ID: 1033440192

View in Genome Browser
Species Human (GRCh38)
Location 7:141371553-141371575
Sequence AAGTGGGGCTAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 683
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 627}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033440192 Original CRISPR AAGTGGGGCTAGAAGGAAGA AGG Intronic
900242445 1:1623516-1623538 AAGTGGGGCCAGCAGGACGGCGG + Exonic
900471997 1:2859602-2859624 AAGGAGGGGTAGGAGGAAGAAGG + Intergenic
901639914 1:10687967-10687989 TAGTGGGGGCAGAAGGAGGAAGG - Intronic
902161241 1:14532088-14532110 AAGTGGTGCAAGAAGGAAGGTGG + Intergenic
902434742 1:16391175-16391197 CCATGGGGCTAGAAGGGAGATGG + Intronic
902584321 1:17428811-17428833 AAGTGAGGTGAGAGGGAAGATGG + Intronic
902770054 1:18640716-18640738 AATGGGGGCTCGGAGGAAGATGG + Intronic
903536636 1:24071303-24071325 AGGTGGGGCTGGAAGGGAGCGGG - Intronic
903550755 1:24156208-24156230 CAGTGAGGGTAGAAGGAAGGAGG + Exonic
903956868 1:27031864-27031886 AAGTGGGGAGAGACGGAAGGAGG - Intergenic
904443457 1:30548813-30548835 AAGTGAGCCTAGAAAGTAGAAGG - Intergenic
904877090 1:33663507-33663529 AATTGGGGCTAGAGGGCAGGGGG + Intronic
904926492 1:34053025-34053047 AAGTGGCTTTGGAAGGAAGAGGG + Intronic
904969182 1:34405755-34405777 AAGGTGGGGTAGGAGGAAGAGGG - Intergenic
905291905 1:36927650-36927672 AAGGGAGGCAAGAACGAAGAGGG + Intronic
905323138 1:37131797-37131819 AAGTGGGGAAGGAAGGAAGGGGG - Intergenic
906489745 1:46259132-46259154 AACTGGGGCTTGGAGGAATAGGG + Intronic
906607550 1:47182509-47182531 AAGTGGGGCCAGAAGGTAGGAGG - Intergenic
906820958 1:48929415-48929437 AAGGGGGGCAGGAAGGAAGTTGG - Intronic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
907355436 1:53869078-53869100 AAGTGGGCATGGAAGGTAGAGGG + Intronic
907364505 1:53946972-53946994 TAGTGAGGCGTGAAGGAAGAGGG + Intronic
908498836 1:64722675-64722697 CAGTGGAGCGAGCAGGAAGATGG + Intergenic
908970470 1:69822578-69822600 AAGTGGGGCAAGAAAGAGGTAGG + Intronic
909181055 1:72424615-72424637 ACTTGAGGGTAGAAGGAAGAAGG + Intergenic
909265532 1:73553275-73553297 AAGTGTGGCTAGAATAAAGCAGG + Intergenic
909458682 1:75882416-75882438 AAGTGGGGGGAGGAGGAAGAGGG - Intronic
909553700 1:76929019-76929041 AAGTAAGGCTTGAAGGAAGCTGG - Intronic
910689618 1:89952792-89952814 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
912240873 1:107906795-107906817 AAGCAGGGTGAGAAGGAAGAAGG + Intronic
912253267 1:108032729-108032751 AAGTTGGGAAAGAAGAAAGATGG + Intergenic
913229622 1:116730877-116730899 GCCTGGGGCAAGAAGGAAGAAGG + Intergenic
916195524 1:162218755-162218777 GAGTGGGGCTGGAAGGGACAGGG - Intronic
916399424 1:164430081-164430103 ATGTGAGGCTAGAAGTGAGAAGG + Intergenic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
918248575 1:182681866-182681888 AAAAGGTTCTAGAAGGAAGAGGG - Intronic
918524403 1:185450124-185450146 AAAAGGAGCAAGAAGGAAGAAGG - Intergenic
918608009 1:186452815-186452837 AAGTAAGGCAAGAAGGCAGAAGG + Intronic
919260047 1:195180540-195180562 GAGTGGGGAGAGAAGAAAGAGGG - Intergenic
919276820 1:195428858-195428880 TTGTGGGGTTAGAAGCAAGATGG + Intergenic
919404334 1:197158990-197159012 AAGAAGGGCTAGGAAGAAGAAGG + Exonic
919651271 1:200151082-200151104 AGGTGGGGCTGGGAGGAAAATGG + Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920601872 1:207333924-207333946 AAGTGAGACAAAAAGGAAGAGGG + Intronic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921166072 1:212508104-212508126 AAATAGGGCTAAAAGGCAGAGGG + Intergenic
921279259 1:213549542-213549564 AAGTAGGGCAAGAAGGAGGCAGG + Intergenic
921422066 1:214959677-214959699 AAGTGGAGGCAGAAGGGAGAGGG + Intergenic
921944518 1:220877618-220877640 AAGTGGCACTAGAAAGCAGAGGG + Intergenic
922046607 1:221951392-221951414 AAGAGGGGCTGCAAAGAAGAAGG - Intergenic
922308655 1:224367297-224367319 AAGTAGGGTTTGGAGGAAGATGG + Intronic
922334129 1:224605359-224605381 CTGTGGGGCTAGAAGCAAGATGG - Intronic
922456436 1:225777425-225777447 TAGTGGAGCGCGAAGGAAGAAGG - Intergenic
922525706 1:226301723-226301745 AAGAGGGGCTAGAATAAAGTTGG + Intronic
922598445 1:226832086-226832108 AAGTTGGGACAGAAGGAAGATGG + Intergenic
922876458 1:228943390-228943412 AAGGGGAGCTAGAAAGCAGATGG - Intergenic
922930336 1:229384003-229384025 AAGTGGGGGTTCAATGAAGATGG - Intergenic
923075412 1:230604684-230604706 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
923372775 1:233328836-233328858 AAGTGGGGCCAGAGGGAGGTGGG + Intronic
923397795 1:233584193-233584215 AAGAGGAGCTGGAAGGGAGATGG - Intergenic
923675763 1:236079642-236079664 AAGTAGGCTGAGAAGGAAGAAGG - Intergenic
924297684 1:242604781-242604803 AAATGGGGGTGGATGGAAGAGGG + Intergenic
1063503083 10:6572134-6572156 CTCAGGGGCTAGAAGGAAGAGGG - Intronic
1064648242 10:17482094-17482116 CTGTGAGGCTAGAAGCAAGACGG + Intergenic
1064708832 10:18101631-18101653 AGGAGGGGCTTGAAGGATGAAGG - Intergenic
1065438589 10:25726554-25726576 AAGTGGGGAGAGAGGAAAGAAGG - Intergenic
1066061555 10:31727965-31727987 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1066242368 10:33550819-33550841 AGGAGGGGCTGGAAGGAGGAAGG - Intergenic
1066313551 10:34221244-34221266 AAATGGGGCTACAAGGAAAGCGG - Intronic
1067208195 10:44237495-44237517 AAGTGGGAAGAAAAGGAAGAAGG + Intergenic
1067908608 10:50320757-50320779 AAGTGGAGATAGAGGGAGGAAGG - Intronic
1068876267 10:61999934-61999956 AAGTGGGGCTGGGAGGATGCTGG + Intronic
1069136603 10:64773982-64774004 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1069416428 10:68204858-68204880 AAGTGGGGGGACTAGGAAGAAGG - Intronic
1069685209 10:70313535-70313557 TTGTGAGGCTAGAAGCAAGATGG - Intronic
1069806450 10:71128161-71128183 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1069993528 10:72329105-72329127 AAGTGGGGCCAGAATGGAGCTGG - Intergenic
1071447869 10:85765809-85765831 AAGTGTGGCTAACAGGAAGTTGG - Intronic
1071614720 10:87064940-87064962 AGGTGGGGCTAGGACAAAGAGGG + Intronic
1071815455 10:89227823-89227845 TGGTGGAGCCAGAAGGAAGAGGG + Intronic
1072275750 10:93821007-93821029 CGGTGAGGCTAGAAGCAAGATGG + Intergenic
1073244701 10:102081496-102081518 AGCTGGGACTAGAAAGAAGATGG + Intergenic
1073787306 10:106903958-106903980 AAGTGAGGATTGAGGGAAGAAGG - Intronic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1074909550 10:117895326-117895348 AAGTGGTGCTGATAGGAAGAGGG + Intergenic
1075017613 10:118921832-118921854 TAGTGGGCCTAGAAAGAACAAGG + Intergenic
1075051376 10:119184728-119184750 GAATGGGGCTACATGGAAGACGG - Intergenic
1075303672 10:121348502-121348524 AGGTGGGGCAAGGGGGAAGAGGG - Intergenic
1075413738 10:122247747-122247769 CAGTGGGGGTAGAAGGGAGACGG + Intronic
1075421434 10:122303991-122304013 AAGAGGGGCTAGCAGCAACATGG - Intronic
1075445820 10:122512110-122512132 CTGTGGGGGTAGCAGGAAGAGGG + Intronic
1075744655 10:124718397-124718419 ATGTGGGGGTAGAAGGGAGAAGG - Intronic
1075854960 10:125621903-125621925 CAGTGCGGCTAGAACGAAGCAGG - Intronic
1076001500 10:126916702-126916724 AAGGAGGGGTAGAAGGAAGGAGG - Intronic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076499821 10:130928792-130928814 AAGTCTTTCTAGAAGGAAGAAGG - Intergenic
1076515166 10:131041464-131041486 AATTGTGGCTAACAGGAAGAGGG + Intergenic
1077455984 11:2681214-2681236 AAGAGTGGGTAGAAGGAAGCAGG + Intronic
1077663252 11:4087530-4087552 AGGTGAGGCTAGAATGACGAAGG + Intronic
1077789960 11:5428676-5428698 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077914995 11:6605652-6605674 GAGTGGGGCGGGTAGGAAGAGGG - Intronic
1079341976 11:19618811-19618833 AAGTGGAGTAAGAAGGAAGATGG + Intronic
1079930050 11:26547119-26547141 AAGGGATGCTAGTAGGAAGATGG + Intronic
1081526614 11:43932022-43932044 AAGTGGGCCCATAAGGATGACGG + Intronic
1081759696 11:45568637-45568659 AGGTGGGGCAAGAAGTAGGAGGG - Intergenic
1081806768 11:45895141-45895163 AAGTGGGGCGGGAGGGATGATGG + Intronic
1083198928 11:61107902-61107924 AACTGGGGCCAGAAGGAGGGAGG - Intronic
1083340855 11:61957500-61957522 AACTGAGGCTAGAAGGACCAAGG + Intronic
1083993810 11:66262266-66262288 AAGTGAGGCAGGAAGGAACATGG - Intronic
1085172474 11:74461000-74461022 AAGTGAGGGTTGAAGGAGGAAGG + Intronic
1085204515 11:74722742-74722764 GAGTGGGGCTAGAAGAATGCAGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085363699 11:75917188-75917210 TTGTGAGGCTAGAAGCAAGATGG + Intronic
1085489926 11:76906036-76906058 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1087850285 11:103019843-103019865 AAGGGGAGTGAGAAGGAAGAAGG + Intergenic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088678337 11:112217963-112217985 AAGGGGGGCAAGGAGGAAGAGGG + Exonic
1088700811 11:112409596-112409618 AAGAGTAGCTGGAAGGAAGATGG - Intergenic
1089466835 11:118690968-118690990 AAGCGGGGCTCCAAGCAAGAGGG - Intergenic
1089595848 11:119579632-119579654 CTGGGGGGCTAGAAGCAAGAGGG - Intergenic
1089610908 11:119668187-119668209 GAGAGGGTTTAGAAGGAAGATGG - Intronic
1089956647 11:122577315-122577337 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1090807201 11:130210003-130210025 AAGTGGAGCTGGGAGGTAGAAGG + Exonic
1091099233 11:132854876-132854898 CTGTGAGGCTAGAAGAAAGATGG - Intronic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091512155 12:1138736-1138758 AAGTGGGGCAAGGAGGCATATGG + Intronic
1091664550 12:2409904-2409926 AAGTAGGGCTAGGAGGAAAATGG + Intronic
1091685327 12:2557447-2557469 AAGTGAGGCTGGGAGGCAGATGG - Intronic
1091780819 12:3213626-3213648 AAGGGGGGCTGGAAGGGGGAGGG - Intronic
1092170335 12:6370372-6370394 AAGAGGGGCTAGAGGGGAGAGGG - Intronic
1092495981 12:8995562-8995584 ATGTGGGGCAAGGAGGCAGAAGG + Intronic
1092783077 12:12005213-12005235 AAGTGGGACTTGAAAGCAGAAGG - Intergenic
1092924650 12:13262213-13262235 AGGAGGGGCTACAAAGAAGAAGG + Intergenic
1092938145 12:13383166-13383188 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1093896202 12:24577194-24577216 TATTGGTGGTAGAAGGAAGATGG - Intergenic
1095644704 12:44529801-44529823 AAGTGTCACTGGAAGGAAGAAGG + Intronic
1096522578 12:52192502-52192524 GAGAGGGGGTAGAAGGAAGGGGG - Intergenic
1097007269 12:55928260-55928282 AAGTGGGGATATAAGCAGGAAGG - Intronic
1097242912 12:57588472-57588494 ATGTGGGGATTGAAGGAAAAGGG - Intergenic
1097263097 12:57730717-57730739 AAGAGGGGTAAGAGGGAAGAGGG - Intronic
1097336887 12:58393751-58393773 AAGTGTGGCTCAAAGCAAGAGGG + Intergenic
1097978901 12:65717104-65717126 AGTTGAGGCTAGAAGCAAGATGG - Intergenic
1098291874 12:68964276-68964298 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1099585194 12:84505887-84505909 AACTGGGGCTGGAAGGAAGAGGG - Intergenic
1099872993 12:88371142-88371164 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
1100284255 12:93149817-93149839 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1100426685 12:94494151-94494173 CCGTGAGGCTAGAAGCAAGATGG - Intergenic
1100773427 12:97948962-97948984 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1100979573 12:100153926-100153948 AAGAGGGGCTAAAAGGGAAAGGG - Intergenic
1102313660 12:111867764-111867786 AAGCGAGGGTAGGAGGAAGAAGG - Intronic
1102511830 12:113421226-113421248 CAGTGGGGCTGGGAGGGAGAAGG - Intronic
1102798152 12:115707360-115707382 AACTGAGGCTAGAAGGAACAAGG - Intergenic
1103229345 12:119315093-119315115 AGGTGGGGGAAGGAGGAAGAGGG - Intergenic
1103238949 12:119397864-119397886 AAGTGGGGCAGGGAGGAAGGGGG + Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104703002 12:130921440-130921462 AAGTGGGAGCAGAAGGAAGGGGG + Intergenic
1105032429 12:132893174-132893196 AGGAGGGGCTACAAAGAAGAAGG - Intronic
1106828953 13:33557199-33557221 AAGGAGGGAGAGAAGGAAGAGGG - Intergenic
1107048367 13:36019358-36019380 ATTTGGGGCTAGAAGGAGAAAGG - Intronic
1107437187 13:40390364-40390386 AAGTGGGGTTGCAAGGGAGAGGG + Intergenic
1107590079 13:41894382-41894404 AAGTAGGGATAGATGGAAAAAGG + Intronic
1108326410 13:49336708-49336730 TAGTGGCCCTGGAAGGAAGATGG - Intronic
1109343776 13:61091823-61091845 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
1110270252 13:73581377-73581399 ATGTGGGGCTAAAACAAAGAGGG + Intergenic
1110457178 13:75702341-75702363 AAGTTGGGGTAGCAGGCAGAAGG + Intronic
1111695624 13:91620135-91620157 GATTTGGGCTAGAAGGTAGAAGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111872601 13:93851874-93851896 AAGTGGGGATAATAGGAAGTGGG + Intronic
1112206225 13:97325883-97325905 CAGTGGTGCTTGAAAGAAGAGGG + Intronic
1112728715 13:102335028-102335050 AAGTAGGGTTTGATGGAAGAGGG - Intronic
1113324527 13:109268806-109268828 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
1113332319 13:109341814-109341836 AAGTTCGTCTAGAAGGTAGAAGG - Intergenic
1114837231 14:26217217-26217239 AAATGTGGCTAGAAGAAACATGG + Intergenic
1115217741 14:31029214-31029236 AAGTGGGGGTAGAATGGAGGTGG - Intronic
1115814235 14:37145631-37145653 ATGTGGGGCAAGTAGAAAGATGG + Intronic
1117507682 14:56418910-56418932 AGGTGGGGTCAGAAGAAAGAGGG - Intergenic
1118276383 14:64389201-64389223 AAATGAGAGTAGAAGGAAGAGGG + Intronic
1118675792 14:68183397-68183419 CAGTGTGGCTAGAAAGAAGCAGG - Intronic
1119002631 14:70896679-70896701 AAGGGGGGAAGGAAGGAAGAGGG + Intergenic
1119957398 14:78813852-78813874 AAGTGAAGCCAAAAGGAAGAAGG - Intronic
1120042228 14:79767202-79767224 CAGTAGGGCTGGGAGGAAGAAGG - Intronic
1120622447 14:86780916-86780938 AAGTGGGACTTGGATGAAGAAGG - Intergenic
1120648558 14:87102703-87102725 AAGAAGGGCAAGAGGGAAGAGGG - Intergenic
1121086772 14:91152575-91152597 AAGTGTTGCTGCAAGGAAGAAGG - Intronic
1121303828 14:92892462-92892484 CTGTGGGGCTAGAAATAAGACGG - Intergenic
1121406233 14:93720855-93720877 CAGTGGGGATAGGAGGGAGAAGG + Exonic
1121510137 14:94506104-94506126 ATCAGGGGCTAGAAGGATGAAGG + Intronic
1121843621 14:97154867-97154889 AGGTGGGGCTGGAAGGAAGTGGG + Intergenic
1122067411 14:99183507-99183529 AAGTGGGTCTGGAAGGAACATGG - Intronic
1122482746 14:102058023-102058045 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1123068136 14:105628337-105628359 AGGTGGGGGTAGAAGGAGCAGGG - Intergenic
1124483892 15:30099763-30099785 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1124490268 15:30151082-30151104 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1124519687 15:30397461-30397483 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1124538966 15:30568760-30568782 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1124753265 15:32387247-32387269 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1124759683 15:32438812-32438834 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1124975005 15:34522947-34522969 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1125186805 15:36940291-36940313 AAGTAGGGAAAGAAGAAAGAAGG - Intronic
1125286271 15:38095889-38095911 GATTGGAGCTAGAGGGAAGAGGG - Intergenic
1125519647 15:40340694-40340716 AGCTGGGGCTGGGAGGAAGAAGG - Intronic
1125921668 15:43528882-43528904 AAGTTCGGCTAGTAGGAAGAGGG + Exonic
1126161754 15:45620239-45620261 GAGTGGGGCTAGAACGAGAAAGG - Intronic
1126492782 15:49258232-49258254 AAGTGGGGAAAGAAGGGTGATGG + Intronic
1126843949 15:52742045-52742067 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
1127042071 15:54988075-54988097 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1127404953 15:58633915-58633937 AAGAGGGGGTAGAGGAAAGAAGG + Intronic
1127458180 15:59173927-59173949 AAGAGGGTCAAGATGGAAGAAGG + Intronic
1127552700 15:60056828-60056850 AAGTTGGGGTAGAATGAAGGTGG - Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1128334318 15:66776331-66776353 AAGTGGGTGCAGAAGGAAGGAGG - Intronic
1128479345 15:68023839-68023861 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1129210440 15:74064994-74065016 AAGAGAGGCTGGAAGGAAAAGGG - Intergenic
1129403575 15:75300379-75300401 AAGAGGGGCTGGAAGGAAAAGGG + Intergenic
1129840254 15:78739345-78739367 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1130275941 15:82476409-82476431 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1130462370 15:84168746-84168768 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1130468302 15:84203801-84203823 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1130473989 15:84247668-84247690 AAGAGGGGCTGGAAGGAAAAGGG + Intergenic
1130481402 15:84361736-84361758 AAGAGGGGCTGGAAGGAAAAGGG + Intergenic
1130490302 15:84426039-84426061 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1130495964 15:84469741-84469763 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1130501894 15:84504797-84504819 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1130550850 15:84889148-84889170 GAATGGGGGTAGAAGGCAGAAGG - Intronic
1130577042 15:85102204-85102226 AAGAGGGGTTAGAGGGACGAGGG + Intronic
1130590595 15:85208399-85208421 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1130596271 15:85252309-85252331 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1130784722 15:87083487-87083509 GAGTGGGGCAACCAGGAAGAGGG - Intergenic
1131332506 15:91514883-91514905 AGGAGAGGCTACAAGGAAGACGG + Intergenic
1131479887 15:92771664-92771686 TTGTGGGGTTAGAAGCAAGATGG + Intronic
1131661814 15:94525260-94525282 TTGTGAGGCTAGAAGCAAGATGG + Intergenic
1132185332 15:99798331-99798353 AAGTGGGGCTGGAAAGGAAAGGG + Intergenic
1132299491 15:100767317-100767339 AAGTGGGGGGACAAGGATGAGGG - Intergenic
1132991339 16:2796696-2796718 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1133119731 16:3598619-3598641 AAGCTGGGCAAGAAGGAGGAGGG + Intronic
1133655733 16:7862079-7862101 AAGTGCAGCCGGAAGGAAGAGGG - Intergenic
1133766554 16:8842337-8842359 AGGAGGGGCTACAAAGAAGAAGG + Intronic
1134073176 16:11273151-11273173 ACGTGGGGCCAGAAGGGATAGGG + Intronic
1134218212 16:12332868-12332890 AGGTGAGGCTTGAAGGACGAGGG - Intronic
1134682381 16:16135311-16135333 AAGTGGGGACAGATGGAGGAGGG - Intronic
1134847001 16:17448701-17448723 AAGAGGGGGGAGGAGGAAGAGGG + Intronic
1135013334 16:18903469-18903491 TAGTGGTGGGAGAAGGAAGAAGG - Intronic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135438690 16:22448147-22448169 TAGTGGTGGGAGAAGGAAGAAGG + Intergenic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1136330489 16:29572763-29572785 TAGTGGTGGGAGAAGGAAGAAGG - Intergenic
1137613617 16:49834857-49834879 AAGTGGGTCAAGGAGGAAGGAGG + Intronic
1138182135 16:54948595-54948617 GAGTGGGGTCAGATGGAAGAAGG - Intergenic
1138625763 16:58250143-58250165 AGGAGGGCCTAGGAGGAAGAGGG - Intronic
1138884848 16:61064221-61064243 AAGTGTGGTTAGAACCAAGATGG + Intergenic
1139480509 16:67227943-67227965 AAGTGGGCATAGAAGCAAGGAGG - Intronic
1139631421 16:68234164-68234186 AAGTGAGGGTAGGAGGAAGGAGG + Intronic
1139758645 16:69166254-69166276 AGGTGGGGGTGGAAGGAACATGG + Intronic
1140511517 16:75512243-75512265 AAGTGGGGCCAGCTGGAAGGAGG - Intergenic
1140866345 16:79065820-79065842 CCGTGGGGCTAGAAGCAAGATGG + Intronic
1140997215 16:80272602-80272624 AAGTAGGGAAAGAAGGAAGGAGG + Intergenic
1141210172 16:81972379-81972401 AAGTGGGGGGAGGGGGAAGAAGG - Intergenic
1141421538 16:83921019-83921041 GAGGGTGGATAGAAGGAAGATGG + Exonic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1141850661 16:86643268-86643290 AAGGGGTGGCAGAAGGAAGATGG - Intergenic
1142539501 17:647117-647139 AATGGGGGAAAGAAGGAAGAGGG - Intronic
1142708698 17:1711457-1711479 AGGTGGGGGTAGAAGAATGAAGG - Intergenic
1144156438 17:12508631-12508653 ATCTGGGGCTGGAAAGAAGAGGG - Intergenic
1144350278 17:14388595-14388617 AGGTGGGGATAGAAGGAAGAGGG + Intergenic
1145398884 17:22515553-22515575 AAGAGGAGAAAGAAGGAAGAAGG + Intergenic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1146637822 17:34519093-34519115 AATGGAGGCTAGAAGGAGGAGGG + Intergenic
1146722930 17:35136073-35136095 AGCTGGGTCTAGAAGGGAGAAGG + Intronic
1147629343 17:41919591-41919613 AAGTGGGGCTAGGAGGGTGCAGG + Intronic
1148642381 17:49197769-49197791 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1151000613 17:70370955-70370977 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1151193737 17:72416919-72416941 AAGTGGACCTAGAAGGAGAAAGG - Intergenic
1151210821 17:72542630-72542652 AAGTGGGGCTGGACGGTAGGAGG - Intergenic
1151354209 17:73548873-73548895 AACTGGGGCCAGAAGGAGGCTGG - Intronic
1151383932 17:73743824-73743846 AAGGGGGGAGGGAAGGAAGAGGG - Intergenic
1151944061 17:77309868-77309890 GAGTGGGGCTAGGATGGAGAAGG - Intronic
1153638048 18:7129904-7129926 ATGTGGAGCGAGAATGAAGAAGG + Intergenic
1153748236 18:8202347-8202369 AAGTGGTGCTAGAAAGAAGAGGG + Intronic
1153879550 18:9408473-9408495 AAGTAGGGAGAGAATGAAGAAGG + Intergenic
1153942266 18:9988609-9988631 AAGTGTTGATAGAAGGATGAAGG - Intergenic
1153993347 18:10419172-10419194 AAGTGAGGCAAGAAGGAAAAGGG - Intergenic
1154205841 18:12336016-12336038 GTGTGAGGCTAGAAGCAAGATGG - Intronic
1156205555 18:34882289-34882311 AAGGGAGGGTGGAAGGAAGAAGG - Intronic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1156808111 18:41211848-41211870 AAGTGTGGCTGGAAGGAAGAAGG + Intergenic
1157696228 18:49725957-49725979 AAATGGGGCCAGATGGTAGAGGG - Intergenic
1157722827 18:49938579-49938601 AAGTGGGGGTTAAAGGAAGAGGG - Intronic
1157956268 18:52100716-52100738 AAATTGGATTAGAAGGAAGAGGG - Intergenic
1158406354 18:57163216-57163238 AACTGGGGCTGGAATGAAGTGGG - Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158610499 18:58935467-58935489 AAGAGGGGGGAGAAGGGAGAAGG - Intronic
1159210825 18:65319020-65319042 AACTGTGGCTAGAAAGAAAAAGG + Intergenic
1161689807 19:5725088-5725110 AAGTGGGAATAGAACTAAGATGG + Intronic
1162543109 19:11310223-11310245 AAGTGCAGGAAGAAGGAAGAAGG + Intronic
1163044726 19:14631870-14631892 AAGTGGAAGTAGCAGGAAGAGGG + Intronic
1163172090 19:15538614-15538636 AAGTGGGGACATAAGGAATAAGG + Intronic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1163900010 19:20092865-20092887 AGGAGGGGCTACAAAGAAGAAGG + Intronic
1165679285 19:37760147-37760169 AAGAGGGCCTAGCACGAAGAGGG + Intronic
1165894957 19:39136066-39136088 AAGAGGGGTGACAAGGAAGAAGG - Intronic
1166913922 19:46181143-46181165 CAGTGAGGCTGGAAGCAAGATGG - Intergenic
1167627459 19:50601918-50601940 ACGCGGGGGTAGATGGAAGATGG - Intergenic
926144993 2:10391595-10391617 AAGAGGGGCTAGCAGGTAAAGGG - Intronic
926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG + Intergenic
926800755 2:16658376-16658398 AGGTCAGGCCAGAAGGAAGATGG + Intronic
927319733 2:21729215-21729237 AAGATGGACTAGAAGGAAGAAGG - Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
928013091 2:27629040-27629062 GGGTGGGGCCAGGAGGAAGATGG + Exonic
928061743 2:28120659-28120681 TACTGGGCCTAGTAGGAAGAAGG + Intronic
929052402 2:37849211-37849233 AAGTGGGGGAAGAAGGAGAAGGG - Intergenic
929370383 2:41216570-41216592 GAGTGGGGCAGGAATGAAGAGGG - Intergenic
929895957 2:45960996-45961018 CAGAGGGGCTGGAAGCAAGAGGG + Intronic
930506938 2:52294307-52294329 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931453027 2:62384478-62384500 TTGTGAGGCTAGAAGCAAGATGG + Intergenic
931455294 2:62405283-62405305 AAGTGGGGCTAGCACAAGGAGGG + Intergenic
931853787 2:66280601-66280623 AAGTGATGGTAAAAGGAAGATGG - Intergenic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932367044 2:71160183-71160205 AGGAGGGGCTACAAAGAAGAAGG + Intergenic
932368213 2:71166619-71166641 AACTGGGCCTAGAGGGAAGGGGG - Intergenic
932461109 2:71882631-71882653 ATGTGAGCCTAAAAGGAAGATGG + Intergenic
932595793 2:73092830-73092852 AGGTGGGGCTGGAAGGGAGGTGG - Intronic
932730668 2:74219830-74219852 AAGTGGGATGAGAAGGAAGGTGG + Intronic
933158017 2:78995191-78995213 AAGTGGGGAGAGAATGAAGATGG - Intergenic
933916289 2:86997222-86997244 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
934006704 2:87772683-87772705 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
934555923 2:95286963-95286985 AGGTGGGGTTGGGAGGAAGATGG + Intronic
934603352 2:95675804-95675826 AAGAAGGGCCGGAAGGAAGATGG - Intergenic
934603689 2:95678497-95678519 AAGAAAGGCTGGAAGGAAGATGG - Intergenic
934708266 2:96499671-96499693 AAGAGGGGCCTGAAGGAAGGTGG - Intronic
935156266 2:100486214-100486236 CTGTGGGGTTAGAAGCAAGATGG + Intergenic
935770351 2:106413604-106413626 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
935967860 2:108499212-108499234 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
936131519 2:109847469-109847491 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
936213178 2:110524016-110524038 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
936401521 2:112168210-112168232 AAGTCAGGGTAGAAGGAAAAAGG - Intronic
936422317 2:112378573-112378595 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
936475464 2:112835886-112835908 AAGTGTGGCTTGGAGGGAGAGGG - Intronic
936536734 2:113318030-113318052 AAGAAGGGCCGGAAGGAAGATGG - Intergenic
936537070 2:113320735-113320757 AAGAAGAGCTGGAAGGAAGATGG - Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937010578 2:118559383-118559405 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
937247502 2:120503124-120503146 ATGTGGGGCTAGATGGCACATGG - Intergenic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937630728 2:124098314-124098336 GAGTAGGCTTAGAAGGAAGAGGG + Intronic
938242938 2:129757166-129757188 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
938372476 2:130780484-130780506 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
939395901 2:141629247-141629269 AAGGAGGGGTACAAGGAAGATGG + Intronic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
940223753 2:151381131-151381153 ACTTGGGGCAAGAGGGAAGATGG - Intergenic
940894348 2:159065950-159065972 AAGGGAGGCAAGAAGGAAGCAGG + Exonic
941203625 2:162544846-162544868 AAGGGAGGGTAGAAGGAAAACGG - Intronic
942174355 2:173317357-173317379 AAGTGGGACTGCAAAGAAGAAGG - Intergenic
942588622 2:177515468-177515490 ACTTGGGGGCAGAAGGAAGAAGG - Intronic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
943340200 2:186671548-186671570 AAGTGGGGTTGGGAGGTAGAAGG - Intronic
943642719 2:190376574-190376596 AAGTGGGGACAGAAGGAATTAGG + Intergenic
945173652 2:207020712-207020734 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
945301291 2:208218481-208218503 AGGAGGGGCTACAAAGAAGAAGG + Intergenic
946033425 2:216723298-216723320 GAGTGGGGTTAGAGGGCAGAAGG - Intergenic
946179205 2:217939871-217939893 AGGTGGGGCAAGTAGGAAGATGG + Intronic
946411751 2:219518653-219518675 AACTGGGGCTTGGAGGAAGGGGG - Intronic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
947360823 2:229343634-229343656 GAGTGGGGCAAGAATGAAGGTGG + Intergenic
947590127 2:231380686-231380708 AGGTGGGTTTTGAAGGAAGATGG - Intergenic
948189607 2:236047431-236047453 AGGTGGCACGAGAAGGAAGAGGG - Intronic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
949061272 2:241959182-241959204 AAATAGGACCAGAAGGAAGATGG + Intergenic
1168954420 20:1824851-1824873 AAATGTTTCTAGAAGGAAGAAGG + Intergenic
1169311006 20:4539963-4539985 AAATGGGACTTGAAGGCAGATGG - Intergenic
1169513950 20:6296397-6296419 GAGTGAGGCTGGGAGGAAGACGG - Intergenic
1169601715 20:7268763-7268785 AAGTGGGGATTGAATAAAGATGG - Intergenic
1169772978 20:9221518-9221540 GAGTGAGGCAAGGAGGAAGATGG - Intronic
1170223418 20:13964952-13964974 ATAGGGGGTTAGAAGGAAGAAGG - Intronic
1171394357 20:24821966-24821988 GAGTGGGGATTGGAGGAAGATGG - Intergenic
1171398216 20:24854056-24854078 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1171496339 20:25558597-25558619 AAGTTGGTCAAGAAGGAAAAAGG - Intronic
1171500253 20:25587461-25587483 AAATGGGGTGAGAAGGAAGCAGG + Intergenic
1172905243 20:38364276-38364298 AAGTAGGGGAAGAAGGAGGAGGG - Intronic
1173584528 20:44172261-44172283 AATTGGGGTGAGAAGGAAAAAGG + Intronic
1174292930 20:49521766-49521788 AAGTGGGGCCAAGAGAAAGATGG + Intronic
1176697330 21:9995236-9995258 AAGGAGGGGGAGAAGGAAGAAGG + Intergenic
1176891411 21:14324167-14324189 AAGGAGGGCAGGAAGGAAGAGGG + Intergenic
1177100820 21:16895628-16895650 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
1177998865 21:28135403-28135425 CAGTGTGGCTAGAATGAAGCAGG + Intergenic
1178262361 21:31111648-31111670 AAATGGGGCTAAAAGAAAAAAGG - Intergenic
1178862320 21:36299695-36299717 AGGCGGTGCTAGAAGGAAGAGGG + Intergenic
1178896923 21:36566763-36566785 AAGTGGGGCTAGAAGTGAATGGG - Intronic
1179403908 21:41109875-41109897 AGGAGGAGCTAAAAGGAAGAAGG + Intergenic
1179573895 21:42294799-42294821 AGGTGGAACTAGCAGGAAGATGG - Intronic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1181810337 22:25400223-25400245 AGGTGGGGCAAGAAGGGATAGGG + Intronic
1181964662 22:26647975-26647997 AGATGGGGCTAGAAGGAATTGGG - Intergenic
1182433165 22:30312693-30312715 GAATGGGGGTTGAAGGAAGATGG - Intronic
1182926706 22:34131904-34131926 CAGTGGGGCTAGAATAAAGCAGG - Intergenic
1184059574 22:42073977-42073999 AAGTGGGCCGAGCAGGGAGAGGG + Intergenic
1184421449 22:44384901-44384923 GAGTGGGGGGAGATGGAAGAGGG + Intergenic
1184630966 22:45779421-45779443 AAGACGGACTGGAAGGAAGAGGG + Intronic
1184926083 22:47639135-47639157 AATTGGGGGTGAAAGGAAGAGGG + Intergenic
949606240 3:5657455-5657477 AAGTCAGGGAAGAAGGAAGAAGG - Intergenic
949660667 3:6275047-6275069 AAATGGGGAAAGAAGGAAGCTGG + Intergenic
950089489 3:10285416-10285438 AAGTGGGACTAAGAGAAAGAGGG - Intronic
950175659 3:10872390-10872412 AAATGGGGATGGAAGGAAGACGG - Intronic
950907553 3:16552956-16552978 AAGAAGGGAAAGAAGGAAGAAGG + Intergenic
951347507 3:21563763-21563785 ACGTTGGTCTAGAAGGAATAGGG - Intronic
952161979 3:30703105-30703127 ATGTGAGGCTAGAAGCAAGTTGG - Intergenic
952413706 3:33071824-33071846 ATGAGGGTCTAGAAGGGAGAAGG - Intronic
952895021 3:38072913-38072935 AGGAGGGGCTACAAAGAAGAAGG + Intronic
953073906 3:39550453-39550475 AAGTGAGTCTAGAAGGAATTGGG - Intergenic
953586761 3:44208029-44208051 CAGTGGGCCTAGAAGAAAGTGGG - Intergenic
953675700 3:45000273-45000295 AAGGGGTGCTATGAGGAAGAAGG - Intronic
953685415 3:45074417-45074439 AAGTGGTGGAAGTAGGAAGAAGG + Intergenic
953911228 3:46894008-46894030 AGGTGGGGGTCAAAGGAAGAGGG + Exonic
954413519 3:50381623-50381645 AACTGGGGCCAGAAGCAAGCAGG + Intronic
954466501 3:50658266-50658288 AGGTGGGTTTGGAAGGAAGATGG + Intergenic
954737747 3:52720590-52720612 AATGGAGGCTAGAAGGCAGAAGG + Intronic
956135739 3:66096760-66096782 CTGTGAGGCTAGAAGCAAGAAGG + Intergenic
958794840 3:98695813-98695835 AAGTGGGAGTAGAAGGGAGCTGG - Intergenic
958813760 3:98893072-98893094 AATTGGGGATAAAGGGAAGAGGG + Intronic
959021481 3:101192067-101192089 AAGTTAGGTTACAAGGAAGAAGG - Intergenic
959466877 3:106699214-106699236 AGGTGTGACTAGAAGGGAGATGG + Intergenic
959597881 3:108147443-108147465 AACTGGGGCTAGAGGAAGGATGG + Intergenic
960157069 3:114306953-114306975 GAGTTGGACTAGAAGTAAGAGGG + Intronic
960463541 3:117967178-117967200 CAGTGAGGCTAGAACGAAGCTGG + Intergenic
960585002 3:119312669-119312691 AAATGGGGCTACAAGGATGTGGG - Intronic
961263180 3:125618920-125618942 CAGTGTGGCTAGAATGAAGCAGG + Intergenic
961264742 3:125632798-125632820 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
961563224 3:127745856-127745878 AAGTGGGGACAGAAGGCACAGGG + Intronic
961578056 3:127854620-127854642 AGGTGGGACTAGAATGGAGACGG + Intergenic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
963693714 3:148537374-148537396 GTGTGAGGCTAGAAGCAAGATGG + Intergenic
964143874 3:153434872-153434894 TAGTGGGGCTAGAAGTTGGATGG + Intergenic
964984691 3:162724773-162724795 AGGAGGGGCTACAAAGAAGAAGG + Intergenic
965639837 3:170820208-170820230 AGGAGGGGCTACAAAGAAGAAGG + Intronic
965870723 3:173261238-173261260 CTGTGAGGCTAGAAGTAAGATGG + Intergenic
967309779 3:188095098-188095120 AAGACAGGCTAGAAGCAAGATGG - Intergenic
967391185 3:188956396-188956418 AAGTGGGGGATGAAGAAAGAGGG - Intronic
967543510 3:190696537-190696559 AAGTGAGGGTAGCAGAAAGAGGG - Intergenic
967824214 3:193865858-193865880 AGGAGGGGCTTGAGGGAAGAGGG - Intergenic
967894491 3:194385101-194385123 AAGGGGTGATACAAGGAAGAGGG - Intergenic
968126380 3:196163584-196163606 AAGGACGGGTAGAAGGAAGAGGG - Intergenic
968889605 4:3361493-3361515 AAGTGGGCCTGAAAGCAAGATGG + Intronic
968937213 4:3617538-3617560 GGGAGGGGCAAGAAGGAAGAAGG - Intergenic
969418042 4:7073909-7073931 AAGTGGGGGTAGAAGGGCCACGG - Intergenic
969643330 4:8412215-8412237 GAGTGGGGCTAGGAGAAAGTAGG - Intronic
969960841 4:10943547-10943569 CAGGAGGGGTAGAAGGAAGAGGG - Intergenic
970088486 4:12374901-12374923 CAGTGGGGCTAGAATAAAGGAGG - Intergenic
970196838 4:13559561-13559583 AAGTGTGGCTAGAAACAGGAAGG + Intergenic
970673603 4:18423012-18423034 AAGTGGGGGAAGATGGAAAATGG - Intergenic
970718529 4:18957782-18957804 TAGTGGGCCTGGAAGGAAAATGG - Intergenic
971110619 4:23581341-23581363 AAGTGGAGCTTTAAGGAAGCTGG - Intergenic
971664117 4:29459750-29459772 CAGTGTGGCTAGAAGAAAGCAGG + Intergenic
971975565 4:33681662-33681684 CTGTGAGGCTAGAAGAAAGATGG + Intergenic
972579682 4:40384240-40384262 TAATGGGGATAGAGGGAAGAGGG + Intergenic
972579839 4:40385486-40385508 AAGGAGGGAGAGAAGGAAGAAGG + Intergenic
974416078 4:61607940-61607962 CTGTGAGGCTAGAAGCAAGATGG + Intronic
974900133 4:67986687-67986709 AAGCAGCACTAGAAGGAAGAAGG + Intergenic
975099905 4:70501043-70501065 CAGTGGGGCTAGAATAAAGCAGG - Intergenic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
975851054 4:78572965-78572987 CTGTGAGGCTAGAAGCAAGATGG + Intronic
976188836 4:82469662-82469684 TTGTGAGGTTAGAAGGAAGATGG + Intergenic
976713169 4:88094921-88094943 AATTGGGGAGAGAAGGAGGAAGG - Intronic
977306295 4:95327773-95327795 AAGGGGAGCTGGAAGGAGGATGG - Intronic
978007403 4:103634069-103634091 AAATAGGACTAGAAGGCAGATGG + Intronic
978386506 4:108180785-108180807 AAGAGGGAAGAGAAGGAAGAAGG + Intergenic
978399127 4:108312406-108312428 AAGGGAGGGTAGAAGGAAGGAGG + Intergenic
978445696 4:108777960-108777982 TTGTGGGGCTAGAAGCAAGATGG + Intergenic
978608312 4:110507312-110507334 AAGTGGGGCTACAACCAAAATGG + Intronic
979350902 4:119643452-119643474 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
979889058 4:126066382-126066404 CAGTGGGGCTAGAACAAAGCCGG - Intergenic
980389956 4:132131688-132131710 CAGTGAGGATAGAAAGAAGATGG + Intergenic
981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG + Intronic
981134559 4:141195459-141195481 AGGTGGGGAAAGGAGGAAGAGGG - Intronic
981249539 4:142583337-142583359 AAGTGGGGCAGGAAAGAAAAGGG - Intronic
981705442 4:147654635-147654657 ATGGGGGGCTAGATGGAGGATGG - Intronic
982079561 4:151775573-151775595 AATTAGGGTAAGAAGGAAGATGG - Intergenic
982083781 4:151814858-151814880 AGGAGGGGCTACAAAGAAGAAGG + Intergenic
982106067 4:152013123-152013145 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
982869145 4:160553752-160553774 AAGGGGAGCTAGAAGGCAGATGG + Intergenic
983164903 4:164463350-164463372 AAATGGGGCTACAAAGAAAAAGG - Intergenic
983535843 4:168855995-168856017 AAGTGGGGAGAGAAGGAGGTGGG - Intronic
983626328 4:169805291-169805313 CTGTGAGGCTAGAAGCAAGAAGG - Intergenic
983887682 4:172998772-172998794 AAGTGTAGCTAGAAATAAGAAGG - Intronic
984812366 4:183806659-183806681 AAGTGGGGGTCGGGGGAAGAAGG - Intergenic
985091716 4:186369917-186369939 TAGTCAGGCTAGAAGGGAGAAGG + Intergenic
985100482 4:186453257-186453279 CTGTGGGGCTAGAAGCAAGATGG + Intronic
985216684 4:187660930-187660952 ATGTGAGGTTAGAAGCAAGATGG - Intergenic
986137231 5:4992095-4992117 ATGTGGGTCTTGAAAGAAGAGGG - Intergenic
986185236 5:5429509-5429531 ATCTTGGGCTAGAAGGAAGACGG - Intronic
986952959 5:13113381-13113403 AAGGGGGCCTGGAAGGAGGAAGG + Intergenic
987733411 5:21806776-21806798 CTGTGAGGCTAGAAGCAAGATGG - Intronic
988217954 5:28301390-28301412 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
988361048 5:30237029-30237051 CAGTGGGGCTAGAATGAAATAGG + Intergenic
988473533 5:31563355-31563377 CTGTGAGGCTAGAAGCAAGACGG - Intergenic
989261568 5:39424764-39424786 AAATGGAGCCAGAGGGAAGAAGG + Intronic
989378402 5:40789631-40789653 AAGTGGGGCTGGAGGGGAAAAGG + Intronic
989559177 5:42831486-42831508 TAGTGGAGCAAGAATGAAGAAGG - Intronic
991268911 5:64756320-64756342 ACTAGGGGCTAGAGGGAAGAGGG - Intronic
992583436 5:78206506-78206528 CAGTAGGGCAAGGAGGAAGAAGG + Intronic
992940155 5:81752361-81752383 AAATGGGGTTAGAAAGAAGATGG + Intergenic
992959025 5:81940269-81940291 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
994472739 5:100229597-100229619 AAATGTGGCAAGAAAGAAGAAGG - Intergenic
994884993 5:105549073-105549095 AGATGGGGCCAGAAGGGAGATGG + Intergenic
995075451 5:107978196-107978218 GTGTGTGGCTAGAAGCAAGATGG - Intronic
995320186 5:110825095-110825117 AAATGGGGGTAGCAGGAAGGTGG - Intergenic
995533644 5:113114787-113114809 AAGGGGAGCTAGAAGGGGGATGG - Intronic
996105778 5:119500811-119500833 AAGTGTGTCAAGAAGGAGGAGGG + Intronic
996909168 5:128635706-128635728 CAGTGCGGCTAGAAGAAAGCAGG - Intronic
997207272 5:132057158-132057180 AGGTGGGGCTAGAAGCAATAAGG - Intergenic
997532576 5:134591326-134591348 AGGTGGGGCTAGCTGGCAGATGG + Intergenic
997598099 5:135120633-135120655 AGGTGGGGCCAGGAGAAAGATGG + Intronic
998205062 5:140152174-140152196 AAGTGAGGCAAGAGGGATGACGG + Intergenic
998388604 5:141772745-141772767 AAAAGGGCCTAGAAGGGAGAAGG + Intergenic
998543778 5:143008052-143008074 AAGTGGGAAGAGAAGGAAGGAGG + Intronic
999869088 5:155730817-155730839 AATTGGGGCTGGAAGGATGCAGG - Intergenic
1000570846 5:162912177-162912199 GAGTGGGGCGAGAGGGAAGTGGG - Intergenic
1000694348 5:164361266-164361288 AAGTGGGGCTGGAAGAAAAGGGG + Intergenic
1001845602 5:174918171-174918193 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1003099938 6:3169328-3169350 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
1003148674 6:3530453-3530475 AGCTGTGGCTGGAAGGAAGAGGG + Intergenic
1003670866 6:8157869-8157891 AATGGGGGCTTGGAGGAAGATGG + Intergenic
1003987100 6:11447792-11447814 AAGTGGTGGTAGCAGCAAGAAGG - Intergenic
1004056644 6:12145670-12145692 AAGTGATGCTAGCAGTAAGAGGG - Intronic
1004279922 6:14271929-14271951 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1006480982 6:34293971-34293993 AAGTGGGGTTAGTGGGAAAAGGG - Intronic
1006519638 6:34563800-34563822 CAGTGGGGCCAGAATGAAGCAGG + Intergenic
1006670725 6:35728349-35728371 TAGAGGGGCGAGAAGGCAGAGGG - Intronic
1006714797 6:36110279-36110301 AACTGGAGCAAGAAGGAAGGAGG + Exonic
1007640276 6:43332916-43332938 AAGTCTGGCTGGAAGGAAAAAGG + Intronic
1008437226 6:51490528-51490550 AAGTGGGGCTTGGGGGAAGCTGG - Intergenic
1008832980 6:55791741-55791763 ACGTGGAGCAAGAGGGAAGATGG + Intronic
1009524104 6:64721284-64721306 AAGTGGGGCTAGGGGCAGGAAGG + Intronic
1010201241 6:73283993-73284015 GAGTGAGGCTAGAAGCAAGATGG - Intronic
1010925301 6:81737713-81737735 AAGGGAGGCTAGGAGGGAGATGG - Intronic
1010973354 6:82286621-82286643 AAGTGGGACAGGAAGGAAGTGGG + Intergenic
1012248336 6:96952452-96952474 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1012398456 6:98825313-98825335 AGGTGAGGCTAGGAGGAAGGGGG + Intergenic
1013272811 6:108559442-108559464 AAGTGGGGAGAGGAGGGAGAAGG - Intergenic
1013476109 6:110508791-110508813 ATGGGGAGCTAGAAGGGAGATGG - Intergenic
1013542916 6:111129251-111129273 AAGTGGGCAAAGAAGGAAGGGGG + Intronic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1014510982 6:122322006-122322028 AAGTAGGAGTAGGAGGAAGAAGG + Intergenic
1014697613 6:124643217-124643239 AACTGCGGCTAGATTGAAGAGGG - Intronic
1015711759 6:136149243-136149265 AAATGGGGAAAGAAGGAAAAAGG - Intronic
1017039610 6:150297077-150297099 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1017136815 6:151154329-151154351 AAATGGGGCAAGAGGGATGAGGG + Intergenic
1019409199 7:899292-899314 AAGCGGGGCTGGAAGGGACATGG - Intronic
1019730592 7:2627430-2627452 AAGAGGGGAAAGAAGGAAGGAGG + Intergenic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1020431247 7:8118589-8118611 ATTTGGGTCTAGAAGGAAAATGG - Intronic
1020450980 7:8320154-8320176 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1021006247 7:15397599-15397621 AGGTGGGGAGAAAAGGAAGAAGG - Intronic
1021623640 7:22571992-22572014 ATGTGGGCCCAGGAGGAAGAAGG + Intronic
1021822982 7:24516457-24516479 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1022518531 7:30990534-30990556 AATTGGGGCTATATGGAAGAAGG - Intronic
1022818663 7:33937564-33937586 ATCTGGGGCTGGAAGGAAGGGGG + Intronic
1023001084 7:35808207-35808229 ACTTGGGGGTAGAAGTAAGAAGG - Intronic
1023066232 7:36380580-36380602 AAGTGAGGCTTAAAGGAGGATGG + Intronic
1023765566 7:43507380-43507402 AAGCGGGGGAAGAAGGAAGTTGG + Intronic
1025229020 7:57187372-57187394 AAGTGGGGGGAGAAGTAATATGG - Intergenic
1026536484 7:71242667-71242689 AACTTGGACTACAAGGAAGAGGG + Intronic
1026602468 7:71787920-71787942 AGGTGTGGGAAGAAGGAAGAGGG + Intronic
1026769707 7:73187882-73187904 GAGTGGGGACAGAAGGAAGGCGG + Intergenic
1027010575 7:74741264-74741286 GAGTGGGGACAGAAGGAAGGCGG + Intronic
1027077467 7:75204776-75204798 GAGTGGGGACAGAAGGAAGGCGG - Intergenic
1027161360 7:75804843-75804865 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1027744749 7:82059052-82059074 AAGGGAGACTAGAAAGAAGAAGG - Intronic
1029049630 7:97671001-97671023 AAATGAGGCTAGAAAGATGAAGG + Intergenic
1029702636 7:102257506-102257528 AAGTGGGGGTAAAAAGAAGGTGG + Exonic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1031422273 7:121566236-121566258 AGGTGGGGCTACAAAGAAGAAGG + Intergenic
1032378428 7:131448873-131448895 AAGTGGGGAGGGAAGGAGGAAGG - Intronic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033077101 7:138259851-138259873 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1033440192 7:141371553-141371575 AAGTGGGGCTAGAAGGAAGAAGG + Intronic
1033448415 7:141441544-141441566 AAATGGGGCTACAAGTGAGAAGG + Intronic
1033668085 7:143462523-143462545 TTGTGAGGCTAGAAGCAAGATGG + Intergenic
1034605331 7:152307390-152307412 AAGGGAGGGGAGAAGGAAGAAGG + Intronic
1034907756 7:154965563-154965585 GAGTGGGCCTAGGAGGAGGAGGG - Intronic
1036155863 8:6341341-6341363 AAGAGGTGGTAGAAGGGAGAAGG - Intergenic
1036546189 8:9771798-9771820 AAGTGGGGGAGGAAGGGAGAAGG + Intronic
1037323610 8:17666830-17666852 AAGAGGGGTTAGTAGGATGATGG + Intronic
1037332368 8:17756161-17756183 AAATGGGGCAAAATGGAAGATGG + Intronic
1037528889 8:19755366-19755388 AAGTAGGGTTACAAAGAAGAAGG + Intronic
1038531509 8:28321548-28321570 AAGTAAGGATGGAAGGAAGAAGG - Intronic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1039088763 8:33806028-33806050 GAGTGGGACAAGGAGGAAGAGGG - Intergenic
1039303153 8:36231879-36231901 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1039727306 8:40232736-40232758 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1039890934 8:41684756-41684778 AAATGGGGCCAGGATGAAGATGG + Intronic
1041057176 8:53998445-53998467 AAGTAGGGCTAAAAGAAACAAGG - Intronic
1042692815 8:71522221-71522243 AAGTGGGGCTATAAGGATCAAGG - Intronic
1042889353 8:73590085-73590107 AAGTAGGGGGAGAAGGAAGTAGG + Intronic
1042932172 8:74024435-74024457 AGGAGGGTCTAGAAGGGAGAAGG + Intronic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1043284181 8:78509183-78509205 AAAAGGGGTTAGAAGGAGGAGGG - Intergenic
1043379969 8:79691997-79692019 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1044573812 8:93747482-93747504 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1045734196 8:105276142-105276164 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1046649299 8:116819151-116819173 ATGTGGGGCTAAAAGGGAAAGGG + Intronic
1047307581 8:123665425-123665447 AAGTGGGGCTACAAGGAGACTGG + Intergenic
1047775515 8:128067309-128067331 ATGTGGGGCTAGAGAGTAGAAGG + Intergenic
1049702858 8:144022998-144023020 AAGAGGGTCTTGAGGGAAGAGGG - Intronic
1049703397 8:144024927-144024949 AAGAGGATCTTGAAGGAAGAGGG - Intronic
1049868629 8:144956510-144956532 AGGAGGGGCTACAAAGAAGAAGG + Intergenic
1050206723 9:3204353-3204375 AAGTGGGGAAAGGAGAAAGAAGG - Intergenic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1050712601 9:8482746-8482768 AAGTGGCAAGAGAAGGAAGAAGG - Intronic
1050829109 9:9989531-9989553 AAGGGGAGCTAGAAGGGGGATGG - Intronic
1050983078 9:12045873-12045895 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1051693354 9:19741285-19741307 AAGGGGAGCTAGAGGGAAGTGGG + Intronic
1053771430 9:41482418-41482440 AAGGAGGGGGAGAAGGAAGAAGG - Intergenic
1054453933 9:65420138-65420160 GGGAGGGGCAAGAAGGAAGAAGG + Intergenic
1054454022 9:65420404-65420426 AAATGGGATGAGAAGGAAGAAGG + Intergenic
1055189658 9:73502348-73502370 AAGTGGGGAGAGAAAGAGGAAGG - Intergenic
1055520899 9:77080161-77080183 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1055907841 9:81314567-81314589 CAGCGTGGCTAGAAGGAAGCAGG + Intergenic
1056340798 9:85629952-85629974 AGGTAAGGTTAGAAGGAAGAAGG - Intronic
1056665126 9:88575612-88575634 AAGTGGGGTTGGGAGGAAGGTGG + Intronic
1056779089 9:89535914-89535936 AAGTGGGGCCAAGAGGAAGGGGG + Intergenic
1057068339 9:92075079-92075101 AAGAGGGGCTGCAAAGAAGAAGG - Intronic
1057920087 9:99090155-99090177 TTGTGAGGCTAGAAGCAAGATGG + Intergenic
1058345008 9:103950821-103950843 AAGGAGGGAAAGAAGGAAGAAGG + Intergenic
1058907753 9:109495510-109495532 GAGTGGGGCCAGGAGCAAGAGGG - Intronic
1059205213 9:112458081-112458103 CAGTGGCACTAGAAGGTAGATGG - Intronic
1059509164 9:114827970-114827992 AAGTGGGGAAGGAAGGAGGAAGG - Intergenic
1059522940 9:114961002-114961024 AAGTGGGGTTGGAATGAGGATGG - Intergenic
1060399648 9:123340740-123340762 AGGTGGGGATGGAAAGAAGAAGG + Intergenic
1060831770 9:126722136-126722158 AAGAGGGGCCTGAGGGAAGAGGG - Intergenic
1061853816 9:133430481-133430503 AAGTGGGGCTGGTAGGGGGAGGG + Intronic
1062692147 9:137847579-137847601 AGGAGGGGCTACAAAGAAGAAGG - Intronic
1186807336 X:13153382-13153404 TTGTGAGGCTAGAAGCAAGATGG - Intergenic
1187055366 X:15737684-15737706 AAATTGGGCTGGAAGGAACACGG + Intronic
1187112715 X:16318061-16318083 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1187192008 X:17044180-17044202 AAGAGGAGCTAGAAAGCAGATGG + Intronic
1187441856 X:19327966-19327988 AAAGGGGGCTAGAAGGGAGCCGG - Intergenic
1187641590 X:21297075-21297097 AAAAGGGGCAAGAATGAAGAAGG - Intergenic
1189423163 X:40874721-40874743 AAGAGAGGGTAGAAGTAAGAAGG - Intergenic
1189752335 X:44235042-44235064 AAGTGGGGATAGTGGCAAGAAGG + Intronic
1189962842 X:46340812-46340834 TTGTGAGGCTAGAAGCAAGATGG + Intergenic
1190219226 X:48500302-48500324 AGCTGGCTCTAGAAGGAAGAAGG + Intergenic
1190727458 X:53198931-53198953 AAGTGGGGCAAGAAGGAGGATGG - Intronic
1191044244 X:56119241-56119263 AAGTGGGAAAAGGAGGAAGAGGG + Intergenic
1192623765 X:72706781-72706803 TAGTGGGGCTAGAGGGTAAAGGG - Intronic
1192733792 X:73828944-73828966 AAGTGGGGCTAAATGTGAGATGG - Intergenic
1193910541 X:87300935-87300957 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1194490440 X:94539787-94539809 AAGTGGAGGAAGAAGGAAGTTGG + Intergenic
1195615853 X:106911387-106911409 AGGTGAGGCTTGAAGGAACAGGG - Intronic
1195836491 X:109120532-109120554 AAGTGGGGCAAGTTTGAAGAGGG - Intergenic
1196348408 X:114696325-114696347 AAGTAGAGGTGGAAGGAAGAAGG - Intronic
1196375924 X:115032383-115032405 AAGTGGGGCTAGAGGGTAAGAGG - Intergenic
1196414134 X:115453318-115453340 ACGTGGAGCAAGAAGGAAAATGG + Intergenic
1196885157 X:120237371-120237393 TAGTGCTGCTAGAAGCAAGAGGG + Intergenic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197347750 X:125345272-125345294 CTGTGAGGCTAGAAGCAAGAAGG + Intergenic
1197652627 X:129082368-129082390 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1197733677 X:129833834-129833856 AAGTATGGCTTTAAGGAAGAAGG + Intronic
1197916968 X:131546186-131546208 AATTGGGGGTAGAGGGAGGAAGG - Intergenic
1197976847 X:132174865-132174887 GAGTGGGCATAGAAGGGAGATGG + Intergenic
1198629435 X:138618380-138618402 GAGTGGGGATAGAAAGAAGTAGG - Intergenic
1199239113 X:145526142-145526164 AAGCTGGGCTAGAAGGAAACTGG + Intergenic
1199709545 X:150459466-150459488 AAGTGGGGCTTGGAGGAAATGGG - Intronic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1201642031 Y:16190397-16190419 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1201660784 Y:16394924-16394946 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1201937318 Y:19422433-19422455 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
1202076344 Y:21041333-21041355 AGGAGGGGCTACAAAGAAGAAGG + Intergenic
1202367919 Y:24179524-24179546 AAGAGGGGCTAGAAAGGAAAGGG + Intergenic
1202376922 Y:24246384-24246406 AAGAGGGGCTGGAAGGGAAAGGG - Intergenic
1202493858 Y:25423737-25423759 AAGAGGGGCTGGAAGGGAAAGGG + Intergenic
1202502864 Y:25490593-25490615 AAGAGGGGCTAGAAAGGAAAGGG - Intergenic