ID: 1033439074

View in Genome Browser
Species Human (GRCh38)
Location 7:141362357-141362379
Sequence GTACACTTCAAAGCCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033439074 Original CRISPR GTACACTTCAAAGCCAAAAC AGG (reversed) Intronic
908591324 1:65638596-65638618 GCTCACTTCATAGCCACAACTGG - Exonic
912063699 1:105707426-105707448 GGACACTTCAAAGCCAATTTGGG + Intergenic
917454857 1:175177470-175177492 GTAAAAGTCAAAGCCAGAACAGG - Intronic
917981967 1:180275205-180275227 GGACACTTAAAAACCAAAACAGG - Exonic
919260438 1:195186514-195186536 GTACACCTTAAATCCAAAAATGG + Intergenic
920722418 1:208400059-208400081 GTACTTTTCAAAGCAAAGACAGG + Intergenic
923380160 1:233409438-233409460 ATACAATTAAAAGCAAAAACAGG - Intergenic
1063892962 10:10649178-10649200 ATACTCTTCATAGCCAAAAATGG + Intergenic
1063939461 10:11112047-11112069 GTCTCCTTGAAAGCCAAAACTGG - Intronic
1064534080 10:16341005-16341027 GTTAACTTCAAAGTAAAAACAGG + Intergenic
1070209609 10:74302420-74302442 GTCCATTTGAAAGCAAAAACAGG - Intronic
1074260546 10:111848922-111848944 GTACCCTGCAAAGCCACAAGGGG + Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1081314276 11:41612559-41612581 GGACACTGCAAAGCCAGAGCAGG - Intergenic
1087290154 11:96312295-96312317 GAAAACTCCAAAGCCAAAACAGG + Intronic
1095515687 12:43002843-43002865 GTACACTTGAGAGCCAAAAAGGG + Intergenic
1096860471 12:54523682-54523704 GTAGACTTCAAAGGCAAAGTAGG - Intronic
1096916798 12:55041655-55041677 GTACAATTCAAATCAAAGACTGG - Intergenic
1097345459 12:58487162-58487184 GAAAAGTTCAAAGCCAAAGCAGG - Intergenic
1097440505 12:59602353-59602375 GAGCACATGAAAGCCAAAACAGG - Intronic
1102690135 12:114753913-114753935 TTAAACTTCAAAGCCAAAGAGGG - Intergenic
1102778307 12:115540472-115540494 CTACCCTGGAAAGCCAAAACAGG - Intergenic
1103422056 12:120794312-120794334 GCACACTATAAAGCCAAAAAAGG - Intronic
1106783026 13:33078801-33078823 GTACACTTCAAAACCACATCTGG - Intergenic
1106924395 13:34599026-34599048 GTCCACTCCAAAGCAAATACAGG + Intergenic
1108486441 13:50931074-50931096 TTACACTTGAAATACAAAACAGG + Intronic
1108621545 13:52189678-52189700 GTCCACTTAAAAGCTACAACTGG - Intergenic
1108665145 13:52622203-52622225 GTTCACTTAAAAGCTACAACTGG + Intergenic
1110833972 13:80063428-80063450 ACTCACTTCATAGCCAAAACAGG - Intergenic
1112559240 13:100497346-100497368 GCATACTTCAAAGCCAAATTCGG - Intronic
1115292512 14:31788507-31788529 GTAGACTTCATATCCAACACTGG - Intronic
1116589582 14:46754428-46754450 CTACACTTAAAACACAAAACAGG + Intergenic
1120637032 14:86965415-86965437 GTACACTGCAAAGCCACAGGTGG + Intergenic
1130727386 15:86453362-86453384 GGAAACTTCAAATCCAATACAGG + Intronic
1135332170 16:21569692-21569714 GGACTCTTCAAGGCCAACACCGG + Intergenic
1150149180 17:62794985-62795007 CTACTCTTCACAGCCAAAACAGG - Intronic
1150953477 17:69828000-69828022 GTAGACTTCAGAACCCAAACAGG - Intergenic
1153800512 18:8663875-8663897 GTACACAGCAGAGCCTAAACTGG + Intergenic
1157363274 18:47038981-47039003 CTACACTCCAAAGCAGAAACAGG + Intronic
1157476324 18:48025823-48025845 ATGAATTTCAAAGCCAAAACAGG + Intergenic
1159240893 18:65742189-65742211 GTAGACGTCAAAGCCTAAAGTGG - Intergenic
1159907819 18:74113850-74113872 TTACACTTCAAAGACACAACTGG + Intronic
1167913499 19:52722113-52722135 GTACATTGCAAGGCCAAGACAGG + Intronic
926368688 2:12158055-12158077 TTATTCTTCATAGCCAAAACTGG - Intergenic
931818942 2:65932404-65932426 ACACATTTCAAAGCCAGAACTGG + Intergenic
932162922 2:69479166-69479188 TTACACATAAAAGCCAAAGCGGG + Intronic
933445782 2:82378073-82378095 GTACCCTGCAAAGCCACAAGAGG + Intergenic
937401146 2:121584850-121584872 GTACAATTTAAATCCATAACAGG + Intronic
938986301 2:136579681-136579703 GTACTTTTCAAAACCAAAAAGGG + Intergenic
942264748 2:174211527-174211549 GTACATATCATATCCAAAACTGG + Intronic
942325993 2:174777678-174777700 GAACAATTCAAAGACAGAACTGG + Intergenic
942512604 2:176718159-176718181 GTACATTTCAAAGCTGAATCAGG + Intergenic
942759600 2:179382914-179382936 GCACCCATCAAAGCCAAGACTGG + Intergenic
944505555 2:200407054-200407076 TTCCACTTCAAAGCCACACCTGG + Intronic
945499969 2:210559899-210559921 GAACATTTTAAAGCAAAAACTGG + Intronic
945682837 2:212934669-212934691 GTACACTTGAAAGAGAAAAGAGG + Intergenic
947014572 2:225604303-225604325 GTTCACATTAAAGCCAAAAAAGG - Intronic
948259219 2:236590515-236590537 GGCCACCTCAAAGCCAAGACAGG - Intergenic
1169478836 20:5958512-5958534 GTACACCCTAAAGACAAAACAGG - Exonic
1170365714 20:15596590-15596612 GTACTCTTGAAAGCCATGACTGG + Intronic
1171297288 20:24029253-24029275 GAAAACTTCAAAGCCAGAGCTGG - Intergenic
1172867066 20:38108407-38108429 GTATACATCAAGGCCAGAACAGG + Intronic
1174468945 20:50741205-50741227 GAACACTTCGAGGCCAAGACGGG - Intronic
1183252521 22:36740199-36740221 CTTTAATTCAAAGCCAAAACAGG + Intergenic
949165095 3:930457-930479 TGACACTTCTAAGGCAAAACTGG + Intergenic
954176053 3:48847007-48847029 GTTGTCTTCGAAGCCAAAACTGG + Intronic
954948473 3:54447672-54447694 TTACACGTCAAAGCAAATACAGG + Intronic
955849066 3:63200066-63200088 GTATATTTCAGAGCCAGAACTGG + Intergenic
959712911 3:109402523-109402545 GAAAAATTAAAAGCCAAAACAGG - Intergenic
961617620 3:128195491-128195513 GGACACTCCAAAGCCAAACTTGG + Intronic
963688544 3:148469753-148469775 GTAAAGCTCAAAGCCAAAATGGG + Intergenic
966611308 3:181870539-181870561 GAACTTTTCAAAGCCAAAAGCGG - Intergenic
969057075 4:4408758-4408780 GTATGTCTCAAAGCCAAAACGGG - Intronic
970797530 4:19931407-19931429 GTACACATGAAACACAAAACAGG + Intergenic
972617496 4:40714145-40714167 GTAAACTTGAATACCAAAACCGG - Intergenic
973336988 4:48966854-48966876 ATACACTTCAAAACCAAGAGGGG + Intergenic
980076826 4:128302804-128302826 GTAGACTTGAAAGGCAAAAGGGG + Intergenic
980602678 4:135045446-135045468 CTACACCTAAAAGCCAAAATGGG + Intergenic
980841212 4:138263908-138263930 GAAGACTTCAAAGCAAAAACTGG - Intergenic
981648830 4:147032004-147032026 GTACACTTCAAAAGTAAAAGGGG - Intergenic
982156735 4:152530699-152530721 TTACACTACAAAGCCAGGACTGG - Intronic
982247831 4:153371834-153371856 ATACAGTCAAAAGCCAAAACAGG - Intronic
988155251 5:27441501-27441523 GTACAGTACAAAGCCATCACAGG - Intergenic
992541548 5:77770484-77770506 GAACACTTCACTGCTAAAACTGG - Intronic
995229491 5:109743099-109743121 GGTCACTTCAAAGCCAAAAGAGG - Intronic
995395903 5:111686629-111686651 GTTCACTTCAAGTCCAAAAGTGG - Intronic
996469745 5:123845688-123845710 TTACATATCAAAACCAAAACTGG + Intergenic
998448793 5:142218712-142218734 GTACACTTCAAAGGTAGAACTGG - Intergenic
998925230 5:147116060-147116082 GTATACTTAATAGCCCAAACTGG - Intergenic
999649508 5:153751463-153751485 TAACACTTGAATGCCAAAACAGG - Intronic
1000662098 5:163949778-163949800 GAACTCTTAAAGGCCAAAACAGG - Intergenic
1006958894 6:37905938-37905960 GTATACATAAAAGCCAAAAGAGG + Intronic
1008030699 6:46689908-46689930 GTGCACTTCACAGCCAATATTGG - Exonic
1008302667 6:49860723-49860745 GGACAAATCAAACCCAAAACTGG + Intronic
1015607703 6:134976183-134976205 GTACAAATCAAAGCCACAATGGG + Intronic
1016605364 6:145916353-145916375 GAACATCTCAAATCCAAAACTGG - Intronic
1017536421 6:155351671-155351693 AGACACTTTAAAGCCAAAATTGG - Intergenic
1019765639 7:2848095-2848117 GTACACTGCAAACCCCGAACTGG + Intergenic
1021505776 7:21383358-21383380 GTACATTTCACAGCCAAAACAGG + Intergenic
1022077640 7:26988818-26988840 GTACACTTCTAGGTCAAAAGGGG - Intronic
1023476904 7:40590289-40590311 GAACACTTCAAGGCCAATATAGG - Intronic
1027460806 7:78451145-78451167 GAACACTTCCAAGCCACAAGTGG - Intronic
1027751861 7:82159137-82159159 TTGTACTTCAAAGCCAAAATAGG - Intronic
1028090033 7:86688400-86688422 GTACATTTCAAAGTCATAAAAGG + Intronic
1030964117 7:115968184-115968206 AGACACTTCAAAGTTAAAACTGG - Intronic
1031189848 7:118534683-118534705 GTACATTTTAAAGCCATAAAAGG + Intergenic
1031365532 7:120895941-120895963 GTACCCTGCAAAGCCACAAGGGG + Intergenic
1032043529 7:128582524-128582546 ATACACTTTAAAGGAAAAACAGG - Intergenic
1033122464 7:138678195-138678217 GGACAATTCAAATTCAAAACAGG - Intronic
1033439074 7:141362357-141362379 GTACACTTCAAAGCCAAAACAGG - Intronic
1035329374 7:158086055-158086077 GTATGCTTCAAAGCCAAAGCAGG - Intronic
1035465727 7:159075422-159075444 GGAGACTTCAAAGCCAAAACTGG - Intronic
1036729266 8:11247905-11247927 TTAAACTTTAAAACCAAAACAGG + Intergenic
1038631743 8:29251739-29251761 GTGCACTTCAAAGGCTAAAATGG + Intronic
1041539716 8:58969801-58969823 AAACATGTCAAAGCCAAAACTGG + Intronic
1043266235 8:78270695-78270717 GTACCCTGCAAAGCCACAGCAGG - Intergenic
1045387351 8:101684563-101684585 GTACATTTCAAAGTCATAAAAGG - Intergenic
1045608534 8:103807130-103807152 GTTCACAACACAGCCAAAACAGG + Intronic
1049123521 8:140763220-140763242 GCACACTTGAAAGGCAACACTGG + Intronic
1056487783 9:87076206-87076228 ATTCACTTCAAAACCTAAACAGG + Intergenic
1056695501 9:88846808-88846830 GTACACTGCAAAGTCACAAGGGG + Intergenic
1057796709 9:98162979-98163001 GCCCACATCAAAGCCACAACAGG + Intronic
1058780079 9:108324756-108324778 GTACACTTCAAAGGCTATATAGG + Intergenic
1188309948 X:28604308-28604330 GTAAATGTCAAAGCCAAAATTGG - Intronic
1188770739 X:34150393-34150415 GTAAATTTCAAAGCAAAAAGTGG + Intergenic
1188796577 X:34473869-34473891 GTAAATTTCAAAGCAAAAAGTGG + Intergenic
1193843234 X:86435583-86435605 GGACATTCCAAAGCAAAAACAGG - Intronic
1194811220 X:98389492-98389514 GCACACCTAAAAGCCAAAATGGG + Intergenic
1197206772 X:123797820-123797842 GTATACATCAGAGCCAATACGGG + Intergenic
1198475237 X:136990470-136990492 GTAGACCTCAAAGCCTAAACTGG + Intergenic
1198707629 X:139465950-139465972 GTACACCACAGAGCCAAGACTGG + Intergenic