ID: 1033441678

View in Genome Browser
Species Human (GRCh38)
Location 7:141385794-141385816
Sequence CAGAAATAGAAGTGGACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 373}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033441678 Original CRISPR CAGAAATAGAAGTGGACCCA AGG (reversed) Intronic
904806269 1:33134552-33134574 CAGAGACACAAGGGGACCCATGG + Intergenic
904886206 1:33740457-33740479 CAGAAACAGCAGTGGCCCTAGGG + Intronic
905323958 1:37137316-37137338 AGGCAAGAGAAGTGGACCCAGGG + Intergenic
907465850 1:54636210-54636232 GAGAAAGAAAAGTGGGCCCAGGG + Exonic
908022750 1:59915252-59915274 GAGAAAGAAAAGTGGGCCCAGGG - Intronic
909047715 1:70730072-70730094 CAAAAATATAAGTGGACATATGG + Intergenic
909290737 1:73880046-73880068 CACAAATAGAAGTGGACTTATGG - Intergenic
910653854 1:89600120-89600142 CAGAAAGACAAGTGGGCCTAGGG + Intergenic
911041542 1:93594712-93594734 CAGACCAAGAAGTGGGCCCAGGG - Intronic
911883049 1:103265914-103265936 CAGAAATAGAAGTAAACAAAGGG + Intergenic
911947780 1:104134833-104134855 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
912642371 1:111359814-111359836 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
914393254 1:147240951-147240973 GAGAAAGAAAAGTGGGCCCAGGG - Intronic
914985675 1:152455202-152455224 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
916005104 1:160652992-160653014 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
916039329 1:160948918-160948940 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
916267337 1:162903936-162903958 CAGAACTAGAACTGGAACCCAGG + Intergenic
916400504 1:164442867-164442889 CAGAAAAAGAACTGGAGACAGGG - Intergenic
916630276 1:166605458-166605480 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
917628407 1:176869273-176869295 CAGAAAGAGCATTGAACCCAAGG + Intronic
919043350 1:192421005-192421027 TGGAAATAAAAGTGGACCAATGG + Intergenic
919326054 1:196108826-196108848 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
920300380 1:204985108-204985130 CAGACTTAGAGGGGGACCCATGG - Intronic
921179856 1:212623674-212623696 GAGAAATAGAGGTGGCCCCTTGG + Intergenic
921748314 1:218763447-218763469 CAGCAATAGAAGTATACACAAGG - Intergenic
922352378 1:224744718-224744740 CAGAAATAGAAATAGAAACAGGG + Intergenic
922783710 1:228272815-228272837 CAGAAAGACAGGTGGACACATGG - Intronic
923098130 1:230791950-230791972 CAGAAATAGACATGGATCCTGGG + Intronic
923440259 1:234011904-234011926 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
923912731 1:238467129-238467151 CAGGAATGGAACTGGACCCCAGG - Intergenic
1064084290 10:12333695-12333717 CAGAAATAGAAGTGGATCTCTGG + Intergenic
1064834410 10:19509901-19509923 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
1065132458 10:22635884-22635906 CAGAAAGAGAAGTCGACTTAGGG + Intronic
1065319735 10:24498196-24498218 CAAGAAGAGAAGTGGACCCAGGG + Intronic
1065500489 10:26376978-26377000 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1066634684 10:37489089-37489111 CAGAAATAGAAGTGGCTCTCTGG + Intergenic
1066635351 10:37494192-37494214 GAGAAAGAAAAGTGGGCCCAAGG - Intergenic
1069570375 10:69491183-69491205 CAGGAATGGAAGAGAACCCAGGG - Intronic
1071499325 10:86192248-86192270 CAGAAAGCCAAGTGGACCAAAGG + Intronic
1075549207 10:123379668-123379690 TGGAAATAGACGTGGGCCCAGGG - Intergenic
1076932383 10:133541144-133541166 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
1080429985 11:32189287-32189309 CAGGAATAGAAGAGAAGCCACGG - Intergenic
1080518897 11:33049437-33049459 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
1081014584 11:37859786-37859808 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1081124623 11:39307736-39307758 CAGAAATACCATTTGACCCATGG - Intergenic
1081883909 11:46478394-46478416 CAGAAATACATTTGGCCCCAAGG + Intronic
1082673024 11:56058507-56058529 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1082982591 11:59137161-59137183 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1083040642 11:59682019-59682041 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1083388108 11:62327450-62327472 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1083394702 11:62382217-62382239 GAGAAAAAAAAGTGGGCCCAGGG + Intronic
1083579639 11:63816801-63816823 CAGCAATAGGAGTGGGACCATGG + Intronic
1083797112 11:65023292-65023314 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
1084230656 11:67750311-67750333 AAGAAACAGAAGTGGAGCTAAGG + Intergenic
1084292000 11:68178422-68178444 CAGAAACAGAAGTCAACACAGGG - Intronic
1084596547 11:70120125-70120147 CAGAAATGAAAGTGCAGCCAAGG + Intronic
1084799783 11:71535580-71535602 GAGAAAGAAAAGTGGGCCCAGGG - Intronic
1085319474 11:75565168-75565190 CAGCAGTAGCAGTGGCCCCAAGG - Intronic
1086726197 11:90187286-90187308 TAGAAATAGCATTTGACCCAGGG + Intronic
1087289796 11:96307876-96307898 CAGAACTAATAGTGAACCCAAGG + Intronic
1087359843 11:97144545-97144567 CAGAAATAGAATTAGACCCTTGG + Intergenic
1087614285 11:100470501-100470523 GAGAATTAGAACTGGAGCCATGG - Intergenic
1088014388 11:105040905-105040927 CATAAATAGAAGTTGACCCTAGG - Intergenic
1088032283 11:105265703-105265725 CAGAAAGAAAAGCGGGCCCAGGG - Intergenic
1088714900 11:112540411-112540433 CAGAACTAGAAATGCCCCCAGGG - Intergenic
1089084183 11:115802969-115802991 TAGAAATAGAAGTAGACCCCGGG + Intergenic
1089240506 11:117074407-117074429 CAGAAGTAGAGGTAGAACCAAGG - Intronic
1090600193 11:128362074-128362096 CAGAAATAGAAGACGAGCAAAGG - Intergenic
1091426893 12:398563-398585 TAGAATTAGAAGTGGAGCCTTGG - Intronic
1091612026 12:2018911-2018933 CAGCTAAAGAAGTGGTCCCAAGG + Intronic
1092059631 12:5537866-5537888 GAGAAAGAAAAGTGGGCCCAGGG - Intronic
1092234458 12:6797494-6797516 GAGGAATAAAAGTGGGCCCAGGG + Intronic
1092455160 12:8636494-8636516 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1093019531 12:14190297-14190319 CAGAAATAAAAATGGACAAATGG + Intergenic
1095456200 12:42388595-42388617 GAGAAAGAAAAGTGGGCCCAGGG - Intronic
1095722548 12:45416266-45416288 GACAAAAAGAAATGGACCCATGG - Intronic
1096759328 12:53826943-53826965 CAGAACTAGAAGAGGACTGAAGG - Intergenic
1096869032 12:54582001-54582023 CAGACACAGAAGTGGAGTCAAGG - Exonic
1097350465 12:58543256-58543278 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1098654303 12:73008817-73008839 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1099349338 12:81545586-81545608 CAAAAATAGAAGTTGCACCATGG + Intronic
1100184888 12:92128386-92128408 CAGAAATACAACTGGCCCTAAGG - Intronic
1101294056 12:103402816-103402838 GAGAAGTAGAAGGGGACCCAAGG + Intronic
1101518236 12:105457265-105457287 CAGAAATAGAATTGGAGTCATGG - Intergenic
1104356919 12:128095087-128095109 CAAAAACAGAATTGGAACCAAGG - Intergenic
1105209934 13:18251804-18251826 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1105542900 13:21330049-21330071 CAGAAACAGAAATTGAGCCAAGG + Intergenic
1105688660 13:22813742-22813764 GAGAAAGAAAAGTGGACCCGGGG + Intergenic
1105879589 13:24592415-24592437 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1105920251 13:24956639-24956661 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1107388806 13:39942200-39942222 TAGAAATAGAGTTGGAACCACGG - Intergenic
1109267211 13:60215563-60215585 CAGAGATAAAACTGGACCTAAGG - Intergenic
1109707213 13:66112064-66112086 CAGAAGCAGAATTGGACCGAGGG - Intergenic
1110893383 13:80717786-80717808 CACAAATAGAACTGGCCCAATGG + Intergenic
1112007795 13:95268888-95268910 GAGAAAGAAAAGTGGGCCCAGGG - Intronic
1112144612 13:96684442-96684464 CAGAAATATAAGTGGAATCAGGG + Intronic
1112193616 13:97202960-97202982 CAAAACAAGAAGTGGAGCCAAGG - Intergenic
1112369556 13:98782783-98782805 CAGAGACAGCTGTGGACCCAAGG + Intergenic
1112443672 13:99444359-99444381 CAGAAATGGGAGTGGACGAAAGG - Intergenic
1112459168 13:99588220-99588242 TTGAAATAGATGTGGACTCATGG - Intergenic
1113403609 13:110018328-110018350 CAGAAATAGAACTGGACAGTGGG - Intergenic
1113970104 13:114182005-114182027 GAGAAATAACAGTGGGCCCAGGG + Intergenic
1114006615 14:18320359-18320381 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1114604024 14:23981586-23981608 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
1114609042 14:24024385-24024407 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1114802462 14:25792859-25792881 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1114993969 14:28323578-28323600 CAGAAATATAAGTGCAGTCATGG + Intergenic
1115000587 14:28416344-28416366 GAGGAAGAAAAGTGGACCCAGGG - Intergenic
1115109134 14:29800374-29800396 ATGAAGTAGAAGTGGACACAGGG - Intronic
1115282121 14:31675910-31675932 ATGAAACAGAAGGGGACCCAAGG - Intronic
1116464393 14:45214575-45214597 GAGAAACAAAAGTGGGCCCAGGG - Intronic
1116846329 14:49868072-49868094 GAGAAATAGAAGAGGAGCCGGGG + Intergenic
1119823075 14:77635370-77635392 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1121506682 14:94483096-94483118 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1122860333 14:104579652-104579674 CAGAAATAGCAGTGAACCCGAGG - Intronic
1202837218 14_GL000009v2_random:87173-87195 CAGACTTAGAATTTGACCCAAGG + Intergenic
1202906610 14_GL000194v1_random:77303-77325 CAGACTTAGAATTTGACCCAAGG + Intergenic
1123390546 15:19866995-19867017 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1127699593 15:61485338-61485360 CAGAAGTTGAAGAGGCCCCAGGG + Intergenic
1129303226 15:74638920-74638942 TAGAAAGAGAAGTGGACAGATGG - Intronic
1129748232 15:78039922-78039944 CAGAACTAGAGCTGGACCCCAGG + Intronic
1134007783 16:10829543-10829565 GAGAAATAACAGTGGGCCCAGGG + Intergenic
1134509897 16:14837702-14837724 GAGAAATAGAGGTGGGCCCCAGG + Intronic
1134697544 16:16236201-16236223 GAGAAATAGAGGTGGGCCCCAGG + Intronic
1134974299 16:18558474-18558496 GAGAAATAGAGGTGGGCCCCAGG - Intronic
1135289338 16:21221881-21221903 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1136710216 16:32230726-32230748 GAGAAAGAACAGTGGACCCAGGG - Intergenic
1136757694 16:32698685-32698707 GAGAAAGAACAGTGGACCCAGGG + Intergenic
1136810412 16:33171690-33171712 GAGAAAGAACAGTGGACCCAGGG - Intergenic
1136816888 16:33281770-33281792 GAGAAAGAACAGTGGACCCAGGG - Intronic
1137793460 16:51194858-51194880 CAGAAAGAGAAGAAAACCCATGG - Intergenic
1137821233 16:51448005-51448027 CAGACCTAGAAGTTGACCCCAGG - Intergenic
1140335515 16:74101183-74101205 CAGAAATAGCATTAAACCCACGG - Intergenic
1140546496 16:75815098-75815120 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1141025267 16:80540971-80540993 CAAAAAAGGAAGTGGCCCCACGG - Exonic
1141970336 16:87477663-87477685 CAAAAATAGAACTTGACTCATGG + Intronic
1203059844 16_KI270728v1_random:959034-959056 GAGAAAGAACAGTGGACCCAGGG + Intergenic
1143443196 17:6991691-6991713 TAGAATTAGAAGTGGAGCCTGGG + Intronic
1145968500 17:28938897-28938919 CTGAAAGAAAAGTGGACCAAAGG - Intronic
1146166600 17:30594537-30594559 GAGGAATAAAAGTGGGCCCAGGG + Intergenic
1146261570 17:31425614-31425636 CAGAAATAGAAGGGGAAGCCTGG + Intronic
1150219899 17:63490221-63490243 CAGAAACAGATTTGGACTCAAGG - Intronic
1152976174 18:221333-221355 TAGAATGAGAAGTTGACCCAGGG - Intronic
1153867799 18:9289079-9289101 AACAAAAAGATGTGGACCCAAGG + Intergenic
1154305990 18:13231261-13231283 AAGAAATGGCAGTGGACACATGG + Intronic
1155547117 18:26927376-26927398 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
1155942289 18:31811367-31811389 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1156563764 18:38160016-38160038 AAAAAATACAAGTGGACCAAAGG - Intergenic
1156657177 18:39302563-39302585 CAGAAAAAGAAGTGCACAAAAGG + Intergenic
1157113171 18:44840126-44840148 CATAAAGAGAAGTGTACACATGG - Intronic
1157379509 18:47199724-47199746 AAGAAATTGAAGCGGACCCCAGG + Intergenic
1159720091 18:71878857-71878879 CAGAAATAAAGGTGGACAAAAGG + Intergenic
1159846027 18:73460913-73460935 CAGTAATGGAAGTGAACCAAAGG + Intergenic
1162374523 19:10296781-10296803 CAGAAACAGAAGCGGAGACAGGG - Intergenic
1162699500 19:12503132-12503154 CAGAAATAGAACGGGGCACAGGG - Intronic
1163203181 19:15782689-15782711 GAGAAAGAACAGTGGACCCAGGG + Intergenic
1163898880 19:20083188-20083210 GAGAAAGAAAAGTGGGCCCAGGG - Intronic
1163920782 19:20286591-20286613 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1163920834 19:20287029-20287051 CAGAAGTATAAATGGGCCCATGG + Intergenic
1164022751 19:21322908-21322930 CAGAAATGTAAATGGGCCCATGG - Intronic
1164055685 19:21620305-21620327 GAGAAACAACAGTGGACCCAGGG + Intergenic
1164208684 19:23078650-23078672 GAGAAAGAAAAGTGGGCCCAGGG - Intronic
1164390482 19:27815436-27815458 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1164833624 19:31341781-31341803 CAGAAGTAGCCGTGGAACCAGGG - Intronic
1165295190 19:34921030-34921052 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1165535393 19:36440011-36440033 CAGAGGTAGGAGTTGACCCAGGG - Intergenic
1165606186 19:37106738-37106760 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
1165607119 19:37115291-37115313 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
1165621558 19:37252488-37252510 CAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1165633530 19:37321566-37321588 GAGAAAGAAAAGTGGGCCCAGGG - Intronic
1165657861 19:37549639-37549661 CCGAATTAGAAGTGGGCTCAAGG - Intergenic
1166619220 19:44280690-44280712 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
1167424653 19:49423680-49423702 CAGACAGAGAGGTGGACACAGGG + Intergenic
1167867323 19:52338873-52338895 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
1168461110 19:56559425-56559447 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1168614179 19:57824479-57824501 GAGAAAGAAAAGTGGGCCCAGGG - Intronic
1168638374 19:58013640-58013662 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1202635421 1_KI270706v1_random:40178-40200 CAGACTTAGAATTTGACCCAAGG - Intergenic
925626497 2:5846611-5846633 GAGGAATAGAACTTGACCCATGG + Intergenic
925820358 2:7793884-7793906 CAGAAAGAGAGGGTGACCCAGGG - Intergenic
927717628 2:25362805-25362827 CCGAAGAAGAAGTGGAGCCACGG + Intergenic
928689061 2:33780146-33780168 CAGAAAAAGAAGGTGACCTATGG - Intergenic
929757891 2:44783073-44783095 TAGAATTAGAAGTGGAGCCTGGG + Intergenic
929994115 2:46814471-46814493 CACAAAAAGAAGTTGAACCAAGG + Intergenic
930578836 2:53185254-53185276 CAGAAAGAGCTGTCGACCCATGG - Intergenic
932802399 2:74752543-74752565 CACAAATAGAAATGGAGCTAGGG + Intergenic
934548404 2:95238836-95238858 TAGAATTAGAAGTGGAGCCTGGG + Intronic
935180517 2:100685722-100685744 GAGAAAGAAAAGTGGACCCAGGG - Intergenic
935351614 2:102155706-102155728 CAGAAGTAAACTTGGACCCAGGG + Intronic
936980531 2:118261160-118261182 CAGAACTAGAACTGGAACCCAGG - Intergenic
937970108 2:127542668-127542690 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
938529947 2:132175115-132175137 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
938713558 2:133997590-133997612 CAGAAACAGCAGTGGTCTCAAGG + Intergenic
938919301 2:135979670-135979692 CTGAATTAGAAGGGGACACAGGG - Intronic
938978882 2:136506989-136507011 CACAAATAAAAGTTGACCCTGGG - Intergenic
939616831 2:144371005-144371027 CAGAATTAGAAGTGGAAATAAGG + Intergenic
940122416 2:150281565-150281587 GAGACTTAGAAATGGACCCAAGG + Intergenic
940358270 2:152769170-152769192 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
941606965 2:167609877-167609899 AAGAAATAGATGTGGAGCGAAGG + Intergenic
941859409 2:170263397-170263419 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
942285959 2:174416243-174416265 CAGAAATAGCAGTGGTGGCATGG + Intronic
942888632 2:180960406-180960428 CAGAAATAGCAGTTGGCCCTGGG - Intergenic
942923787 2:181409313-181409335 CTGAAAAAGAATTGGACTCAGGG + Intergenic
943327614 2:186520943-186520965 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
943327791 2:186522347-186522369 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
944406151 2:199385893-199385915 CAGATATGGAAATGGACACATGG - Intronic
946413099 2:219525476-219525498 CAGATTCAGAAGTGGACCCCAGG - Intronic
946784806 2:223232177-223232199 CAGAATTAAAAGAGGTCCCAAGG - Intergenic
947426703 2:229990025-229990047 CAGAACTAGGATTGAACCCAGGG - Intronic
948730486 2:239960742-239960764 CAGAAATAAAAGTGTTTCCATGG - Exonic
1169948720 20:11018122-11018144 CATAAGTAAAAGTGTACCCATGG + Intergenic
1170397789 20:15946758-15946780 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
1170724729 20:18916325-18916347 CAGAAGTAGAATTGGACAAAGGG + Intergenic
1170758282 20:19224453-19224475 CAGTAATAAAAGTGCATCCATGG - Intronic
1171256752 20:23694451-23694473 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1171264108 20:23756373-23756395 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1171291085 20:23983494-23983516 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1174619463 20:51863049-51863071 TAGTAATAGATGTGGACACATGG - Intergenic
1176625956 21:9092102-9092124 CAGACTTAGAATTTGACCCAAGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178935695 21:36859758-36859780 AAGGAATAGAAGTGGTCCCAAGG + Intronic
1180365286 22:11933049-11933071 CAGACTTAGAATTTGACCCAAGG + Intergenic
1180431124 22:15251170-15251192 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1180513683 22:16119071-16119093 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1180766326 22:18347599-18347621 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1180779989 22:18514779-18514801 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1180812703 22:18772100-18772122 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1181198861 22:21206348-21206370 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1181400874 22:22649441-22649463 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1181423719 22:22819348-22819370 CAGGAATAGAAGTGTCCTCAGGG - Intronic
1181534952 22:23536915-23536937 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1181702856 22:24630539-24630561 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1182395102 22:30029754-30029776 CAGAATTTAAAGTGGACCCTGGG + Intronic
1183092539 22:35532640-35532662 CAGAAATGGAGGTGGAACCTGGG + Intergenic
1183627186 22:39011609-39011631 CAGGAAGAAAAGTGGGCCCAGGG + Intergenic
1203227944 22_KI270731v1_random:88489-88511 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
949549851 3:5104002-5104024 GAGAAAGAGAAGAGAACCCAAGG - Intergenic
950387984 3:12674967-12674989 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
950629604 3:14273696-14273718 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
951283424 3:20780102-20780124 AACAAGTAGAAGTTGACCCAAGG + Intergenic
953769021 3:45764752-45764774 CAGAAATAGAGGTGAACTCCAGG + Intronic
954941327 3:54375759-54375781 CAGAAAAAGAATGGGATCCAGGG + Intronic
956529676 3:70203884-70203906 CAGAAACAGAAGTGGGGACATGG + Intergenic
956624926 3:71257660-71257682 AAGAAAAAGAAATGGAGCCACGG + Intronic
957217966 3:77346379-77346401 GAGTAATAAAACTGGACCCAGGG - Intronic
958858799 3:99420171-99420193 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
958874664 3:99602475-99602497 AAGAAAGAGAAGTGGTCCCACGG - Intergenic
959583669 3:108006254-108006276 CAGAATTAGAAGTGGAGTCAGGG - Intergenic
961387209 3:126529469-126529491 CAGAAACAGAATTTGACCCCAGG - Intronic
961879286 3:130049428-130049450 AAGAAAGAGAAGTGGAGCTAAGG + Intergenic
962090716 3:132241477-132241499 CAGAAAAGGAACAGGACCCAAGG - Intronic
962128698 3:132649678-132649700 TAGAAAGAAAAGTGGGCCCAGGG - Intronic
962727136 3:138241149-138241171 CAGAAGTAAAATTGGACTCATGG + Intronic
963552827 3:146745763-146745785 CACGGATAGAAGTGGAGCCATGG - Intergenic
965164686 3:165181775-165181797 CAGAAACAGAAGTAGAAGCAGGG + Intergenic
965404990 3:168256943-168256965 CAGAAAGTGAAGGGGAACCAAGG + Intergenic
966031207 3:175349959-175349981 CAAACATAGAAGAAGACCCATGG - Intronic
968373784 4:19911-19933 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
968991515 4:3916449-3916471 AAGAAAGAGAAGTGGAGCTAAGG + Intergenic
969012188 4:4075199-4075221 GAGAAACAGCAGTGGGCCCAGGG - Intergenic
969609013 4:8216785-8216807 CAGAAGGAGAGGTGGGCCCAGGG - Intronic
970254130 4:14149488-14149510 CAGAGACAGAAGTGTACCAAGGG - Intergenic
970418149 4:15879438-15879460 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
970947552 4:21712935-21712957 CAGAAAGAGAAGCAGACACAGGG - Intronic
971026875 4:22597854-22597876 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
971492197 4:27224964-27224986 CAGAAACTGAAGTATACCCAGGG + Intergenic
971781880 4:31046094-31046116 CAGATATACAAGTCAACCCATGG - Intronic
972480460 4:39491459-39491481 CTGAAATGGAAGTGAACACATGG - Intergenic
973147097 4:46840766-46840788 CAGTAACAGAAGTGGACATAAGG + Intronic
974952422 4:68598909-68598931 GAGAAAGAAAAGTGGGCCCAGGG - Intronic
975245460 4:72115596-72115618 CAGAAATAGGAGACAACCCAGGG - Intronic
976843692 4:89462109-89462131 GACAAATAGAAATGGATCCATGG - Intergenic
976868710 4:89764027-89764049 CAGAAACAGATGGGGATCCAAGG + Intronic
977400386 4:96524199-96524221 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
977489303 4:97691778-97691800 CAGGAAGTGAAGTGGACACAGGG - Intronic
978293549 4:107175624-107175646 CAGAAATCCAACTGGACCCCTGG - Intronic
978422769 4:108551521-108551543 CAGAAATAAAAATAGACACACGG + Intergenic
978565068 4:110072677-110072699 CAGAGATAAAAGTGCTCCCAGGG - Intronic
979758796 4:124374290-124374312 CAGCAATTGCAGTGGGCCCATGG + Intergenic
980544939 4:134247159-134247181 CAAATATAAAAGTGGACACATGG - Intergenic
981408960 4:144405326-144405348 CACAAATAGTAGTAAACCCATGG - Intergenic
982823718 4:159976581-159976603 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
984019952 4:174473688-174473710 CAGAAATAGCACAGGACCCTGGG + Intergenic
985057871 4:186050892-186050914 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1202762730 4_GL000008v2_random:126057-126079 CAGATTTAGAATTTGACCCAAGG - Intergenic
985734103 5:1567484-1567506 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
986431419 5:7684746-7684768 CAGACATAGATGTGGCTCCAAGG - Intronic
988496061 5:31747296-31747318 GAGAAATAGAATTGGACAAAGGG + Intronic
990081579 5:51922432-51922454 CAGAAATGGAACTGGAACCCAGG + Intergenic
990177370 5:53122805-53122827 CAGAAATAAAAGAGGAGCAATGG + Intergenic
990458013 5:56006563-56006585 CAGAACGAGAACTGGACACAAGG - Intergenic
990619807 5:57547548-57547570 GAGAAACAACAGTGGACCCAGGG - Intergenic
992733328 5:79693663-79693685 CAGAATTAGGAGTAGACCCCAGG + Intronic
992836116 5:80643167-80643189 TAGAATTAGAAGTGGAACCTGGG + Intronic
993313996 5:86375921-86375943 CAGAAAAAGAAGTGGCACAAAGG - Intergenic
993540575 5:89145563-89145585 CAGAAATAAAAGGCAACCCATGG - Intergenic
993889491 5:93456677-93456699 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
993889674 5:93458149-93458171 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
994116143 5:96063105-96063127 CAGAAATACAAGTGGCACAATGG - Intergenic
995421654 5:111974325-111974347 AAGAAATAGATGTGGAAACAGGG + Intronic
995602159 5:113809155-113809177 CAGATATAGAACTGAATCCAGGG + Intergenic
995750536 5:115449265-115449287 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
996038505 5:118785027-118785049 TAGAAAAAGGAATGGACCCATGG + Intergenic
997997185 5:138596378-138596400 CAGAAGTAGGAGTGGACCTGAGG + Intergenic
999216856 5:149942570-149942592 GAGAAAGAGCAGTGGGCCCAGGG + Intronic
999361575 5:150990572-150990594 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
999451563 5:151682128-151682150 AGGAAATAGAAGTGGAAGCAGGG - Intronic
999989218 5:157034094-157034116 GAGAAAGAGCAGTGGGCCCAAGG + Intronic
1000875290 5:166629965-166629987 AAGACATAGAAGTGGATCAATGG - Intergenic
1002377529 5:178798926-178798948 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1002721964 5:181266954-181266976 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1003751131 6:9057218-9057240 CAGAATCAGAACTGGACTCAAGG + Intergenic
1005534921 6:26745525-26745547 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1005623377 6:27640404-27640426 CAGAAATAGAAATGGAAATAGGG - Intergenic
1005729502 6:28683295-28683317 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1005730073 6:28688240-28688262 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1006238499 6:32657219-32657241 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1007506116 6:42336758-42336780 CAGAGCTAGAATTTGACCCAAGG - Intronic
1009269242 6:61597793-61597815 CGGGAAAAGAAGTGGACCAAAGG + Intergenic
1012136232 6:95560716-95560738 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1012782842 6:103584946-103584968 TAGAAGTAGAAGTGGAGCCTGGG - Intergenic
1015262329 6:131252373-131252395 CAGAAAATGGAGAGGACCCAGGG - Intronic
1017770907 6:157644015-157644037 CAGAAAGAGGAGGGGACACATGG - Intronic
1017878940 6:158546466-158546488 CAAAAATAGAACTGAACCCCAGG + Intronic
1020314347 7:6894338-6894360 AAGAAAGAGAAGTGGAGCTAAGG + Intergenic
1021747487 7:23757301-23757323 GAGAAAGAAAAGTGGGCCCAAGG + Intronic
1022116393 7:27264723-27264745 CTGAATTAGAAGTGATCCCATGG - Intergenic
1022307369 7:29159952-29159974 CAGAAAATGACGTGCACCCATGG - Intronic
1026008591 7:66619049-66619071 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1028596729 7:92553929-92553951 AAGAAATGGAAGTGGAACCCAGG - Intergenic
1029981796 7:104885902-104885924 GAGAAATAGCAGGGGAGCCAGGG - Intronic
1030273530 7:107695282-107695304 CAGAAATAAAAGCGGATACAAGG + Intronic
1030756265 7:113291341-113291363 CTGAAATAAGAGTGGACCCTGGG - Intergenic
1030939094 7:115622925-115622947 CAGAAATAGGAGTTGTCACAAGG + Intergenic
1031478767 7:122253361-122253383 AAGAAAAAGAGGTGAACCCAGGG - Intergenic
1031536346 7:122938093-122938115 CAGAAATAAAAATGGACAAATGG - Intergenic
1032339905 7:131061221-131061243 CAGAAATAAAAGTGGTTCCTGGG - Intergenic
1033441678 7:141385794-141385816 CAGAAATAGAAGTGGACCCAAGG - Intronic
1033482026 7:141751987-141752009 GAGAAAGAAAAGTGGGCCCAGGG - Intronic
1033545783 7:142398938-142398960 CAGAATCAGAAGTGGAGACAGGG - Intergenic
1033548492 7:142424005-142424027 CAGAATCAGAAGTGGAGACAGGG - Intergenic
1034039347 7:147860663-147860685 CAGAAGTAGAAGGGGAATCAAGG - Intronic
1035257525 7:157640792-157640814 AAGAAATAGAACTTGACCCTTGG + Intronic
1035606994 8:936257-936279 AAGAAAGAGAAGGGGACCCAAGG + Intergenic
1037062228 8:14528722-14528744 CAGAAATAGAAATTGGGCCAGGG - Intronic
1037776288 8:21838120-21838142 CATAAATAGAAGTGGATTCAGGG - Intergenic
1039674809 8:39650888-39650910 GAGAAAGAAAAGTGGACCCAGGG + Intronic
1041407442 8:57515707-57515729 CAGAAATCAAGGTGGTCCCAAGG + Intergenic
1042045014 8:64640924-64640946 CACAAATAGAAGTTGCCCTATGG - Intronic
1042477725 8:69267739-69267761 CAGTAATGGATGTGGAGCCATGG - Intergenic
1043079425 8:75747129-75747151 CAGAAACAAAAGTGGACAAATGG + Intergenic
1043279059 8:78439617-78439639 GAGAAAGAGAAGTGGGCCCAGGG - Intergenic
1044632485 8:94292857-94292879 CAGAACTAGAACTGGACTCCAGG - Intergenic
1050385165 9:5082129-5082151 GAGAAAGAAAAGTGGGCCCAGGG + Intronic
1050522179 9:6512287-6512309 CAGAAATAAAAGTGAATTCACGG - Intergenic
1051062671 9:13062824-13062846 CAGTAATAGAAGTGAAGGCATGG - Intergenic
1053216803 9:36278369-36278391 CAGATAAAGGAGTGGATCCATGG + Intronic
1055540828 9:77303517-77303539 GAGAAACAACAGTGGACCCAGGG + Intronic
1055776029 9:79768044-79768066 CAGAAATAGATGAGGCCCCAGGG + Intergenic
1056880655 9:90389436-90389458 CATAAATAGAAATGCACTCAAGG + Intergenic
1057403223 9:94743015-94743037 CAGAAAGAGAAGAGGGCCCACGG + Intronic
1057664882 9:97037689-97037711 CAGAAATGGAAGAGAAACCATGG + Intronic
1057685776 9:97232992-97233014 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1057718556 9:97514781-97514803 CTGAATTAGAAGTGGACGAAAGG + Intronic
1058070383 9:100595579-100595601 CTGAATAAGAAGGGGACCCATGG + Intergenic
1058106535 9:100978229-100978251 CAGAACTAGAAGTAGAACCTGGG + Intergenic
1059042214 9:110827101-110827123 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1060026709 9:120178130-120178152 CAGAAATACCATTTGACCCAGGG - Intergenic
1060518724 9:124281956-124281978 CAGACACAGAAGTGGAGCCCGGG + Intronic
1061829788 9:133284277-133284299 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1062407361 9:136403279-136403301 GAGAAACAGAAGGGGTCCCAGGG + Intronic
1062661570 9:137637972-137637994 CAGAAATAAAAATGGTCACAGGG - Intronic
1203749129 Un_GL000218v1:62523-62545 CAGACTTAGAATTTGACCCAAGG + Intergenic
1203377732 Un_KI270442v1:390460-390482 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1203543493 Un_KI270743v1:110938-110960 CAGATTTAGAATTTGACCCAAGG - Intergenic
1186498243 X:10029650-10029672 CAGAAGCAGAAGTGGAATCATGG - Intronic
1187385711 X:18846583-18846605 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1188039080 X:25350947-25350969 CAGACCTAGACCTGGACCCAAGG - Intergenic
1188766167 X:34094518-34094540 AAGAAATTGAAGAGGACACAAGG + Intergenic
1189595608 X:42562324-42562346 CAGATATAGAAGTAAAGCCATGG + Intergenic
1189918571 X:45881242-45881264 TATAAAAAGAAGTGGACCAAAGG + Intergenic
1190527334 X:51341485-51341507 CTGATAAAGAACTGGACCCAAGG - Intergenic
1191227942 X:58065416-58065438 GAGAAAGAAAAGTGGGCCCAAGG + Intergenic
1193761387 X:85470731-85470753 AAGAAATTGAAGAGGACACAAGG - Intergenic
1193851230 X:86539265-86539287 CAGAAAGTGAAGGGGAACCAAGG - Intronic
1197014569 X:121608026-121608048 CATAAATAAAAGTGAACCAAAGG - Intergenic
1197313483 X:124935156-124935178 CAGAAAGGGAATTGGACTCAGGG - Intronic
1198007466 X:132511440-132511462 CAGAAACAGAAATGGACAAATGG + Intergenic
1198170160 X:134097443-134097465 CAGAAAAAGAAGTGCAACAATGG + Intergenic
1198268265 X:135031197-135031219 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic
1198595280 X:138229323-138229345 CAGAGCTAGAACTGGAGCCAAGG - Intergenic
1199565534 X:149211874-149211896 CTGCAAGAGAAGTGGCCCCAAGG + Intergenic
1201162486 Y:11177536-11177558 CAGACTTAGAATTTGACCCAAGG + Intergenic
1202342069 Y:23880460-23880482 GAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1202528700 Y:25789625-25789647 GAGAAAGAAAAGTGGGCCCAGGG - Intergenic