ID: 1033445365

View in Genome Browser
Species Human (GRCh38)
Location 7:141416820-141416842
Sequence CTCGTTATGTACTCTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033445365_1033445366 14 Left 1033445365 7:141416820-141416842 CCAGACACAGAGTACATAACGAG 0: 1
1: 0
2: 0
3: 3
4: 107
Right 1033445366 7:141416857-141416879 AAGACCCAACAGCAAAACACCGG 0: 1
1: 0
2: 3
3: 20
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033445365 Original CRISPR CTCGTTATGTACTCTGTGTC TGG (reversed) Intronic
902929699 1:19722399-19722421 CTCAGTATGTACTATGTGCCAGG + Intronic
904087261 1:27917648-27917670 ATTGGTATGTACTCTGTGTGTGG + Intergenic
906632588 1:47384921-47384943 TTATTTATCTACTCTGTGTCAGG - Intergenic
906779500 1:48559894-48559916 CTCATTGTTTACTGTGTGTCAGG - Intronic
907966062 1:59331026-59331048 CAGGATATGTTCTCTGTGTCTGG + Intronic
908187544 1:61667081-61667103 CTCATCACCTACTCTGTGTCGGG - Intergenic
908968573 1:69796864-69796886 CTCCTTATGTATACAGTGTCAGG - Intronic
913082193 1:115399037-115399059 CTGGGTACCTACTCTGTGTCAGG + Intergenic
915792093 1:158683596-158683618 CTCTTTATGGCCTCTGAGTCTGG - Intronic
917159306 1:172039808-172039830 CTCTTCATGCACTCAGTGTCTGG + Intronic
917431790 1:174976922-174976944 CTCATAATCTAATCTGTGTCAGG - Intronic
921424377 1:214985028-214985050 CCCATTATGGACTCTGTGTGGGG - Intergenic
923271046 1:232355272-232355294 CTAGTCATGTGCTCAGTGTCTGG - Intergenic
923469294 1:234276603-234276625 CCCGTTATGTCTTCTGTCTCAGG - Intronic
924925358 1:248675052-248675074 ATAGGTATGTATTCTGTGTCTGG - Intergenic
924925377 1:248675295-248675317 ATAGGTATGTATTCTGTGTCTGG - Intergenic
924925387 1:248675415-248675437 ATAGGTATGTATTCTGTGTCTGG - Intergenic
924925399 1:248675535-248675557 ATAGGTATGTATTCTGTGTCTGG - Intergenic
924925405 1:248675595-248675617 ATAGGTATGTATTCTGTGTCTGG - Intergenic
924925423 1:248675775-248675797 ATAGGTATGTATTCTGTGTCTGG - Intergenic
924925443 1:248676018-248676040 ATAGGTATGTATTCTGTGTCTGG - Intergenic
924925454 1:248676141-248676163 ATAGGTATGTATTCTGTGTCTGG - Intergenic
1065045887 10:21747445-21747467 CTCCTTAGGAACTCTGAGTCGGG - Intergenic
1068092805 10:52453957-52453979 CTTGTTCTGTGCACTGTGTCGGG - Intergenic
1078603828 11:12757551-12757573 TTCGTTATTTACACTGTGCCTGG + Intronic
1079181927 11:18201401-18201423 CCCAATAGGTACTCTGTGTCGGG + Intronic
1079673619 11:23198861-23198883 CTCAGTAGGTACTCTGTGTGGGG + Intergenic
1081301856 11:41462257-41462279 CTTGATTTGTACTATGTGTCTGG + Intergenic
1082224017 11:49679443-49679465 TTCGTTATGTACTAAATGTCAGG + Intergenic
1091442193 12:519947-519969 CTTGTTATGTCCTCTGTGTAGGG + Intronic
1093807020 12:23446821-23446843 GTCCTTATGTATTCTGTGTGAGG - Intergenic
1094670750 12:32566483-32566505 CTGGTTATGTACTATGTGAGCGG - Intronic
1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG + Intergenic
1098343042 12:69470853-69470875 CTAGTTTGGTATTCTGTGTCCGG + Intronic
1099037726 12:77610346-77610368 ATCTTTATGTCCTCTTTGTCAGG + Intergenic
1107685123 13:42889473-42889495 CTCCTTGTTTACTCTGTCTCTGG + Intronic
1108773500 13:53734310-53734332 CTCATTTTGTCCTCTGTATCTGG + Intergenic
1111634594 13:90887708-90887730 CACATCATGTTCTCTGTGTCAGG - Intergenic
1112190451 13:97172188-97172210 CTCCTTAAGCACTCTGTGGCTGG - Intergenic
1115369109 14:32592191-32592213 CTAGTTATGTGCTGTGTGCCAGG + Intronic
1116409721 14:44607169-44607191 TTACATATGTACTCTGTGTCTGG + Intergenic
1118581754 14:67307491-67307513 ATGATTATGTACTCTGTGCCAGG + Intronic
1122724863 14:103743780-103743802 CTCGTCATGTGCTATGAGTCCGG - Intronic
1125195369 15:37040301-37040323 CTGGTTATGTGTTCTGAGTCAGG - Intronic
1130977964 15:88791834-88791856 CTCTTTGTGTGCCCTGTGTCTGG - Intergenic
1138813070 16:60173468-60173490 CTAGTCATGTACTTTGTGACAGG + Intergenic
1139120350 16:64009017-64009039 TTCGTTATTTACACTGTGCCAGG + Intergenic
1140342711 16:74180843-74180865 CTTGTTATGTAAACTGTGCCAGG + Intergenic
1156350957 18:36300426-36300448 CTGACTATGCACTCTGTGTCAGG - Intronic
1161011810 19:1963081-1963103 CACGGCATGTCCTCTGTGTCTGG - Intronic
925013924 2:507594-507616 CTCCTTCTGTTCTCTGTTTCTGG - Intergenic
926333311 2:11843888-11843910 TTGGATATGTACTCTGTGTCAGG - Intergenic
926624512 2:15079856-15079878 TTAGTTATGTACTCTGTGCCTGG - Intergenic
930287794 2:49454495-49454517 CCTGGTATATACTCTGTGTCAGG + Intergenic
930607856 2:53510896-53510918 CTCGTTTTGTATTATGTGTTTGG - Intergenic
933321723 2:80783639-80783661 CTCAATATCTGCTCTGTGTCTGG + Intergenic
933573096 2:84036409-84036431 ATCTTTATTTACTTTGTGTCAGG + Intergenic
935082625 2:99813489-99813511 CTTGTTATGTACTCCAGGTCAGG - Intronic
947163872 2:227241761-227241783 CTGCATATGTACTCTGTGCCAGG + Intronic
1169090744 20:2860107-2860129 CTCGATATATACTCTGCTTCCGG + Exonic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1173155562 20:40605730-40605752 CTGGTTATGCACTGTGGGTCCGG + Intergenic
1174558119 20:51411036-51411058 CTGGGTATTTACTCTGTGCCAGG + Intronic
1177521328 21:22231040-22231062 CTAGTTATGTCATCTGTGTGTGG + Intergenic
1179431052 21:41321459-41321481 CTCATTTTGTTTTCTGTGTCTGG + Intronic
1180152699 21:45959821-45959843 CTCAGGATGGACTCTGTGTCTGG - Intergenic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
949170186 3:987763-987785 CTAGTTATGTATTCTGGCTCTGG + Intergenic
956643924 3:71438182-71438204 CTCTTTAAGAACACTGTGTCTGG + Intronic
961072883 3:123952647-123952669 CTCCTTATGTACTTTCTATCTGG - Intronic
962191487 3:133315525-133315547 CTCTTTATGGAATCTGTGTTTGG - Intronic
970008839 4:11436454-11436476 TTCAGTGTGTACTCTGTGTCAGG - Intergenic
981041548 4:140227504-140227526 CTATTTATTTACTCTGTGTTTGG + Intergenic
981170478 4:141616932-141616954 TTCGTGATGTTCTCTCTGTCAGG + Intergenic
981392400 4:144206670-144206692 CTGGTTCTGTTCTCTGTGGCTGG - Intergenic
989215909 5:38904404-38904426 CGCGCCATGTACTCTGTGGCAGG - Exonic
991273260 5:64812053-64812075 CTCTTACTGTACTTTGTGTCTGG + Intronic
994088518 5:95786351-95786373 CCAGTTTTGTACTGTGTGTCAGG + Intronic
997838049 5:137212501-137212523 CTGAATATGTACTATGTGTCAGG + Intronic
998918356 5:147040680-147040702 CTTGTTAGGTACTCCGTGTGAGG + Intronic
1007517558 6:42425417-42425439 CCCTTTATGTGCTCTGTGACTGG - Intronic
1009952782 6:70415355-70415377 TTCCTTATGTTGTCTGTGTCAGG + Exonic
1013033492 6:106359095-106359117 CACAATATGTACTCTGTTTCTGG - Intergenic
1013313032 6:108915340-108915362 CTCGTCATGTTCTCTCTGGCTGG - Intronic
1014010357 6:116468665-116468687 CTAGTTATTTACTTTTTGTCAGG + Intergenic
1015704887 6:136077024-136077046 CTTCTTATGTACCCTGTGCCAGG + Intronic
1016555322 6:145329820-145329842 CTCTTTTTGTACTCTGATTCAGG - Intergenic
1019096992 6:169590184-169590206 CACGTTAGGTACTCTGTGAAAGG - Intronic
1022283373 7:28932803-28932825 CACGTAATGTACTCTGTGCTGGG + Intergenic
1022909123 7:34883053-34883075 CTCAGTAGGTACTCTGTGTAGGG + Intergenic
1022995429 7:35750383-35750405 CTTGTTACTTACTCTGTGTGAGG + Intergenic
1024496092 7:50047448-50047470 TTGTATATGTACTCTGTGTCTGG - Intronic
1031807920 7:126329476-126329498 CCCAGTATGGACTCTGTGTCGGG - Intergenic
1032940405 7:136782139-136782161 GTGAGTATGTACTCTGTGTCAGG - Intergenic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1036910061 8:12750920-12750942 CTGGGCATTTACTCTGTGTCAGG + Intronic
1041119820 8:54574782-54574804 CTAGTTCTGTAATCTGTGTTGGG + Intergenic
1043776886 8:84280581-84280603 ATGGTGATGTACTCTGTGTGTGG - Intronic
1047515606 8:125552242-125552264 TTTGTTATTTACTATGTGTCAGG + Intergenic
1048576595 8:135695227-135695249 ATTGTTATATACTCTGTGTATGG - Intergenic
1050057221 9:1668219-1668241 CTGAGTATCTACTCTGTGTCAGG - Intergenic
1050116584 9:2269746-2269768 TTCGGTATCTACTCTGTCTCTGG - Intergenic
1050231578 9:3530985-3531007 TATGCTATGTACTCTGTGTCTGG - Intergenic
1052853719 9:33393976-33393998 CTCTTTCTGTACACTGTCTCTGG + Intronic
1056801957 9:89698591-89698613 CTCCTTCTCTCCTCTGTGTCCGG + Intergenic
1185593443 X:1293539-1293561 CTCTTTGTCTACTCTGTGTAGGG - Intronic
1186307962 X:8285131-8285153 CCAGTCATGAACTCTGTGTCTGG + Intergenic
1187199627 X:17122305-17122327 TGCGGTATATACTCTGTGTCTGG + Intronic
1188963620 X:36523877-36523899 ATCATTATATACTGTGTGTCAGG - Intergenic
1190287214 X:48969694-48969716 CTCGTTTTCTACTATGTGACCGG - Exonic
1192046314 X:67677741-67677763 CTCATTGTGTAATCTGAGTCAGG + Intronic