ID: 1033440524

View in Genome Browser
Species Human (GRCh38)
Location 7:141374017-141374039
Sequence CTCTTTAAGGAATAAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 368}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033440524_1033440529 24 Left 1033440524 7:141374017-141374039 CCTTCCATTTATTCCTTAAAGAG 0: 1
1: 0
2: 1
3: 34
4: 368
Right 1033440529 7:141374064-141374086 CCACCCTGTAGCTGATGACATGG No data
1033440524_1033440530 25 Left 1033440524 7:141374017-141374039 CCTTCCATTTATTCCTTAAAGAG 0: 1
1: 0
2: 1
3: 34
4: 368
Right 1033440530 7:141374065-141374087 CACCCTGTAGCTGATGACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033440524 Original CRISPR CTCTTTAAGGAATAAATGGA AGG (reversed) Intronic
900657548 1:3767146-3767168 ATCTTTTAGGAAAAAGTGGATGG + Intronic
900896028 1:5483557-5483579 CTCTGTGATGAATAAATGGCAGG - Intergenic
901084303 1:6601443-6601465 CTCCTTAAGGAATCCAGGGACGG - Intronic
901342120 1:8504483-8504505 TTGTACAAGGAATAAATGGATGG + Intronic
901884035 1:12210231-12210253 CTCTTTATGGAATAAGTGTGGGG - Intergenic
902637006 1:17741207-17741229 CTATTTACCGAATAAATGAATGG - Intergenic
902757576 1:18559095-18559117 CTCTTCAATGAATAAATGAAAGG - Intergenic
904563869 1:31415570-31415592 CTTTGTGAGGATTAAATGGAAGG - Intronic
905718205 1:40172057-40172079 GTATTTAAGAAATAAATGCATGG + Intronic
905837944 1:41145169-41145191 CTCTTTAAAGAAAACATAGAAGG - Intronic
905959229 1:42029587-42029609 CTCTTTGTGGAATAAGTAGAGGG + Intronic
906591400 1:47027769-47027791 CTCTTTTAGGAATAATTTGCAGG - Intronic
906985011 1:50673869-50673891 CTCTTTAAAAAATAAACTGAGGG + Intronic
906998901 1:50829365-50829387 CTCATTAAAAAAGAAATGGAAGG - Intronic
907422519 1:54356870-54356892 ATCTTCAAAGAATAAATGTAGGG + Intronic
907762259 1:57372863-57372885 TTCTTTAAGGTAGACATGGAAGG - Intronic
907975189 1:59424754-59424776 TTGTTCAATGAATAAATGGATGG + Intronic
909571298 1:77114659-77114681 CTTATCAAGGAATAAATGCAAGG - Intronic
912141943 1:106740757-106740779 CTATCTAGGGAATAAATGGAGGG + Intergenic
912152564 1:106878360-106878382 CACTGTAAGGGATAATTGGAAGG - Intergenic
912588714 1:110791752-110791774 TTGTTCAACGAATAAATGGATGG + Intergenic
913014166 1:114716272-114716294 CACTTTAAGAACCAAATGGAAGG - Intronic
913275649 1:117135523-117135545 CTTTTTGAGGAATAAATGATGGG - Intergenic
913378889 1:118186423-118186445 TTCTTTGAGGAATAAATTGAGGG + Intergenic
913522267 1:119656075-119656097 CTATTGAATGAATAAATGGATGG - Intergenic
914859834 1:151376731-151376753 CTCTTTAAGCAATAGAGGTAAGG - Intergenic
915306227 1:154980873-154980895 CTATTTTAGGAATAAGTGGATGG - Intergenic
915520874 1:156442701-156442723 TTGTTTAATGAATAAATGAATGG + Intergenic
915611787 1:156999525-156999547 CTCTCTAAAGAATAAAGGGAGGG + Intronic
916633973 1:166648299-166648321 ATCTTTAAGGAATAGGTTGAGGG - Intergenic
917277233 1:173343752-173343774 TTGTTGAAGGAATAAAAGGATGG + Intergenic
918028106 1:180773736-180773758 CTCTTAAAGCAAAACATGGAGGG - Intronic
918510722 1:185310871-185310893 CTCTTTAAGGAAAAAAAAAAAGG + Intronic
919183126 1:194111294-194111316 GTCTCTAAGGAATTACTGGATGG + Intergenic
919602596 1:199640980-199641002 ATATTAAAGGAATAAATGGAAGG + Intergenic
919659840 1:200233725-200233747 ATTTTTAAGGAAGAAATGGCAGG + Intergenic
921847302 1:219897753-219897775 TTTTTTAATAAATAAATGGAAGG - Intronic
923636081 1:235698144-235698166 CTCTTAAATGTATAAAAGGAGGG - Intronic
923895338 1:238263432-238263454 TTCTTTAATAAATAAATGTAAGG + Intergenic
924122863 1:240820354-240820376 TTATTTAATGAATAAATAGATGG - Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924838466 1:247680045-247680067 AGATTTAAAGAATAAATGGATGG + Intergenic
1065834890 10:29647900-29647922 CTTTTTAAGTAAAAAATGTAGGG - Intronic
1065989796 10:30997333-30997355 GAATTTAAGGAATAAATGGGAGG + Intronic
1066258189 10:33702590-33702612 CTCTATAAGGAATATGAGGAAGG - Intergenic
1069416778 10:68207583-68207605 TTGTTAAAGGAATAAATGAAAGG - Intronic
1069429822 10:68324469-68324491 CTCTTTAAGAAATATTTGGCTGG - Intronic
1069716519 10:70524467-70524489 CTATTTAAAGAATAAAGGAATGG - Intronic
1072004256 10:91227927-91227949 ATCTTAAATGAATAAATGCATGG + Intronic
1072105537 10:92270071-92270093 CTGTTTGAGGAATTAATGCAAGG - Intronic
1072982936 10:100114962-100114984 CTCTTTAAGGAGGAGTTGGACGG - Intergenic
1073602181 10:104857462-104857484 TTAATTAAGGAATAAATGAATGG - Intronic
1074209507 10:111316926-111316948 TTTTTTAAAGAATACATGGAAGG - Intergenic
1074210625 10:111330753-111330775 ATTTTAAAAGAATAAATGGATGG - Intergenic
1074296628 10:112195260-112195282 ATCTGTAAGGAATATATGGAAGG - Intronic
1074460872 10:113635848-113635870 TTGTTCAAGAAATAAATGGATGG - Intronic
1074609629 10:115009051-115009073 CGGTTTGAGGAATAAAAGGATGG - Intergenic
1075549397 10:123381038-123381060 CACTTTTAGGAATTAATTGATGG - Intergenic
1075961417 10:126570472-126570494 ATTTTTAAGCAATAAAAGGAGGG + Intronic
1076174261 10:128354967-128354989 CACCTTATGGAATAAATGAAGGG + Intergenic
1076363239 10:129904813-129904835 TTCTTGAATGAATAAATGAATGG + Intronic
1077836835 11:5933560-5933582 TTCAGTAAGGAATAAAGGGAAGG - Intronic
1078381844 11:10849534-10849556 CTCTTAGAGGAAGAAATGAATGG - Intronic
1078480842 11:11673873-11673895 CTGTTTAAAGAATCAATAGAAGG - Intergenic
1078696678 11:13640247-13640269 CTCTTTGAAAAATAAAAGGAGGG - Intergenic
1079673166 11:23193252-23193274 CTCATTAATGCATAAATGGTTGG + Intergenic
1080087839 11:28307385-28307407 TTCTTTAATGAATAAATGAATGG + Intronic
1080328357 11:31106388-31106410 CTTTTTAAAGGAGAAATGGATGG - Intronic
1080955492 11:37089662-37089684 ATCTGTAAGTAATAAGTGGATGG - Intergenic
1081097679 11:38959245-38959267 CTTTTTGAAGAATAAATGTATGG + Intergenic
1081481445 11:43493387-43493409 TTCTGTGAGGATTAAATGGAAGG + Intronic
1081782969 11:45726297-45726319 CTACTTATGGAATAAATGAAAGG - Intergenic
1082742212 11:56923669-56923691 CTTTTGGAGGAATAAAAGGAGGG - Intergenic
1082742361 11:56925079-56925101 GTTTTTAAGGAATAACTTGAAGG - Intergenic
1083007202 11:59357840-59357862 TACTTAAAGGAAGAAATGGATGG - Intergenic
1083574202 11:63777645-63777667 CTCTATAAAGAAAAACTGGATGG + Intergenic
1084565232 11:69924807-69924829 ATCTTTAATGAATTGATGGATGG + Intergenic
1086094460 11:83036518-83036540 CTATCTGAGGAATAAATGAATGG - Intronic
1087219212 11:95527688-95527710 CTCTTTGGGGAATAAATACATGG + Intergenic
1087265050 11:96051395-96051417 CTTATTAAGGATTAAATGAAAGG - Intronic
1087676727 11:101171471-101171493 TAGTTTAAGGAAGAAATGGAAGG - Intergenic
1088601101 11:111476752-111476774 CTGTTAATGGAATAAATGGGAGG - Intronic
1088844159 11:113650928-113650950 TTAATTAATGAATAAATGGATGG + Intergenic
1089249387 11:117146583-117146605 CTCTGGAAGGAAGAAATGGGAGG + Intronic
1090489013 11:127141322-127141344 CTCTTTAAGGATATAATGGTTGG - Intergenic
1091117532 11:133028031-133028053 CTCTTTCAGGTATAAAAGTAAGG + Intronic
1092659004 12:10718847-10718869 GTCATTAAGGAAGAAAAGGAGGG - Intronic
1094416498 12:30221933-30221955 CTCTTTCAGGAAGAAAGGAAGGG + Intergenic
1094754858 12:33456265-33456287 CTCTTTATTGAATAACTGAATGG - Intergenic
1095043423 12:37470549-37470571 TGTTTTAAGAAATAAATGGAGGG - Intergenic
1095412385 12:41938092-41938114 TTTTTTAATGAATAAATGAATGG + Intergenic
1095725742 12:45450697-45450719 CTCATTAAGGCATAAATTTAGGG - Intergenic
1096102126 12:48976191-48976213 CACTCTAAGGAATAAATGCCAGG - Intergenic
1097216784 12:57420321-57420343 CATTTTGAGGAATAAATGGGAGG - Intronic
1097335156 12:58374295-58374317 CTATTAAATGAATGAATGGATGG - Intergenic
1097626590 12:62009673-62009695 TTCTGTGAGTAATAAATGGATGG - Intronic
1098027117 12:66215356-66215378 TTCTTTAAGAAAGAAAGGGAAGG - Intronic
1099693378 12:85990579-85990601 CTCTTCAATGAATTAATGCAAGG + Intronic
1099949462 12:89284860-89284882 CTGTCTGAGGAATAAATGGAAGG - Intergenic
1100094895 12:91021928-91021950 TTCTTAAAGGAATAAAGGAAAGG - Intergenic
1101250718 12:102931980-102932002 CTGTTGAAAGAATAAATGAATGG + Intronic
1101312576 12:103596582-103596604 GTGTTTAATGAATAAATGAATGG + Intronic
1102882399 12:116495661-116495683 CTATTTATGGAATGAATGAATGG - Intergenic
1103284834 12:119792167-119792189 TTCCTAAGGGAATAAATGGATGG - Intronic
1104664321 12:130636611-130636633 CTATTGAAGAAATGAATGGATGG + Intronic
1106275401 13:28200872-28200894 ACATTTAAGGAGTAAATGGATGG - Intronic
1107122721 13:36812845-36812867 GTCTTTAAAGAGTAAACGGATGG + Intergenic
1107820284 13:44279782-44279804 CTCTGTAAGTCATAGATGGAGGG + Intergenic
1108024238 13:46162212-46162234 TTGTTTAGTGAATAAATGGATGG - Intronic
1108439195 13:50432209-50432231 CTCTTTCAGGAATAATCGGTTGG - Intronic
1109279041 13:60334761-60334783 TTGTTGAAGGAATAAATGAATGG + Intergenic
1109653882 13:65365208-65365230 CTTTTTAAGAACTAAATGAAAGG + Intergenic
1109986530 13:69993554-69993576 CTCTTGGAGGAATATATGAAGGG - Intronic
1110129710 13:71992187-71992209 CTGTTGAATGAATAAATGGTGGG - Intergenic
1110331636 13:74279545-74279567 CTCTTTGAGGAATATATTAAGGG + Intergenic
1110858133 13:80319414-80319436 CTATTTGATGAATAAATGAATGG - Intergenic
1112062523 13:95755455-95755477 CTCTTTAAAGAATAAAAAAATGG + Intronic
1112321302 13:98410164-98410186 CTCTTTAAACAATAAGTGCAAGG - Intronic
1112953353 13:105030023-105030045 CTCTCTAAGCCGTAAATGGAGGG - Intergenic
1113086978 13:106578749-106578771 TTCTTTGAGGAACAAATAGAAGG - Intergenic
1114221304 14:20699850-20699872 CTATTTAAGGAGTAAGTGTAAGG - Exonic
1116088084 14:40267149-40267171 CTCTTAAATAAATAAATGGAGGG + Intergenic
1116161439 14:41270924-41270946 TTATTCAAAGAATAAATGGACGG + Intergenic
1116247737 14:42437865-42437887 CTCCTGAAGGAATAAATTGTGGG + Intergenic
1117177264 14:53157508-53157530 TTGTTGAATGAATAAATGGAAGG - Intergenic
1117525201 14:56594750-56594772 TTCTTTTAAAAATAAATGGAAGG - Intronic
1117917741 14:60695900-60695922 CTCTCCCAGGAATATATGGATGG - Intergenic
1120054990 14:79913666-79913688 CTGTTTGTGGAATAAATGGAAGG - Intergenic
1120816020 14:88859137-88859159 TTCTTTAATGTATGAATGGATGG + Intronic
1120884158 14:89439056-89439078 CTCTTTAAGAAAAGAATGTAAGG - Intronic
1121688770 14:95859383-95859405 CTGTTAATGGAATAAATGGATGG + Intergenic
1122030865 14:98910747-98910769 GTGTTGAATGAATAAATGGATGG + Intergenic
1202941969 14_KI270725v1_random:158161-158183 TGTTTTAAGAAATAAATGGAGGG - Intergenic
1127284275 15:57518848-57518870 CTCTTTAACGTCTAAACGGAGGG - Intronic
1127529915 15:59833749-59833771 CTCTATGAGGACCAAATGGAGGG - Intergenic
1127780405 15:62308339-62308361 ATCTTTATTGAATGAATGGAAGG - Intergenic
1128374274 15:67064833-67064855 TTCTTGAAGGAATGAATGGAGGG - Intronic
1128821925 15:70664375-70664397 TTCCTTAAGAATTAAATGGAGGG + Intronic
1130041820 15:80411360-80411382 TTTGTTAATGAATAAATGGAGGG + Intronic
1131585517 15:93688919-93688941 CTCCTTAGGGAAGAATTGGATGG + Intergenic
1132332053 15:101019193-101019215 CTCTTTAAGTAAGAGATGGCTGG - Intronic
1136361256 16:29781153-29781175 CTCATTAAGGAATGAATGGGAGG + Exonic
1137507363 16:49065720-49065742 CTCATTAAGGAGGAAATGGGGGG + Intergenic
1137571790 16:49571156-49571178 TTATTGAATGAATAAATGGACGG - Intronic
1137996357 16:53218736-53218758 CTTTTTAAGCAATATATGAAGGG + Intronic
1139377960 16:66512435-66512457 CTCATTATGGAAAAAAAGGAGGG - Intronic
1139643007 16:68306511-68306533 CTCTTTAAGCAATAATAGGCCGG - Intronic
1139843150 16:69898322-69898344 ATCTTTAAGAAATAACTGGCTGG - Intronic
1140641018 16:76973055-76973077 CTCTCTCAGCAATAAAAGGAGGG - Intergenic
1140923617 16:79562375-79562397 CCCGTGAATGAATAAATGGATGG + Intergenic
1140960887 16:79911502-79911524 CTCTTCAAGATATAAATCGATGG - Intergenic
1141230522 16:82162896-82162918 CTCTTTAATAAACAACTGGAAGG + Intronic
1141364036 16:83425827-83425849 TTGTTGAATGAATAAATGGAAGG - Intronic
1146002338 17:29138986-29139008 CTCTCTAAGGAATGAACTGAAGG + Intronic
1146303893 17:31714953-31714975 TTATTTCAGGAATAAAAGGATGG + Intergenic
1146434679 17:32833475-32833497 CTGTTTTAAGAATAAATTGAAGG - Intronic
1146716788 17:35092840-35092862 CTCCCTAAGAAATCAATGGAAGG + Intronic
1146722832 17:35135203-35135225 CTCTGTAAGGAGTGAATGGTGGG - Intronic
1148352588 17:46951368-46951390 ATCTTTAAGGATGAAATTGATGG - Intronic
1148996424 17:51714208-51714230 CTCTTTAAGAAAGAGATGGATGG - Intronic
1149109218 17:53006962-53006984 CTCATGAAGGAATAAAAAGAAGG - Intergenic
1149615164 17:57991134-57991156 CTCTTTGAAGGAGAAATGGATGG - Intronic
1150099829 17:62412999-62413021 ATGTAAAAGGAATAAATGGAGGG + Intronic
1150732173 17:67705177-67705199 CTCTGGAAGGAAGTAATGGAAGG + Intergenic
1155940901 18:31801059-31801081 TGCTTTATGTAATAAATGGATGG - Intergenic
1156039840 18:32808402-32808424 TTCTTAAAGGAATAAATCCATGG + Intergenic
1156515984 18:37680915-37680937 ATCTGTAAGGAAAAAAGGGAGGG + Intergenic
1157370847 18:47109944-47109966 CTTTTTAAAGAATGAATGGAGGG + Intronic
1157585690 18:48799758-48799780 CTGTTAACTGAATAAATGGATGG - Intronic
1158962751 18:62600293-62600315 TTCTTTCAGGAAGAAATGGAGGG + Intergenic
1160072454 18:75640542-75640564 CTCTGTAAGGTTTAAGTGGAAGG - Intergenic
1161851284 19:6739358-6739380 CCCTTTAAGGAATAATTGCGGGG + Intronic
1162107253 19:8377511-8377533 ATCTATAAGGAATATTTGGAGGG - Intronic
1162273945 19:9638447-9638469 GTCTTTAAGGAATGAAAAGAAGG + Intronic
1164409229 19:27984736-27984758 CTCTTGAAGGAAGAAATGAGGGG + Intergenic
1168092097 19:54092631-54092653 CTGGTTAATGAAGAAATGGATGG + Intergenic
1168237036 19:55070033-55070055 CTGGTTAAGGGATAAATGGATGG - Intronic
1168646340 19:58061345-58061367 CTCTTGAAATAAGAAATGGAGGG - Intronic
925028633 2:630207-630229 TTTTTTAAAGCATAAATGGAAGG - Intergenic
925078016 2:1035466-1035488 CTCTTGATAGAACAAATGGAGGG - Intronic
925852415 2:8095435-8095457 CTCTTTAATGAAAATATTGACGG - Intergenic
925990570 2:9251100-9251122 TTCTTCAGGGAATAAGTGGACGG + Intronic
926383350 2:12313119-12313141 ATCTTTAAGGAATTAACTGAAGG - Intergenic
926776320 2:16426878-16426900 CTCTCTAAGGAAGGAATGTAAGG + Intergenic
926900450 2:17746054-17746076 ATTTTTAAGGTAAAAATGGATGG - Intronic
926971500 2:18471773-18471795 CTCTTTAAAAAAAAAAAGGAGGG - Intergenic
927748890 2:25648703-25648725 CTCTTTAAGAAAAAGATGGCTGG + Intronic
928683451 2:33726289-33726311 ATCTTAAAGGAAGCAATGGATGG - Intergenic
929456592 2:42070601-42070623 GTCTTTAAGGAAAAGAGGGAGGG - Intergenic
930003435 2:46877454-46877476 CTATTTAATAAACAAATGGAGGG + Intergenic
930173801 2:48280434-48280456 ATATTTACTGAATAAATGGATGG - Intergenic
930675649 2:54197711-54197733 TTCTTTGAGGAATAAGTAGAAGG + Intronic
931295568 2:60921362-60921384 CACTTTTAGGAGAAAATGGAAGG - Intronic
931550103 2:63434617-63434639 CTGCTTAAGGAATTAATGGAAGG + Intronic
935818963 2:106874664-106874686 CTCTTTAAGAAAAAAATTGAGGG - Intronic
936977732 2:118236295-118236317 GTCTTTAAGGAATTGATGGCAGG - Intergenic
937693534 2:124782230-124782252 GGCCTTCAGGAATAAATGGAAGG - Intronic
939110979 2:138007172-138007194 TTCTTTTAGGAAGAAATAGATGG - Intronic
939284581 2:140112321-140112343 TTCATGAAGGAATAAATGCAAGG + Intergenic
939296657 2:140274673-140274695 ATTTTTAAGTAATAAATGAAAGG - Intronic
939327186 2:140708162-140708184 CTCTTTAAGTCATAAATGTAGGG + Intronic
939922220 2:148130141-148130163 CTCTTTTAGGACAAAATGCATGG - Intronic
940342760 2:152598713-152598735 TTCTTTATTGAAGAAATGGAAGG + Intronic
942135929 2:172925408-172925430 CCTTTGTAGGAATAAATGGATGG + Intronic
942925767 2:181430329-181430351 CAAGTTAAGGAATAAAAGGATGG + Intergenic
945176712 2:207050888-207050910 CTCTTTGTAGAATAAATGGCAGG - Intergenic
945554236 2:211259486-211259508 TTATGTAAGGAAAAAATGGAGGG + Intergenic
945621306 2:212142337-212142359 ATATTTAATGAATGAATGGATGG + Intronic
945896156 2:215484025-215484047 CACTTTCAGGAAGAAATAGATGG + Intergenic
946088857 2:217202256-217202278 CTCTTTAGAGAATAGAGGGATGG + Intergenic
946096440 2:217278590-217278612 CTCTATAAGGAATAAATTACTGG + Intergenic
946491676 2:220154844-220154866 CTCTTTAAGGAATAACAGTTTGG - Intergenic
948245816 2:236484934-236484956 GTCTGTAAAGAATAAAGGGAGGG - Intronic
948791196 2:240377791-240377813 CTCCTTGGGGAATGAATGGATGG - Intergenic
1169794658 20:9448800-9448822 CAGTTTAAGAAATAAATGTATGG + Intronic
1169883399 20:10371741-10371763 TTATTCAATGAATAAATGGATGG - Intergenic
1170120325 20:12904641-12904663 CTTTTTAAATAATAAATAGAAGG - Intergenic
1170132330 20:13034051-13034073 CTGCTTAGGCAATAAATGGAAGG + Intronic
1170568524 20:17620131-17620153 CTCATTAAGGAAAAACAGGATGG + Intronic
1171537880 20:25913307-25913329 TGTTTTAAGAAATAAATGGAGGG - Intergenic
1171803308 20:29648496-29648518 TGTTTTAAGAAATAAATGGAGGG + Intergenic
1171840813 20:30208618-30208640 TGTTTTAAGAAATAAATGGAGGG - Intergenic
1172507731 20:35476285-35476307 CTCCTTAATGAATGAATGAAGGG + Intronic
1174640490 20:52039787-52039809 CTGTTTTAGGATTTAATGGAGGG - Intergenic
1175093769 20:56525544-56525566 CTCTTTCAGGTAGAAAAGGAAGG + Intronic
1175121940 20:56722488-56722510 CTCCTTCAGGAATAAAGGGGTGG + Intergenic
1175667769 20:60874626-60874648 CTGTTTAATGAATAAATGGCTGG - Intergenic
1175817172 20:61889283-61889305 CTCTTTAAAGCATGGATGGATGG + Intronic
1176581199 21:8528773-8528795 TGTTTTAAGAAATAAATGGAGGG + Intergenic
1176972011 21:15277411-15277433 CTGTTGAAAGAATAAATGGATGG - Intergenic
1177125493 21:17188333-17188355 CTTAAAAAGGAATAAATGGAAGG + Intergenic
1177169010 21:17635039-17635061 TTCTATAGGGAAGAAATGGATGG + Intergenic
1177298850 21:19214004-19214026 CTTTTTAAGAAACAAAAGGACGG + Intergenic
1178129032 21:29548827-29548849 CTATTTAAGGAATACATGGTGGG - Intronic
1180019150 21:45109654-45109676 CTTGTTGAAGAATAAATGGACGG + Intronic
1181142628 22:20817879-20817901 CTCTGGAAGGAAGAAATGGGTGG + Intronic
1182291878 22:29286361-29286383 CTCTTTAAGGATTATACAGATGG + Intronic
950221621 3:11200672-11200694 CTGATTAGGGAATACATGGAAGG + Intronic
951982379 3:28579781-28579803 CTCTTTCATGAATATATGAATGG + Intergenic
952173582 3:30836381-30836403 TTTTTTAAGGAATAAATTTATGG - Intronic
952645797 3:35657261-35657283 CTCTTTAAGTTGTGAATGGATGG - Intronic
954356539 3:50086826-50086848 ATCTTTCAAGAATAAGTGGAGGG - Intronic
954362089 3:50127285-50127307 ATATTTAGGGGATAAATGGAGGG - Intergenic
955136056 3:56219387-56219409 CTGTTTAAGAAGTAAATGAATGG - Intronic
955438393 3:58929628-58929650 TTGATTATGGAATAAATGGATGG - Intronic
956052522 3:65263805-65263827 ATCTTTGTTGAATAAATGGATGG - Intergenic
957508465 3:81155991-81156013 CTCTTTAAGGCAGAGTTGGATGG - Intergenic
957515382 3:81244113-81244135 CTACTAAAGGAATAAAGGGAGGG - Intergenic
959178822 3:102952768-102952790 TTGCTAAAGGAATAAATGGAGGG - Intergenic
959350778 3:105260290-105260312 ATCTTTATAAAATAAATGGAAGG + Intergenic
959717375 3:109447598-109447620 GTCTTTATGAAATAAAGGGATGG + Intergenic
959840775 3:110971534-110971556 CTTTTTAAAGAATATTTGGAAGG + Intergenic
962191343 3:133314080-133314102 CTTGTTCATGAATAAATGGATGG + Intronic
962813976 3:138982187-138982209 CAGTTTATGGAATGAATGGAGGG + Intergenic
963054203 3:141171344-141171366 TTCTTTCAGAAAAAAATGGAGGG - Intergenic
963305907 3:143652758-143652780 GTATTTAAGGAATACAAGGATGG - Intronic
963644100 3:147892362-147892384 CTGTATAAAGAATAAATTGAAGG - Intergenic
964408632 3:156376118-156376140 CTGTTAAAAGAATAAATGAAAGG - Intronic
964652614 3:159028376-159028398 GGCATCAAGGAATAAATGGAAGG - Intronic
965483497 3:169249231-169249253 CAAATGAAGGAATAAATGGAAGG + Intronic
965976413 3:174628863-174628885 CTTTTTAAGGAATATGTGTAAGG + Intronic
967707676 3:192671086-192671108 GTTTTCAATGAATAAATGGAAGG + Intronic
968351074 3:198052920-198052942 ATCATTAAAGAATAAATGGCTGG + Intergenic
969402938 4:6968908-6968930 CCCTTTAAGTGCTAAATGGATGG + Intronic
970305685 4:14729600-14729622 TGCTTTAATGAACAAATGGAGGG - Intergenic
970987833 4:22178498-22178520 CTTTTTATGGAATGAATGGGTGG - Intergenic
971834035 4:31738173-31738195 CTATCTGTGGAATAAATGGATGG + Intergenic
972429416 4:38966181-38966203 ATCTAATAGGAATAAATGGAGGG + Intergenic
973052198 4:45610097-45610119 CTCTTTAAGGATAATGTGGACGG - Intergenic
974596510 4:64019771-64019793 CTCTTTAAGGAAAAAGCGGTGGG - Intergenic
974978806 4:68926423-68926445 CTATTTAAAGAATTAATGGCAGG - Intergenic
976883269 4:89956447-89956469 CTTATTAAGTAATAAATGAATGG - Intergenic
976886681 4:89993482-89993504 CTTTTAATGGAAAAAATGGAAGG + Intergenic
976911792 4:90315863-90315885 CACTGTAAGGAAGAAATGGTAGG + Intronic
977091741 4:92686105-92686127 ATCTTTAAGCAATGAATGAAGGG - Intronic
977606368 4:98988751-98988773 CTCTTTAAAAAATAAAAGGCCGG - Intergenic
977953322 4:102999393-102999415 CTCTTAAAGGAAAATATAGAAGG - Intronic
978389963 4:108215189-108215211 CTGTTTATGGAATAAATGAATGG - Intergenic
978843460 4:113244220-113244242 TTGTTTAAGGAATAAATGAATGG - Intronic
980541261 4:134200261-134200283 CTGTTGAAGAAATGAATGGAAGG - Exonic
981731792 4:147907213-147907235 TGCTTTGAGGAATAAATTGAAGG + Intronic
982740376 4:159051671-159051693 CTATTGAAGAAATAAATGAATGG - Intergenic
983490865 4:168387474-168387496 CTCTTCAAAGAACAAAGGGAGGG - Intronic
983694657 4:170513415-170513437 CTCCTTAAGGAATTTATGTATGG - Intergenic
983843469 4:172486164-172486186 GTCTATAAGGAATAAAAAGAAGG + Intronic
985915405 5:2914524-2914546 CTCTTTAGCGAATAGCTGGATGG + Intergenic
987759343 5:22139977-22139999 CTCTTGATGAAACAAATGGAAGG + Intronic
987879630 5:23726711-23726733 TTATATAAGGAATAAATGTATGG + Intergenic
989390223 5:40892797-40892819 CATTTTAAAAAATAAATGGAAGG + Intergenic
989564730 5:42890709-42890731 CATTTTAAGGAAAAAGTGGAGGG - Intergenic
990658558 5:57986013-57986035 CACTTTAAGGAATAAATTGGGGG + Intergenic
991271279 5:64784867-64784889 ATTTTTAAGGAATAAATGGAGGG - Intronic
991894061 5:71373406-71373428 CTCTTGATGAAACAAATGGAAGG + Intergenic
992205043 5:74423028-74423050 CTCTTCTAGGAGAAAATGGATGG - Intergenic
992896274 5:81247823-81247845 CTCTTCAAGGAATCAAAGCAAGG + Intronic
992980515 5:82166265-82166287 CTTTATAAGGCATAAATGGAGGG - Intronic
993034869 5:82745654-82745676 CTGTTTAAATATTAAATGGAGGG - Intergenic
993950372 5:94167480-94167502 AGCTTTTGGGAATAAATGGATGG + Intronic
993985366 5:94591054-94591076 CTTTTTAAGGTATATCTGGAGGG - Intronic
994236076 5:97364071-97364093 CTCTTTTAGAAATAAAGTGACGG - Intergenic
996151209 5:120037035-120037057 TTGTTTAATGAATAAATAGATGG + Intergenic
996664833 5:126047071-126047093 GTCTATAAGGAATAAGTGGAAGG - Intergenic
998077868 5:139250986-139251008 CTGTTTAAGGAATGAAGGAATGG + Intronic
998446040 5:142199206-142199228 CCCCTTAAGGAATACATGTAAGG + Intergenic
999895521 5:156029406-156029428 ATCTTGAATGAATGAATGGATGG - Intronic
1000656163 5:163880767-163880789 ATCTTTAAAATATAAATGGAAGG - Intergenic
1000713775 5:164614069-164614091 CACTTTAAGGAAAAAAAGGTGGG + Intergenic
1001700056 5:173700378-173700400 CTCATTAAGGCATAAATTGCTGG + Intergenic
1001785488 5:174409120-174409142 CTATTTAAGGAAATAAAGGAAGG - Intergenic
1002932265 6:1642874-1642896 CTCCATAAGGAGTAAAGGGAAGG - Intronic
1003432027 6:6047695-6047717 ATTTTTAACGAATAAATGAATGG + Intergenic
1003667297 6:8123235-8123257 TACTTTAATGAATAAATGTACGG - Intergenic
1004534367 6:16485718-16485740 CTACTTCAGGAATAAAAGGATGG - Intronic
1004990152 6:21127743-21127765 CTATCTCAGGAATAAAAGGAAGG + Intronic
1005474944 6:26198768-26198790 CCTTTTAAGGAATACATGGGTGG + Intergenic
1007122468 6:39394633-39394655 CTCTTTGAGGAACCCATGGAAGG - Intronic
1007330446 6:41102819-41102841 ATCCTTAAGGAACACATGGAAGG + Intergenic
1007817229 6:44533172-44533194 CCCAGTGAGGAATAAATGGAAGG - Intergenic
1008486034 6:52036777-52036799 CTCTTGAAGAACTTAATGGATGG + Intronic
1008735738 6:54541721-54541743 TACTTTGGGGAATAAATGGAAGG - Intergenic
1010740786 6:79501296-79501318 TTCTTAAAAGAATGAATGGATGG - Intronic
1011423629 6:87202210-87202232 TTATTTAAAGAATAAAAGGAAGG - Intronic
1011533412 6:88350325-88350347 ATATTTAAGGTATAAATGTAAGG + Intergenic
1012839640 6:104313526-104313548 CTTTTTAAGAAATAAGTAGAGGG + Intergenic
1014082760 6:117306638-117306660 GTATTTAAGCAGTAAATGGAAGG + Intronic
1014363974 6:120517275-120517297 CCCTATGGGGAATAAATGGAAGG - Intergenic
1020805509 7:12785627-12785649 CTCTCTAAGAAACAAATGAAAGG + Intergenic
1021039632 7:15846096-15846118 CACTGTAAGGAATAACAGGAAGG + Intergenic
1022044441 7:26611888-26611910 CTCATTAAAGAAGAAAGGGAGGG + Intergenic
1024872943 7:53987082-53987104 CTTTTAAGGGAATAGATGGAAGG - Intergenic
1025289331 7:57700136-57700158 TGTTTTAAGAAATAAATGGAGGG - Intergenic
1025533330 7:61917493-61917515 CTCTTTAGAGAATCACTGGAGGG + Intergenic
1026271724 7:68842646-68842668 CTCTTTATATAATAAATAGAGGG + Intergenic
1028232558 7:88323222-88323244 CACGTTTAGGAATAAATAGATGG - Intergenic
1029594839 7:101532103-101532125 CTCTTTAATGATGAAATAGATGG - Intronic
1029927246 7:104329900-104329922 CTGTTTAAAGATGAAATGGAAGG - Intronic
1030303268 7:107995308-107995330 CTCTCAAAGGAAAAAAGGGAGGG + Intronic
1031540295 7:122987437-122987459 CTATTTAAGGTATGTATGGAGGG + Intergenic
1032028961 7:128465838-128465860 ATGTAAAAGGAATAAATGGAGGG + Intergenic
1033002945 7:137526908-137526930 CTCTTTATGGATAAAGTGGATGG + Intronic
1033026751 7:137781802-137781824 AGGTTTAAAGAATAAATGGAGGG + Intronic
1033131867 7:138751671-138751693 ATGTCTAAGGAATGAATGGAGGG + Intronic
1033440524 7:141374017-141374039 CTCTTTAAGGAATAAATGGAAGG - Intronic
1033926990 7:146474440-146474462 CACATAAAGGAATATATGGAGGG - Intronic
1034148496 7:148893796-148893818 CTTTTGAATGAATAAATGAAGGG - Intergenic
1037608494 8:20457284-20457306 CTCTGGAGGGAATAAAAGGAAGG - Intergenic
1037846645 8:22288782-22288804 GCATTTAATGAATAAATGGATGG + Intronic
1038376993 8:27049587-27049609 TGCTTTCAGGAATAAGTGGATGG - Intergenic
1038788973 8:30650250-30650272 TTATTTCAGGAATAAATGCAAGG + Intronic
1038989963 8:32857403-32857425 CTAATTAAGGGATAAATGGAGGG - Intergenic
1039294128 8:36130767-36130789 CTCTGAAAGGAATAAATGAATGG - Intergenic
1040275311 8:46010792-46010814 CTCTTGAAGGAAAAAAAGGGTGG - Intergenic
1042258431 8:66831155-66831177 CTCTTTAAAAAATAAATGTTAGG - Intronic
1042361046 8:67883543-67883565 ATTTTTTAGGAATGAATGGATGG - Intergenic
1042866055 8:73357541-73357563 CTTATTAAGTGATAAATGGAGGG - Intergenic
1043541958 8:81274200-81274222 TTATTTAAGAAATAAATGAAAGG - Intergenic
1043772214 8:84218845-84218867 CCCATGAAGGAACAAATGGATGG + Intronic
1044108989 8:88248434-88248456 ATCAGTAAGGAATAAAAGGATGG + Intronic
1044553164 8:93534470-93534492 GTCTTTCAAGAATAAATTGATGG + Intergenic
1044693405 8:94900225-94900247 CTCTTTGTGGGATAAATGGAGGG + Intronic
1044912817 8:97079620-97079642 GTCCTTAAGGAGTTAATGGAGGG + Intronic
1045722090 8:105124427-105124449 ATGTTTTATGAATAAATGGATGG + Intronic
1046109337 8:109702916-109702938 ACATTTAAGGAATAAGTGGATGG - Intergenic
1046792600 8:118337811-118337833 CACTTAAAGGAATCAATGTACGG - Intronic
1047178279 8:122562697-122562719 CTCTTTCTGGAATATCTGGAAGG + Intergenic
1050767524 9:9153250-9153272 CTCTTTAACTGCTAAATGGATGG + Intronic
1052120570 9:24710659-24710681 CTCATTAATTAATAAATTGAAGG + Intergenic
1053105847 9:35406879-35406901 CTCTTCAAGGAATATTGGGAGGG - Intergenic
1053566948 9:39262927-39262949 GTTTATAAGGAAAAAATGGAAGG - Intronic
1053832723 9:42100769-42100791 GTTTATAAGGAAAAAATGGAAGG - Intronic
1054130195 9:61356080-61356102 GTTTATAAGGAAAAAATGGAAGG + Intergenic
1054161658 9:61675616-61675638 CTTTTTAAAGAATCAATGAAGGG + Intergenic
1054597830 9:67086641-67086663 GTTTATAAGGAAAAAATGGAAGG + Intergenic
1054818291 9:69496733-69496755 CTCTTTAAATAATTAATAGACGG - Intronic
1055266919 9:74503889-74503911 CTCATTAAGAATTGAATGGATGG - Intronic
1055864124 9:80792214-80792236 TTCCTTGAGGAATGAATGGATGG - Intergenic
1057932099 9:99202959-99202981 CTTTTTAAGAAAAAAAAGGATGG + Intergenic
1058381767 9:104384499-104384521 CTATTTAATGGATGAATGGATGG - Intergenic
1058961011 9:109993055-109993077 TTCTTTAAGAATTAAAAGGAGGG - Intronic
1060547910 9:124471437-124471459 TTCTTCAAGGAAAAGATGGAGGG - Intronic
1062650325 9:137573062-137573084 CTCTCTAAAGAATAAGTGGGCGG + Intronic
1203611218 Un_KI270749v1:6818-6840 TGTTTTAAGAAATAAATGGAGGG + Intergenic
1185646156 X:1617170-1617192 CTCTTTAAAAAATAAACGGCAGG + Intronic
1185814219 X:3139248-3139270 CTCTTTGAGGAATAAGGGAAAGG + Intergenic
1185821435 X:3208647-3208669 CCCTTTAAGAAATTAATAGAAGG - Intergenic
1186358048 X:8807868-8807890 TTATTTAAAGAATGAATGGATGG - Intergenic
1186617452 X:11204287-11204309 ATCTTGAAAGAATGAATGGATGG + Intronic
1187261906 X:17692612-17692634 TTCTTTCAGGAATGAAAGGAAGG - Intronic
1189012187 X:37056977-37056999 CTTTTTAATAAATAAATGGCAGG - Intergenic
1189036524 X:37499308-37499330 CTTTTTAATAAATAAATGGCAGG + Intronic
1190908820 X:54753790-54753812 AAGTTAAAGGAATAAATGGAAGG + Intronic
1193512426 X:82419839-82419861 CTCCTTAAGGTATAAATTCAGGG - Intergenic
1194142893 X:90227296-90227318 CTATTTAAGAAAAAAATGCAGGG + Intergenic
1194939380 X:99991309-99991331 TTGTTAAAGGAATAAATTGAAGG - Intergenic
1195409432 X:104553860-104553882 CTCTCTAAGGAATAAAGCAAAGG + Intergenic
1195737859 X:108032342-108032364 ATATTTACTGAATAAATGGATGG - Intergenic
1196629988 X:117927194-117927216 CTCTTTAAGAAAGAAGTGGCCGG - Intronic
1196860137 X:120019574-120019596 ATTTTTAAAAAATAAATGGAAGG + Intergenic
1197955916 X:131947562-131947584 ATCTTTCAGAAATAAATGTATGG + Intergenic
1198506610 X:137307664-137307686 TTCTTAAATGAATGAATGGATGG + Intergenic
1198562525 X:137866439-137866461 CTGTTTAAAGAATAAATTAATGG - Intergenic
1198831952 X:140760167-140760189 CTCTTTAAGGAAAACAAGGAAGG + Intergenic
1198990260 X:142505825-142505847 CTCTTTAAGGAGTAAATACTAGG - Intergenic
1200488651 Y:3796618-3796640 CTATTTAAGAAAAAAATGCAGGG + Intergenic