic
1000809438 5:165843031-165843053 CAGAACTTACAGTCTAGTGTGGG - Intergenic
1001226422 5:169948257-169948279 CAGAGCTTATATTTTAGTAGAGG + Intronic
1001849554 5:174951761-174951783 AAGAGCTTACATCCTAATGGGGG + Intergenic
1001884042 5:175272315-175272337 TAGGTCTTACCTTCTAGTGGAGG - Intergenic
1002616665 5:180460521-180460543 TGGAGCTTATATTCTAGTGGAGG - Intergenic
1003892873 6:10578746-10578768 CGGAGCTTATATTCTTGTGGAGG + Intronic
1003922388 6:10845563-10845585 GGGAGCTTACATTCCAGTGGGGG - Intronic
1005080379 6:21951236-21951258 CACACCTTAAATTCTAGGGTTGG - Intergenic
1005167111 6:22937492-22937514 CGGTGCTTACATTCTAGTTGTGG - Intergenic
1006751485 6:36380678-36380700 TGGAGCTTACATTCTAGTTGGGG - Intronic
1008416701 6:51249047-51249069 TAGAGATTACATTCTACTGGAGG + Intergenic
1008766662 6:54925334-54925356 TGAAGCTTACATTCTAGTGGGGG - Intronic
1010447192 6:75961499-75961521 AAGAGCTTACTGTCTAGTGGTGG + Intronic
1010535905 6:77029943-77029965 CAGAGTTTACATTTTAGTGACGG - Intergenic
1010785978 6:80001894-80001916 TGGAGTTTACATTCTAGTGGGGG + Intergenic
1011586255 6:88928422-88928444 CAGAGCTCATATTCTAGTGTGGG - Intronic
1011607527 6:89118777-89118799 CTGAGCTTACATTCTAGAGGGGG + Intergenic
1012797502 6:103781130-103781152 CAGAATTTACAATCTAGTAGAGG + Intergenic
1013459632 6:110362879-110362901 TGGAGCTTACATTCTAGTTGGGG - Intergenic
1013517709 6:110903650-110903672 GAAAGCTTACATTCTAGTAGAGG - Intergenic
1014627809 6:123751067-123751089 CAGAGTTTACATTCTAGTGGGGG + Intergenic
1014715477 6:124860249-124860271 TGGATCTTACATTCTAGTGGTGG - Intergenic
1014786267 6:125623416-125623438 CAGGGCTTACATTCTTTTGGGGG + Intergenic
1015087457 6:129312454-129312476 CATACCTTACGGTCTAGTAGAGG - Intronic
1015108795 6:129568540-129568562 AAGCCCTTACATTCTAGTGGAGG - Intergenic
1015589972 6:134813731-134813753 TAGAACTTACATTCTAATGAAGG + Intergenic
1015681981 6:135818485-135818507 CAGACCTTTCATTCTGGTTTGGG - Intergenic
1017239150 6:152147761-152147783 CAGAGCTTCCACTCTAGTGTGGG - Intronic
1017335782 6:153258189-153258211 TAGAACTTGCATTCTAGTTGGGG - Intergenic
1017935633 6:159002339-159002361 CAGAATTTATATTCTAGTGGAGG + Intergenic
1018071797 6:160171147-160171169 GAGAAGTTACTTTCTAGTGGGGG + Intronic
1019762577 7:2824567-2824589 TAGAGCTTACATTCTAGTGTGGG - Intronic
1019969269 7:4527133-4527155 AAGAGCCTACATTCTAGTGGGGG + Intergenic
1020458662 7:8403255-8403277 GAGAGCTGACATTCTGGTGGAGG + Intergenic
1020863370 7:13523102-13523124 GAGAACTTACTTTCTACTGGAGG - Intergenic
1020903966 7:14041706-14041728 CAGAGCCTACATTCTAGTAGCGG - Intergenic
1021218222 7:17942719-17942741 TGGAGCTTACATTCTAGCGGAGG - Intergenic
1022174935 7:27863594-27863616 CAGAGCTTGCATTCCAGTGCTGG - Intronic
1022590071 7:31653087-31653109 TAGAACTTACAGTGTAGTGGGGG + Intronic
1022629029 7:32067929-32067951 TGGAACTTACATTCTAATGGAGG + Intronic
1022836844 7:34126018-34126040 CAGCACTTACATTCTATTTGGGG + Intronic
1023350078 7:39311460-39311482 CGGAGCTTACGTTCTAGCGGAGG - Intronic
1023927943 7:44683950-44683972 CAGACCTTATAGTTTAGTGCAGG + Intronic
1024146339 7:46521428-46521450 CAGAGCTCATATTCTATTGGTGG + Intergenic
1024583915 7:50824400-50824422 TGAAACTTACATTCTAGTGGAGG - Intergenic
1024868001 7:53925908-53925930 CGGAGCTTGCACTCTAGTGGGGG - Intergenic
1027485025 7:78750574-78750596 CAGATCCTGCATTCTAGTAGGGG + Intronic
1028311597 7:89344560-89344582 CCGAGCTTCCATTTTAGTGGAGG + Intergenic
1028427547 7:90707012-90707034 CAGATCTTACAATTTATTGGGGG - Intronic
1028538013 7:91910830-91910852 TGGAGCTTACATTCTAGTGGGGG + Intergenic
1029139062 7:98397036-98397058 TAGAGCTCACATTCTAGTTGGGG + Intronic
1029188778 7:98757464-98757486 TGGAACTTATATTCTAGTGGAGG + Intergenic
1030103345 7:105965765-105965787 CAGGGCTGACATTCTAGTTGAGG - Intronic
1030819540 7:114079130-114079152 CAAACCTCACATTCTAATGAAGG - Intergenic
1031038844 7:116817588-116817610 TAGAACTTACATTCTAGAGAGGG + Intronic
1031108556 7:117576807-117576829 AAGAGCTTACAATCTAGTGAGGG - Intronic
1031980161 7:128119561-128119583 TGGCCTTTACATTCTAGTGGGGG + Intergenic
1032044907 7:128596927-128596949 TGGAGCTTACATTCCAGTGGGGG - Intergenic
1032805970 7:135354536-135354558 AAAAGCTTACAGTCTAGTGGAGG + Intergenic
1033437872 7:141350380-141350402 CAGACCTTACATTCTAGTGGGGG - Intronic
1036707684 8:11057314-11057336 GCAAGCTTACATTCTAGTGGGGG - Intronic
1037065387 8:14570333-14570355 CACACCTTATATTCTTGTTGAGG - Intronic
1037287073 8:17312612-17312634 CAGAGCTTATATTCTGCTGGGGG - Intronic
1037446926 8:18974610-18974632 TGGACCCTACATTCTAGTGCAGG + Intronic
1037599646 8:20383254-20383276 TAGAACTTACATTCTAGTGAAGG - Intergenic
1037839889 8:22237102-22237124 TAGGGCTTACATTCTGGTGGGGG + Intergenic
1038179400 8:25212471-25212493 AAGAGCTTACATTCTAGTCGGGG + Intronic
1039390662 8:37178704-37178726 CAGCACTTAGAATCTAGTGGAGG + Intergenic
1039792345 8:40885946-40885968 CAGAGCTTAGATTCAAGTGGGGG - Intronic
1039840800 8:41291636-41291658 CAGGCCTTACCATCTAGAGGAGG - Intronic
1040741604 8:50582364-50582386 TAGAACTTACATTCTAGTGAGGG + Intronic
1041623070 8:59995983-59996005 GTGACCTTACATTCTAGTGAGGG - Intergenic
1041678202 8:60557977-60557999 CAGAGCTTACAGTCTAGTTCAGG - Intronic
1041961255 8:63618759-63618781 TGGAGCTTACATTCTAGAGGAGG - Intergenic
1042063362 8:64845843-64845865 CAGATCTTATATTTTAGTGATGG + Intergenic
1042124598 8:65525389-65525411 CCGAGCTTACACTCTAGTGAGGG - Intergenic
1042161410 8:65899653-65899675 TAGAACTTACAGTTTAGTGGGGG - Intergenic
1042204224 8:66312296-66312318 TAGAGCTTGCATTCTAGTGGGGG - Intergenic
1042318753 8:67452627-67452649 GAGAGCTTCCATTCCAGTGGTGG + Intronic
1042363197 8:67906167-67906189 TAGTCCTTACATTCTTGTGGGGG + Intergenic
1042467510 8:69144733-69144755 TGGAGCTTACATTCCAGTGGAGG + Intergenic
1042672859 8:71283423-71283445 GGGAACTTACATTCTATTGGAGG - Intronic
1042767285 8:72337356-72337378 CAGAACTCACATTCTAGTAGAGG - Intergenic
1043038416 8:75228272-75228294 GGGAGCTTACATTCTAGTGGAGG + Intergenic
1043920342 8:85975440-85975462 AAAAGCTTAGATTCTAGTGGTGG + Intergenic
1044809781 8:96047712-96047734 TGGAGCTTACATTTTAGTGGGGG + Intergenic
1044830723 8:96245137-96245159 AGGAGCTTACAATCTAGTGGGGG - Intronic
1044848019 8:96400460-96400482 AAGTACTTACATTCTAGTGTAGG + Intergenic
1045233259 8:100326516-100326538 CAGATCTTGCAGTCTAGTGAGGG + Intronic
1045243628 8:100423957-100423979 CAGAGCTTACATTTTAGTGGGGG + Intergenic
1045565191 8:103307468-103307490 CAGAATTTATATTCTAGTGGAGG + Intronic
1045566457 8:103320967-103320989 TGGACCTTACATTTTAGTGGAGG + Intronic
1045674953 8:104597284-104597306 CAGAACTTATAATCTAGTGGGGG + Intronic
1045710641 8:104979540-104979562 TGGACCTTGCATTCTAGAGGTGG + Intronic
1046278861 8:111998193-111998215 TTGAGCTTACATTCTAGTGGTGG - Intergenic
1046278931 8:111999491-111999513 AAGACCTCACATTCTTGTGGTGG - Intergenic
1047236386 8:123045738-123045760 TGGAACTTACATTCTAGAGGAGG + Intronic
1047417634 8:124678351-124678373 CAGACCCTGCACTCAAGTGGTGG - Intronic
1047500681 8:125438484-125438506 CAGGACTTACAGTCTAGTTGGGG + Intergenic
1047597944 8:126397295-126397317 CAGAGCTTACATGCTGGTAGCGG + Intergenic
1048553496 8:135455228-135455250 CAGAACTTACATTCTATGGTAGG - Intergenic
1048974005 8:139661272-139661294 CAGAGCTTACATCCCAGTGTGGG + Intronic
1049138144 8:140924402-140924424 CGGAGCTTGCATTGTAGTGGGGG - Intronic
1050068562 9:1786630-1786652 CAGAGTTTACATTCTAGTGGGGG - Intergenic
1050217163 9:3339684-3339706 TGAAGCTTACATTCTAGTGGGGG + Intronic
1050656419 9:7833421-7833443 TAGAGCTTACATTCTAGTGGAGG - Intronic
1050701745 9:8347441-8347463 CGGAGCTTACAGTTTAGTGGGGG + Intronic
1050783109 9:9364333-9364355 AAGTGCTTACATTCTAATGGAGG + Intronic
1051042325 9:12826417-12826439 CAGACCTTTCATTCTAGTGTGGG - Intergenic
1051145277 9:14020644-14020666 AGGACCTTACATTCTAGCAGGGG - Intergenic
1051208615 9:14716987-14717009 TAGAGCTTACATTCTATTGGGGG - Intergenic
1051336973 9:16074533-16074555 CAGTGCTTACCATCTAGTGGGGG + Intergenic
1051346910 9:16160171-16160193 TGGAACTTACAGTCTAGTGGAGG + Intergenic
1051807366 9:21010470-21010492 CAGAGCTTACAGTCTAGTCAAGG + Intronic
1051995288 9:23208583-23208605 CGGAGCTTACATTCTAATGCAGG + Intergenic
1052432109 9:28379851-28379873 CAGAAGTTGCATTCAAGTGGGGG + Intronic
1052788173 9:32849384-32849406 CAGGGCTTATAGTCTAGTGGAGG - Intergenic
1053055651 9:34991739-34991761 CAGACGTGACATGCTGGTGGGGG + Intronic
1053492570 9:38520724-38520746 AATAGCTTACATTCTAGTTGAGG - Intergenic
1054777283 9:69134284-69134306 CAGAGCTTACAGTCTGGAGGAGG + Intronic
1054931925 9:70644164-70644186 CAGAGCTTACATCCTACTGGTGG + Intronic
1054952868 9:70872644-70872666 AGGAACTTATATTCTAGTGGGGG - Intronic
1055003608 9:71481595-71481617 CAAAGCTTACATTCTAGCGAAGG + Intergenic
1055560261 9:77515265-77515287 TAGATCTTCCATTCTAGTGGAGG + Intronic
1055633298 9:78247178-78247200 TAGAGCTTACATTCTAGTTGGGG + Intronic
1055744864 9:79432229-79432251 CAGACCTTATATGCTATTTGTGG - Intergenic
1055754330 9:79541718-79541740 CAGGCCTTGCAGTCTAGAGGTGG - Intergenic
1055930756 9:81557615-81557637 CAGACCACACAAACTAGTGGAGG - Intergenic
1056361613 9:85863267-85863289 CAGCCCTCAGAGTCTAGTGGAGG - Intergenic
1057007383 9:91572756-91572778 AGGACCCTACATTCTAGTGATGG + Intronic
1057672809 9:97109658-97109680 AATAGCTTACATTCTAGTTGAGG - Intergenic
1057846196 9:98526613-98526635 AGGAGCTTACATTCTAGTGGGGG - Intronic
1058596360 9:106620151-106620173 TAGAACTTACAGTCTAGTGGAGG + Intergenic
1059829934 9:118084078-118084100 CAGAGCTTATATGCTAGTGATGG + Intergenic
1060085354 9:120695093-120695115 TGGACCTTACATTCTAGTGCTGG + Intronic
1060240682 9:121899757-121899779 TGGAGCTTACGTTCTAGTGGTGG - Intronic
1060262734 9:122090733-122090755 TGGAGCTTACATTCTAGTGAGGG + Intronic
1060429331 9:123535849-123535871 TGGAATTTACATTCTAGTGGAGG - Intronic
1061206796 9:129168900-129168922 TAGAGCTTACATTCTAGTGGTGG - Intergenic
1061635504 9:131905947-131905969 CAGAGCTAACAGTCTAGTGAAGG + Intronic
1062702545 9:137914919-137914941 TGGAGCTGACATTCTAGTGGGGG + Intronic
1186604922 X:11079468-11079490 CAGACCTCACATTTCAGTGTAGG + Intergenic
1186986563 X:15021030-15021052 CAGATCTTACATTACAGTGATGG - Intergenic
1187094474 X:16131988-16132010 TGGAGCTTATATTCTAGTGGTGG - Intronic
1187237024 X:17477086-17477108 GAGAACTTGCAGTCTAGTGGAGG + Intronic
1187539816 X:20181572-20181594 CAGAGCTTATATTTTAGTGGGGG - Intronic
1187920689 X:24198664-24198686 TAGACATTACATTCTAGCAGAGG + Intronic
1188567748 X:31545784-31545806 CAGACCCTGCCTGCTAGTGGAGG - Intronic
1188569855 X:31571474-31571496 CAGAGCTCACAATCTAGTAGCGG - Intronic
1189229747 X:39443090-39443112 CGGAGCCTACATTCTAGTGGGGG + Intergenic
1189410518 X:40766400-40766422 TAGAGCTTGCATTCCAGTGGGGG - Intergenic
1191857377 X:65637979-65638001 TGGAACTTACATTCTAGTGGGGG - Intronic
1191925172 X:66301304-66301326 CAGAACTTACATTCTAGTGGAGG - Intergenic
1192171492 X:68858166-68858188 GAGAGCGTACATGCTAGTGGAGG + Intergenic
1192372256 X:70524197-70524219 AAGAGCTTACATTCTAGTGGGGG - Intergenic
1192537279 X:71938961-71938983 CAGAAATTAGAGTCTAGTGGGGG + Intergenic
1193082367 X:77418324-77418346 TGGGGCTTACATTCTAGTGGAGG + Intergenic
1193102732 X:77634438-77634460 AGGAGCTTATATTCTAGTGGAGG - Intronic
1193374727 X:80745317-80745339 AAGACCTTATATTCTAGAAGTGG - Intronic
1194545852 X:95232527-95232549 TGGACCTTACATTCTGGTAGTGG - Intergenic
1194638085 X:96370131-96370153 TGGAACTTACATTCTAGTTGGGG + Intergenic
1194755193 X:97731199-97731221 GAGAGCTTACATTTTAGTGGAGG + Intergenic
1195009461 X:100721407-100721429 TACAGCTTACAATCTAGTGGGGG - Intronic
1195320286 X:103716249-103716271 AAGAGCTCACAGTCTAGTGGAGG - Intronic
1195405733 X:104511254-104511276 GTGAGCTTACATTCTAGTGAAGG - Intergenic
1195700256 X:107699989-107700011 TGGAGGTTACATTCTAGTGGAGG - Intergenic
1196086272 X:111685606-111685628 TGGTGCTTACATTCTAGTGGTGG + Intronic
1196172799 X:112608528-112608550 CGAAGCTTACATTCTAGTGTGGG - Intergenic
1196209186 X:112975609-112975631 TAGAACTTCCATTCTAGCGGAGG + Intergenic
1196428992 X:115602206-115602228 AAGAGCTTACTGTCTAGTGGGGG - Intronic
1196466432 X:115976344-115976366 TAGAGCTCACATTCTAGTAGAGG + Intergenic
1197181488 X:123541629-123541651 CAGAGCTTCCATTCTAGTGGAGG + Intergenic
1197263715 X:124344126-124344148 TGGACCTTACATTCTAGTGGGGG + Intronic
1197329761 X:125139144-125139166 CAGAGCTTACAATCTGATGGGGG + Intergenic
1197445370 X:126546912-126546934 CAGAGCTCATATTCAAGTGGAGG + Intergenic
1197954847 X:131935010-131935032 GGGACCTTACTCTCTAGTGGAGG + Intergenic
1198364963 X:135930955-135930977 TGGATCTTACATTCCAGTGGAGG + Intergenic
1198599848 X:138270665-138270687 TAGATCTTACATTCCAGTGGAGG - Intergenic
1198802730 X:140463979-140464001 TGGAGCTTACATTCTGGTGGGGG + Intergenic
1198880531 X:141276246-141276268 CAGAGCTCACATTCTGGTAGGGG + Intergenic
1199076091 X:143528992-143529014 CAGTTCTTACATACTCGTGGAGG + Intergenic
1199084706 X:143615437-143615459 CGGAGCTTACAATCTAGTGGAGG - Intergenic
1199444668 X:147908533-147908555 CTGAGCTTACACTCTAGTGAGGG + Intergenic
1199654153 X:149978199-149978221 TATAGCTTACATTCTAGTGGGGG - Intergenic
1199814438 X:151385413-151385435 TTGAACTTAAATTCTAGTGGAGG - Intergenic
1199837348 X:151605092-151605114 AACACCTTACATTCTTGAGGGGG - Intronic
1200031833 X:153303308-153303330 TGGAGCTGACATTCTAGTGGAGG - Intergenic
1200930415 Y:8691898-8691920 CATACCTTAGATTCCAGAGGTGG + Intergenic
1202299617 Y:23398431-23398453 TGGAATTTACATTCTAGTGGGGG + Intergenic
1202571192 Y:26272167-26272189 TGGAATTTACATTCTAGTGGGGG - Intergenic