ID: 1033446104

View in Genome Browser
Species Human (GRCh38)
Location 7:141423533-141423555
Sequence TAGAATATGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1292
Summary {0: 1, 1: 0, 2: 8, 3: 157, 4: 1126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033446097_1033446104 17 Left 1033446097 7:141423493-141423515 CCACATGAGCTGGTGGCTACCAT 0: 1
1: 0
2: 4
3: 23
4: 176
Right 1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG 0: 1
1: 0
2: 8
3: 157
4: 1126
1033446096_1033446104 18 Left 1033446096 7:141423492-141423514 CCCACATGAGCTGGTGGCTACCA 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG 0: 1
1: 0
2: 8
3: 157
4: 1126
1033446098_1033446104 -2 Left 1033446098 7:141423512-141423534 CCATATTAGACTCTTCAGCTTTA 0: 1
1: 0
2: 0
3: 18
4: 203
Right 1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG 0: 1
1: 0
2: 8
3: 157
4: 1126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033446104 Original CRISPR TAGAATATGGAGGAGGAGGA GGG Intronic
900030102 1:365016-365038 TGGAAAGAGGAGGAGGAGGACGG - Intergenic
900050754 1:594080-594102 TGGAAAGAGGAGGAGGAGGACGG - Intergenic
900074960 1:806753-806775 TCAAATATGGAGGATGAAGATGG - Intergenic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900849431 1:5130644-5130666 GGGAATATGGGAGAGGAGGATGG + Intergenic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901236445 1:7669961-7669983 CAGAAAGTGGAGGAGGAGGGTGG - Intronic
901409493 1:9072236-9072258 TCAAAGATGGAGGAGGGGGATGG + Intronic
901644011 1:10706958-10706980 GAGAGGATGGAGGAGGAGGCCGG + Intronic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
901784505 1:11615900-11615922 TAAAATATGGATGATGATGATGG - Intergenic
902165799 1:14570384-14570406 AGGAATTGGGAGGAGGAGGAGGG - Intergenic
902444210 1:16451835-16451857 TAGAACATGAAGAAGAAGGAAGG + Exonic
902970202 1:20042886-20042908 TAGATGTTGGAGGAGCAGGAGGG + Intronic
903389922 1:22956389-22956411 GAGAAAGAGGAGGAGGAGGAAGG + Intronic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
903841200 1:26242151-26242173 TAGGGTATGGAGTAGGTGGATGG + Intronic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
903954916 1:27018748-27018770 AAAATTATGTAGGAGGAGGAGGG - Intergenic
903989200 1:27253438-27253460 GAGAAGAGGAAGGAGGAGGAAGG - Intronic
904087181 1:27917090-27917112 AAGAAGCAGGAGGAGGAGGAGGG - Intergenic
904440255 1:30525332-30525354 AAGAAGAAAGAGGAGGAGGAGGG + Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904949672 1:34226381-34226403 TAGAGGCTGGAGGAGGAAGAAGG - Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905052657 1:35065208-35065230 TAGGTTGTGGAGGAGGAGGAAGG - Intronic
906024171 1:42658717-42658739 TAGACTAGGGAGGCGGAGGTGGG + Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906378910 1:45319060-45319082 TAGATGTTGGAGGAGCAGGAGGG - Intergenic
906415360 1:45617574-45617596 GAAAACATGGAGGAGGAGGTGGG + Exonic
906505114 1:46373255-46373277 AAGAATTTGGAGGAGCAGGTTGG - Intergenic
907273829 1:53306010-53306032 TAGAATAGAGAAGGGGAGGAGGG - Intronic
907488078 1:54790841-54790863 AAGAAGGAGGAGGAGGAGGACGG - Intronic
907704993 1:56825296-56825318 TGGCATGTGGAAGAGGAGGAGGG + Intergenic
907758853 1:57337968-57337990 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
907874965 1:58476870-58476892 CAGTACATGGAGGAAGAGGACGG + Intronic
907896146 1:58693959-58693981 TAGAATATGGTGGGAAAGGAAGG - Intronic
908028562 1:59975857-59975879 CAGAATATAGAAGAGGAAGAAGG - Intergenic
908450009 1:64244706-64244728 GAGAATATGGAGAGAGAGGATGG - Intronic
908698155 1:66868509-66868531 TAGAATTAGAAGGTGGAGGAAGG + Intronic
909142555 1:71887229-71887251 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
909415252 1:75399088-75399110 TAGGAGATGGAGGTGGAGGAGGG + Intronic
909944754 1:81650900-81650922 TAGAAAATGGAGGTGGGGGCAGG - Intronic
910080062 1:83330987-83331009 AAGAACTTGGAGGAGGAGAATGG - Intergenic
911701054 1:100952024-100952046 TTGAAGATGGAGGAAGAGGCCGG + Intronic
911724873 1:101232736-101232758 TAAAAGATGGAGGTGGTGGATGG + Intergenic
911729322 1:101276554-101276576 GAGAAGGTGGAGGAGGTGGAAGG - Intergenic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912257971 1:108080524-108080546 GAAAAGATGGAGGAGAAGGATGG - Intergenic
913245905 1:116869735-116869757 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
913672129 1:121106970-121106992 TAGAATAATGAGCAGGAGAAAGG - Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
913971417 1:143420824-143420846 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
914023893 1:143894327-143894349 TAGAATAATGAGCAGGAGAAAGG - Intergenic
914058053 1:144183179-144183201 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
914065794 1:144246437-144246459 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
914113357 1:144719917-144719939 CAGAGTATTGAGGAGGTGGAGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914505732 1:148287597-148287619 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
914662383 1:149802366-149802388 TAGAATAATGAGCAGGAGAAAGG - Intronic
914857275 1:151361980-151362002 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
915034540 1:152910947-152910969 AAGCACCTGGAGGAGGAGGAGGG + Exonic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915246392 1:154558756-154558778 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
915264169 1:154703670-154703692 TGCACTCTGGAGGAGGAGGAAGG + Exonic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915316729 1:155033027-155033049 TAGAACATGCAGGATGAGGGGGG + Intronic
915493642 1:156266038-156266060 GAAGATATGGAGGAAGAGGAGGG - Exonic
915537128 1:156543549-156543571 GGGAATATGGAGCAGGAAGATGG + Intronic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915770972 1:158423184-158423206 AATAAGATAGAGGAGGAGGAGGG - Intergenic
915824779 1:159063868-159063890 TAGACTGAGGAGGAAGAGGAGGG - Intronic
915866980 1:159512363-159512385 AAAAATAGGGAGGAGGAAGAGGG - Intergenic
916024734 1:160823819-160823841 TAGACATGGGAGGAGGAGGAAGG - Intronic
916268333 1:162914912-162914934 TAGAAGATGTTGGAGGAGGATGG + Intergenic
917247661 1:173022229-173022251 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918076838 1:181177003-181177025 GTGAATATGGAGGTGGAGGTGGG + Intergenic
918112463 1:181469179-181469201 TAGAACCTGGAAGAGGAAGATGG + Intronic
918126030 1:181584773-181584795 TATAATGTGGAGGAGGTGGTAGG - Intronic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918634914 1:186764230-186764252 TAGGATAGGGAGGTGGAAGATGG - Intergenic
919449334 1:197751867-197751889 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
919449350 1:197751936-197751958 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919664627 1:200280018-200280040 TGGAATATGGGAGAGGAGGGTGG + Intergenic
919759361 1:201087681-201087703 GAGAGAAGGGAGGAGGAGGAAGG - Intronic
919811032 1:201408965-201408987 TAACAAGTGGAGGAGGAGGAGGG - Exonic
920145102 1:203853553-203853575 TATAATCAGGAGGAAGAGGAAGG + Exonic
920176056 1:204102616-204102638 GAGCAGATGGAGGAGGAAGAGGG + Intronic
920281077 1:204844101-204844123 TAGAATATGGAGCAAGAGCCAGG + Intronic
920658057 1:207891042-207891064 GAGAGTCTGGATGAGGAGGAGGG + Intronic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
921037530 1:211396085-211396107 TAGAAAATGGAAAAGGAGGACGG - Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921396866 1:214677825-214677847 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
921820198 1:219608452-219608474 TATAATCAGGAGGAAGAGGAAGG - Intergenic
922270801 1:224031652-224031674 TCAAATATGGAGGATGAAGATGG - Intergenic
922867873 1:228875940-228875962 AATAATAAGGAGGAGGAGGGAGG - Intergenic
922998447 1:229985404-229985426 TTGAACATGGTGGAGGGGGAGGG - Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923517732 1:234711607-234711629 GGGAAGAAGGAGGAGGAGGATGG - Intergenic
923766913 1:236901052-236901074 GAGAATCTGGAGGAGGAGGAGGG + Exonic
923787861 1:237085477-237085499 TGGAAGCTGGAGGAGGAGAAGGG + Intronic
923871448 1:237998557-237998579 TTAGATATGGAGGAGGAAGATGG - Intergenic
924078672 1:240369143-240369165 TAGAAAAGGCAGGAGGTGGAGGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924608680 1:245556345-245556367 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
924793660 1:247276369-247276391 TAGAATAGAGAGGAGTAGAATGG + Intergenic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1062961602 10:1576798-1576820 TTGAAGGTGGAGGATGAGGAGGG + Intronic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063376282 10:5556521-5556543 TTGAATTTGGAGGGGGAGGCAGG - Intergenic
1063538129 10:6905386-6905408 TGGAATATGCAGGAGGAAGAAGG - Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063832982 10:9977886-9977908 TAGACACTGGAGAAGGAGGAAGG + Intergenic
1064346438 10:14536984-14537006 TAGAAAATGGCAGAGGAGGAGGG + Intronic
1064497597 10:15929875-15929897 TACATTCTGGAGGAGGAAGATGG + Intergenic
1064581116 10:16794002-16794024 TAGAATAAGAAGGCAGAGGAAGG + Intronic
1064898760 10:20270471-20270493 TTGAATATGTAGGATGAAGAAGG + Intronic
1065253316 10:23839003-23839025 AAGAATATGGAGGAAAAGAATGG - Intronic
1065667871 10:28082456-28082478 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1066306609 10:34150394-34150416 TAGAATATGGAGAAGAGGGCTGG + Intronic
1068460898 10:57327045-57327067 TAAAAAAAGGAGGAGGAAGAAGG - Intergenic
1068929898 10:62578861-62578883 AAGAATATGCAGGAGCAGGATGG + Intronic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1069595101 10:69665199-69665221 TAGAGGCTGGAGGAGGAGGAGGG + Intergenic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069971646 10:72175934-72175956 TACAAAATGGAGGGGAAGGAAGG - Intronic
1070326122 10:75390395-75390417 GAGAAAAAGGAAGAGGAGGAGGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070500406 10:77067237-77067259 TAGAATAAAAAGGAGGAGTAAGG + Intronic
1070568200 10:77619896-77619918 TGGAGGATGGAGGAGGTGGAGGG + Intronic
1071092936 10:81941212-81941234 GAGAATATGAAGTAGGAAGATGG + Intronic
1071388925 10:85150379-85150401 TAGGAAAAAGAGGAGGAGGAAGG - Intergenic
1071454975 10:85840212-85840234 TAAAAAATTGAGGAGGAGAAGGG + Intronic
1071501927 10:86210374-86210396 TAGAAAATGGAGGCTGAGAAAGG - Intronic
1071824164 10:89307889-89307911 TAGACTGGGAAGGAGGAGGAAGG - Exonic
1071933471 10:90499819-90499841 AAGAGTATGGAGTCGGAGGAGGG + Intergenic
1071988544 10:91076653-91076675 AAGACTATGGAGGAGGAATATGG - Intergenic
1072661431 10:97366116-97366138 AACAAGATGGAGGAAGAGGAAGG - Exonic
1073161369 10:101399278-101399300 AAAAAGATGGAGGAGGAGAAGGG + Intronic
1073197216 10:101702057-101702079 TACAATATGGAAAAGGGGGATGG + Intergenic
1073340915 10:102743990-102744012 GAGGAGAGGGAGGAGGAGGAGGG + Exonic
1073528055 10:104204656-104204678 GACTAAATGGAGGAGGAGGAGGG + Intronic
1073547871 10:104367756-104367778 GGGAATATTGAGGAGGTGGAGGG - Intronic
1073919273 10:108440563-108440585 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074412714 10:113242245-113242267 TGGCATGTGGAGGAGCAGGATGG + Intergenic
1074691141 10:116005100-116005122 GAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1074856099 10:117474664-117474686 TAGGAGATGGAGGATGGGGATGG + Intergenic
1075070298 10:119315872-119315894 ATGAATTTGGAGGGGGAGGAAGG - Intronic
1075207397 10:120458738-120458760 TAGAAAATAGAGTAGGAGAAGGG - Intronic
1075301719 10:121330659-121330681 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1075558798 10:123453107-123453129 TAGAAGATGGGGGAGGAGAAAGG - Intergenic
1075692841 10:124411219-124411241 TAGAATATGCAGGCGGCGGGGGG + Intronic
1075994972 10:126869862-126869884 GATATTCTGGAGGAGGAGGAAGG - Intergenic
1077392575 11:2306919-2306941 GAGGAGATGGAGGAGGGGGAAGG + Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1077998911 11:7477064-7477086 AAGAGATTGGAGGAGGAGGAAGG + Intergenic
1078077039 11:8171577-8171599 TAGAATTTGGTGGCGGAGGGCGG - Intergenic
1078502600 11:11896387-11896409 AGGAATTGGGAGGAGGAGGACGG + Intronic
1078836140 11:15031877-15031899 TAGGCTGAGGAGGAGGAGGAAGG - Intronic
1079410280 11:20181097-20181119 AGGAAGAGGGAGGAGGAGGAAGG - Intergenic
1079445555 11:20553592-20553614 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1079623940 11:22592851-22592873 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079742951 11:24086521-24086543 CAGTATCTGGAGGGGGAGGAGGG - Intergenic
1080073335 11:28115724-28115746 TAGACTGAGGAAGAGGAGGAGGG + Intronic
1080412702 11:32040897-32040919 TAGAAAAAGGAGGGTGAGGAGGG - Intronic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1080907539 11:36561628-36561650 TAGAACAAAAAGGAGGAGGAAGG + Intronic
1081717742 11:45262917-45262939 GGGAATAGTGAGGAGGAGGAAGG - Intronic
1081761829 11:45582038-45582060 GACAAAGTGGAGGAGGAGGATGG + Intergenic
1081906622 11:46674415-46674437 GAGAGGTTGGAGGAGGAGGAGGG - Intronic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082877952 11:58007289-58007311 TTGAATATGGAGGTGGAGTAGGG + Intergenic
1082952686 11:58834264-58834286 AAGAATACAGAGGAGAAGGAAGG + Exonic
1082968677 11:58995602-58995624 AAGAATACAGAGGAAGAGGAGGG + Intronic
1083153763 11:60810158-60810180 TATAATAGTGGGGAGGAGGAAGG + Intergenic
1083310325 11:61780560-61780582 TGGAACATGGGGTAGGAGGAAGG + Intronic
1083374453 11:62208323-62208345 TAGAAGGAGGAGGAGGAAGAAGG + Intergenic
1083573431 11:63772133-63772155 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1083589833 11:63887155-63887177 TAGCTTATGGAGGAGGAGCCAGG + Intronic
1083630122 11:64091036-64091058 AAGAAGACAGAGGAGGAGGAGGG + Intronic
1083960687 11:66013287-66013309 GGGAATATGGGGGAGAAGGAGGG - Intronic
1084370210 11:68736784-68736806 GAGAACAAAGAGGAGGAGGAGGG + Intronic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084932959 11:72571400-72571422 TGGAGTTTGGATGAGGAGGACGG - Intergenic
1085256609 11:75177116-75177138 CACCATAGGGAGGAGGAGGAGGG + Intronic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085871887 11:80359822-80359844 TAGGAGGTGGAGGAGGTGGAAGG + Intergenic
1085932753 11:81104803-81104825 TAGAAAATGGGGGAGGGGGGAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086167150 11:83791854-83791876 CACAAGCTGGAGGAGGAGGAAGG - Intronic
1086224359 11:84489780-84489802 TTGAATATGGATGATTAGGAAGG - Intronic
1086338968 11:85827559-85827581 TAGAATATGGAGGAGTTGGCAGG - Intergenic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1086898867 11:92343798-92343820 TATGATATGGTGTAGGAGGAAGG + Intergenic
1086990795 11:93302144-93302166 CAAAAAACGGAGGAGGAGGAGGG + Intergenic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087114886 11:94514104-94514126 TAGAATTTGAAGTAGGAGGCTGG - Intergenic
1087225155 11:95591060-95591082 GAGGATGTGGAGGAGGATGAGGG + Intergenic
1087496451 11:98896022-98896044 GAAAATTTGGAGGAGGAGGAAGG + Intergenic
1087672848 11:101127893-101127915 AAGATAAAGGAGGAGGAGGAAGG - Exonic
1088494366 11:110418694-110418716 TTGAACATGCAGGAGAAGGAGGG - Intergenic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG + Intronic
1089142575 11:116298519-116298541 TAGAGTATGGAGGGGAAAGAGGG - Intergenic
1089344426 11:117781720-117781742 TGGAAAATGGAGGGAGAGGATGG + Intronic
1089627312 11:119759619-119759641 GAGAAAATGGAGCAGGAAGAAGG + Intergenic
1089836194 11:121372762-121372784 TGGAACATGCAGGAGAAGGAGGG + Intergenic
1090213932 11:124943574-124943596 TGGGATGTGGAAGAGGAGGAAGG + Intergenic
1090618780 11:128542365-128542387 GAGAAGAGGGAGGAAGAGGAGGG + Intronic
1091074195 11:132599423-132599445 AAGAAGGTGGAGGAGAAGGAAGG + Intronic
1091296417 11:134477008-134477030 TAGGACAGAGAGGAGGAGGAGGG + Intergenic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091438529 12:494497-494519 TAGAAAATGGAGGAAGAGGGAGG - Intronic
1091596542 12:1882566-1882588 AGGACTGTGGAGGAGGAGGAAGG + Intronic
1091603184 12:1930082-1930104 GAGGAGGTGGAGGAGGAGGAAGG + Intergenic
1091632810 12:2174956-2174978 TAGGAAGAGGAGGAGGAGGAGGG + Intronic
1091882044 12:3987513-3987535 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091996304 12:4996785-4996807 GAGAAAAGGGAGGAGGAAGAGGG + Intergenic
1092216628 12:6688534-6688556 TTAGAGATGGAGGAGGAGGAGGG + Intronic
1092276824 12:7067754-7067776 TGGAAAATGGAGGAGGTGGTAGG + Exonic
1092454442 12:8630171-8630193 AGAAATATGGAGCAGGAGGATGG - Intergenic
1092662193 12:10750495-10750517 TTGAAAATTGGGGAGGAGGAAGG - Intergenic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093457072 12:19374985-19375007 GAGAAGGAGGAGGAGGAGGAAGG + Intronic
1093469325 12:19483610-19483632 TACAATCGGGAGGAGGAAGATGG - Intronic
1093588821 12:20874297-20874319 TATAATACTGAGGAGGAGAATGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094293419 12:28877273-28877295 AAGGAGATGGAGGAGAAGGAAGG - Intergenic
1095610009 12:44116775-44116797 TAGAATTTGTAGGATGAGGATGG - Intronic
1095854170 12:46842380-46842402 CATAGTGTGGAGGAGGAGGAGGG + Intergenic
1096017952 12:48295672-48295694 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096758748 12:53822222-53822244 AAGAAGAGGGAGGAGGAGGAGGG - Intergenic
1096933335 12:55241307-55241329 TAGAATTTGGAGGTGGAGCAGGG + Intergenic
1097285203 12:57871934-57871956 GAGAATATGAAGGAGGAGGTAGG - Intergenic
1097661794 12:62438118-62438140 AACAAGATGGAGGAAGAGGAGGG + Intergenic
1097938381 12:65278487-65278509 GAGAAGGAGGAGGAGGAGGACGG + Intergenic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098157089 12:67610314-67610336 TAGAAGCTGGGGGAAGAGGAAGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098281313 12:68865491-68865513 AAGAAGATGGAGAAGGATGAGGG - Intronic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098622175 12:72614984-72615006 TATAAATTGGAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098986200 12:77015020-77015042 TGGAAGCTGGGGGAGGAGGAGGG - Intergenic
1099133213 12:78862802-78862824 AAGAAGTTGGAGGAGGAGGAAGG - Intergenic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099496992 12:83360804-83360826 TAGAAGATGAAGGAGAAGCAAGG - Intergenic
1099924726 12:89003488-89003510 TAGAATTTGGGGGAGGAGGGTGG + Intergenic
1100056864 12:90522806-90522828 TTGAATATGGACGAGAAGGGAGG + Intergenic
1101302174 12:103494501-103494523 TAAAATAAAAAGGAGGAGGATGG + Intronic
1101403874 12:104411599-104411621 GAGATGATGCAGGAGGAGGAAGG - Intergenic
1101699019 12:107154181-107154203 TTGAATGTGGAGAATGAGGATGG - Intergenic
1101793922 12:107955676-107955698 TTGAATATGAGGGTGGAGGATGG + Intergenic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102230371 12:111257649-111257671 GGGAAGAGGGAGGAGGAGGAAGG - Intronic
1102321656 12:111941079-111941101 TAAAATATGGAAGAGTAGGCCGG + Intronic
1102749148 12:115277179-115277201 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102899329 12:116624143-116624165 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103235367 12:119368150-119368172 GAAAAGAAGGAGGAGGAGGAAGG + Intronic
1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG + Exonic
1103631845 12:122267829-122267851 TAGAAGATGCTGGAGGAGGCCGG - Intergenic
1103838197 12:123841000-123841022 TGGAACGTGGAGGAGGCGGAAGG - Intronic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1104954337 12:132457137-132457159 TCGAATGGGGAGGAGGAGGCAGG + Intergenic
1105567874 13:21569283-21569305 TAGACTATAGAGTAGCAGGAAGG - Intronic
1105836082 13:24213096-24213118 GAGAAGTTGGAGGAGGAAGATGG + Intronic
1106330204 13:28732882-28732904 TAGGATATAGATGAGGAGGAGGG - Intergenic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107436962 13:40388771-40388793 TAGAGTGTCAAGGAGGAGGACGG - Intergenic
1107618018 13:42192558-42192580 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1107879706 13:44822305-44822327 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1107980263 13:45728205-45728227 TGGAACATGGAGGAGCAGCAAGG + Intergenic
1108068942 13:46607624-46607646 AAGAAGAAGGAAGAGGAGGAAGG - Intronic
1108097058 13:46913643-46913665 TAGAAAATGGAGGAAGGAGATGG - Intergenic
1108410229 13:50138426-50138448 AAGAAGATGGATGAGGAGGAGGG + Intronic
1108850999 13:54728800-54728822 CAGAATGTGGAGGAAGAGCAAGG - Intergenic
1108993567 13:56695270-56695292 TAGAATATTGAGGAGGATTTAGG - Intergenic
1109756671 13:66770212-66770234 AAGAATAGGGAGGAGGGTGAGGG + Intronic
1110398527 13:75062625-75062647 GAGAAGAAGGAGGAGAAGGAAGG + Intergenic
1110504290 13:76267492-76267514 TAGAAGGAGAAGGAGGAGGAAGG + Intergenic
1111362787 13:87197081-87197103 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1111371712 13:87327899-87327921 TAGACCATCGAGGAGGAAGAAGG - Intergenic
1111716767 13:91888140-91888162 CAGAAGATGTAGGAGGAGCAAGG + Intronic
1112464196 13:99629391-99629413 TAAAACCTGGAGGAGGGGGAAGG - Intronic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113174664 13:107548598-107548620 TAGATTGTGGAGGGGGAGGAAGG - Intronic
1113321995 13:109243015-109243037 TAGAACACAGAGGAGGAGGAAGG + Intergenic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1114316465 14:21514355-21514377 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1114667846 14:24391019-24391041 CAAAAAGTGGAGGAGGAGGATGG + Intergenic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1115131140 14:30053384-30053406 TAGATTATGGAGGAGGTGGTGGG - Intronic
1115544437 14:34453006-34453028 AATCATAAGGAGGAGGAGGAGGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1115709964 14:36039769-36039791 TAGAAGAGTGAGGAGGAGAAAGG + Intergenic
1115834549 14:37385165-37385187 TAAAATATGGTGGAAGAGGGAGG + Intronic
1116050198 14:39793384-39793406 TAGAATAATCAGGAGGAGAACGG - Intergenic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1116434783 14:44884959-44884981 GAAAATATGGAGTAGAAGGATGG + Intergenic
1116820156 14:49620192-49620214 TGGAAAATGGAGGAGGTGGGTGG - Intronic
1117094343 14:52282300-52282322 TAGAACATGCAGGAGAAGGAGGG - Intergenic
1117125862 14:52625185-52625207 TAGAAAATAGAGGAGGGGGCTGG + Intronic
1117174348 14:53131799-53131821 TAGATGTTGGAGGAGCAGGAGGG - Intronic
1117316155 14:54572557-54572579 TGGCATATGCAGGAGAAGGAAGG + Intronic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1118606939 14:67511383-67511405 TAGAAGATGGAGCAGCCGGAAGG + Intronic
1118629288 14:67688067-67688089 TAGAATGTGGAGGCTGAGGCCGG - Intronic
1119649029 14:76370628-76370650 GAGAAAATGAAGGAGGAGAAGGG - Intronic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1119770195 14:77215820-77215842 TAGAAGAAGTAGGAGGAGGGGGG - Intronic
1119827155 14:77666767-77666789 TAAAATATGGGGGAAGAGAAGGG + Intergenic
1119961395 14:78860848-78860870 GAAGATATGGAGGAGGTGGAAGG + Intronic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1120059337 14:79963773-79963795 TTGGATTTGGAGGAGGAGGAGGG - Intergenic
1120880800 14:89413941-89413963 GAGAAGGGGGAGGAGGAGGAGGG + Intronic
1120890113 14:89484169-89484191 TAGAATAGGAAGGAGCAGAAGGG - Intronic
1120969682 14:90197024-90197046 TAGAATTAGGAGGAGAAAGAGGG - Intergenic
1121074976 14:91060418-91060440 GAGAAGATGGAGGAGGAGGGTGG - Exonic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121518303 14:94568557-94568579 TAGAAAATGGAGGAGGGGCCGGG + Intronic
1121735707 14:96216675-96216697 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121832763 14:97066124-97066146 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1121905201 14:97734800-97734822 TGGAAGAAGGAGGAGGAAGAAGG - Intergenic
1122410086 14:101521400-101521422 TAGAATCAGGAGGTGGGGGAGGG + Intergenic
1122451285 14:101810013-101810035 TCGAATATGGAGAAGGACCACGG - Intronic
1123166221 14:106327533-106327555 TAGGATATGGAGGAGGATTCTGG - Intergenic
1124186130 15:27531104-27531126 AGGATTGTGGAGGAGGAGGAGGG + Intronic
1124246177 15:28072291-28072313 TAGAATATAGTGGAGCAGGCCGG + Intronic
1124279454 15:28350543-28350565 GAGAAGATGGGGGAGCAGGAGGG - Intergenic
1124303244 15:28561065-28561087 GAGAAGATGGGGGAGCAGGAGGG + Intergenic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124992164 15:34685835-34685857 AATAATATGGAGAAGTAGGATGG + Intergenic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125333564 15:38605511-38605533 TAGAAAACAGAGGAGGAGAAAGG - Intergenic
1125420449 15:39499373-39499395 TGGAATATGGGGTTGGAGGAAGG - Intergenic
1125967860 15:43888649-43888671 TACAATATGAAGGAGCGGGAAGG - Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126194233 15:45913606-45913628 TAGACTATGGTGGGGGATGATGG + Intergenic
1126327616 15:47498285-47498307 TAGAATAGGAAGGAGGAATAAGG - Intronic
1126477917 15:49085897-49085919 TAGAAAATGGAGGAGGGGAGAGG + Intergenic
1126550808 15:49927315-49927337 CAGAAGAGGGAGGAGGAGAAAGG + Intronic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126794356 15:52247913-52247935 GAGAATGTGGAGTAGGAGGGAGG - Intronic
1126824584 15:52536497-52536519 GAGAATATGCAGGAGGAGGTGGG - Intergenic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127260631 15:57324054-57324076 GAGAAAAGGGAGGAGGAGAAAGG + Intergenic
1127576664 15:60298416-60298438 TGGAATATGGAGGGGAAGGAGGG + Intergenic
1128153704 15:65378388-65378410 TAAAATATGGACTTGGAGGAGGG - Intergenic
1128797760 15:70477834-70477856 GAGGAGATGGAGGAGGAGGAGGG + Intergenic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1130219639 15:82008454-82008476 TAGAATATGAAGGCAGAGGCTGG + Intergenic
1130559213 15:84945405-84945427 TAGGAAATGGGGGAGCAGGAAGG - Exonic
1130686123 15:86039400-86039422 TAAGATATGGAGGATGGGGATGG - Intergenic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131714086 15:95089717-95089739 TAGAAAAAGAAGGGGGAGGAGGG + Intergenic
1131852141 15:96554731-96554753 GAGGTGATGGAGGAGGAGGAGGG - Intergenic
1131901123 15:97088728-97088750 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131997195 15:98144162-98144184 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
1132028069 15:98419644-98419666 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
1132053776 15:98633961-98633983 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1132283389 15:100640591-100640613 TAGAAATTGGAGGTGGAGGGAGG - Intronic
1133392761 16:5422795-5422817 AAGAAAGAGGAGGAGGAGGAGGG + Intergenic
1133520183 16:6549264-6549286 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133520278 16:6549518-6549540 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133797778 16:9060175-9060197 TTAAATATGGAGAAGAAGGAAGG + Intergenic
1133892139 16:9890287-9890309 TTAATTATGGAGGAGGAGGGAGG + Intronic
1134649573 16:15898111-15898133 AAGAAGATGAAAGAGGAGGAGGG - Intergenic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1134748052 16:16602967-16602989 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1135774912 16:25249120-25249142 CAGAAGCTGGGGGAGGAGGAGGG + Intronic
1136162790 16:28431662-28431684 CAATTTATGGAGGAGGAGGAAGG - Intergenic
1136200176 16:28683326-28683348 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136216524 16:28797519-28797541 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136461092 16:30410566-30410588 TGGCACATGGAGGAGGAGGAAGG + Intronic
1136709573 16:32225378-32225400 TATTTGATGGAGGAGGAGGAGGG + Intergenic
1136758336 16:32704035-32704057 TATTTGATGGAGGAGGAGGAGGG - Intergenic
1136809772 16:33166340-33166362 TATTTGATGGAGGAGGAGGAGGG + Intergenic
1136816248 16:33276420-33276442 TATTTGATGGAGGAGGAGGAGGG + Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137555323 16:49466856-49466878 TAGAAGTTGCAAGAGGAGGAAGG + Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137869047 16:51931920-51931942 TAAATTATAGAGGAGGAGGGAGG + Intergenic
1138027267 16:53531764-53531786 TGGCAGATGCAGGAGGAGGAAGG - Intergenic
1138212921 16:55178351-55178373 TAGGATATGGCAGTGGAGGAAGG - Intergenic
1138586965 16:57976752-57976774 TAGATCATGGAGGAGCAGGGAGG - Intronic
1139072893 16:63404371-63404393 TAGAATAAAGACTAGGAGGAGGG - Intergenic
1139353458 16:66352633-66352655 TAGAATGTGGAAGAGGGAGACGG - Intergenic
1139431321 16:66912425-66912447 CCCAATCTGGAGGAGGAGGAGGG + Exonic
1139822627 16:69732392-69732414 TACAATAGAGAGGAGGAGGCCGG - Intergenic
1140345521 16:74209328-74209350 AAGAAAATGGAGGAAGAGGGAGG + Intergenic
1140357047 16:74315377-74315399 TAGAATAGGGAGGAGGGGGAAGG - Intergenic
1140530395 16:75660760-75660782 CAGAAGATGGGGGAGGATGAAGG + Intronic
1140536500 16:75714667-75714689 CAGAAGATGGGGGAGGATGAAGG + Intronic
1140622231 16:76749117-76749139 TGGAATTTGGGAGAGGAGGATGG - Intergenic
1140938840 16:79702013-79702035 TAGAATATGGCAGAGGTGAAAGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141007121 16:80363056-80363078 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1141157448 16:81607085-81607107 AAGAATGTTGAGGAGGAGGGTGG + Intronic
1141208083 16:81949473-81949495 TAGAATGTGGACTAGGAAGACGG + Intronic
1141359314 16:83380681-83380703 TAGAATATGGAGGTGAAGGCTGG - Intronic
1141703599 16:85653236-85653258 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1142254330 16:89006715-89006737 GAGGAGATGGAGGAGGAGGGAGG - Intergenic
1142254355 16:89006776-89006798 GAGGAGATGGAGGAGGAGGGAGG - Intergenic
1203060487 16_KI270728v1_random:964382-964404 TATTTGATGGAGGAGGAGGAGGG - Intergenic
1203141729 16_KI270728v1_random:1771501-1771523 GGGATGATGGAGGAGGAGGAGGG - Intergenic
1203141803 16_KI270728v1_random:1771761-1771783 GAGATGATAGAGGAGGAGGAGGG - Intergenic
1203141815 16_KI270728v1_random:1771813-1771835 GAGATGATGGAGGAGGAGGAGGG - Intergenic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142902434 17:3020399-3020421 TAGACCAGGGAGGAGGATGAGGG + Intronic
1143193781 17:5059804-5059826 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1143194405 17:5064546-5064568 TAAAATTTGGAGGAGGAGGCTGG - Intergenic
1143264202 17:5623561-5623583 TTGATTAGGGAGGAGGAGAACGG + Intergenic
1143316900 17:6039735-6039757 TGGAAGGTGGAGGAGCAGGAGGG + Intronic
1143729078 17:8870166-8870188 TGGCAGAAGGAGGAGGAGGAAGG - Intergenic
1143729158 17:8870692-8870714 AAGATTATGTAGGAGGATGAAGG + Intergenic
1143856984 17:9859380-9859402 TAGAATGTTAAGGAGGAGGCTGG + Intronic
1143980488 17:10865258-10865280 TTGAATGTGAAGGAAGAGGATGG - Intergenic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144188098 17:12815204-12815226 TAGAAGAGGGAGGAGAAGCAGGG + Intronic
1145094281 17:20010460-20010482 TTGAAGATGGGGGAGGAGGGAGG + Intronic
1145211642 17:21017627-21017649 TAGACCATGGAGGAAGAGGAAGG + Intronic
1145286891 17:21512541-21512563 TAGAATTTGGGAGAGGAGAAGGG + Intergenic
1145390178 17:22449533-22449555 CAAAATATGGATGAGGAGAAGGG + Intergenic
1145390727 17:22453799-22453821 TAGAATTTGGGAGAGGAGAAGGG - Intergenic
1145989861 17:29072812-29072834 TAGAAGGTAGAAGAGGAGGAGGG + Intergenic
1146023589 17:29299946-29299968 TAAAATATGGAGGATGAGGTAGG + Intergenic
1146370768 17:32264646-32264668 TAGAGTAGGGATGGGGAGGAGGG + Intergenic
1146496630 17:33328466-33328488 TAGAAGAGGGAAGAGGAGAATGG - Intronic
1146586720 17:34089171-34089193 AAATAAATGGAGGAGGAGGATGG - Intronic
1147303926 17:39550305-39550327 GAGAATAGCGAGGTGGAGGAAGG + Intronic
1147485499 17:40808670-40808692 TAGTATACGGAGGAGGAGCAGGG - Intergenic
1147498792 17:40942407-40942429 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1147537864 17:41332647-41332669 GAGAAGAGGGAGGTGGAGGAAGG + Intergenic
1147813313 17:43189564-43189586 TAGAATATGGAGCAGAAGGTAGG - Intronic
1147814908 17:43202215-43202237 TAGAGTATGCAGGAGGAGCATGG - Intronic
1148193795 17:45698895-45698917 AAGAATGAGGAGGAAGAGGAAGG + Intergenic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148271460 17:46265401-46265423 TAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1148511004 17:48169777-48169799 TAGATAATGGAGAAGGAGCAGGG + Intronic
1148662812 17:49349091-49349113 TAGTTTATGGCAGAGGAGGACGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148787448 17:50152225-50152247 TAGGAAAAGGAGGAAGAGGATGG - Intergenic
1149107109 17:52982657-52982679 AAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1149926358 17:60705958-60705980 GAGGAGATGGAGGAGGTGGAAGG - Intronic
1150550417 17:66204531-66204553 AAGAAGATGGAAGAGTAGGAAGG + Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151158791 17:72147189-72147211 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1151623428 17:75261571-75261593 TGCAATATGGCGGAGGCGGAAGG - Exonic
1151682036 17:75627378-75627400 TAGAATCTGGGGGAGGACGCGGG + Exonic
1151885164 17:76919219-76919241 TAAAATATCAAAGAGGAGGATGG - Intronic
1152949655 17:83221544-83221566 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1152979763 18:266018-266040 TAGAATTTGGATGAGCAGGTAGG - Intronic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153365092 18:4247072-4247094 TAGGACAAGGAGGAGAAGGAAGG + Intronic
1154050395 18:10950715-10950737 CAGAAGAGGGAAGAGGAGGAAGG - Intronic
1155066538 18:22273768-22273790 AGGAGGATGGAGGAGGAGGAGGG - Intergenic
1155066546 18:22273791-22273813 AGGAGGATGGAGGAGGAGGAGGG - Intergenic
1155111147 18:22715759-22715781 TGGAATATTGAGGAGGATGATGG - Intergenic
1155116379 18:22772463-22772485 TGGAAGATTGAGGAGGAGGTGGG + Intergenic
1155739669 18:29272531-29272553 TAGACTATAGAGGAAGAAGAGGG - Intergenic
1156482660 18:37445881-37445903 GATGATAAGGAGGAGGAGGATGG - Intronic
1157424313 18:47571835-47571857 TAGGATCTGGAGCAGGGGGAAGG + Intergenic
1157618744 18:49003258-49003280 GGGAAAATGGAGGAGGGGGAAGG - Intergenic
1157775350 18:50390682-50390704 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
1158367851 18:56759453-56759475 TAGGAGATGGAGGAGAAGAAAGG + Intronic
1158689254 18:59645652-59645674 TAGAATATGGGGGAGGGTGCTGG - Intronic
1158879948 18:61768511-61768533 TGGAAGATGAAGGAGGAGCAAGG - Intergenic
1158941922 18:62412496-62412518 TAGAAGAGGGAGGTGGAGGCTGG - Intergenic
1159198706 18:65153785-65153807 AAGAAGGAGGAGGAGGAGGATGG - Intergenic
1159517675 18:69478401-69478423 GAGAAAAAGGAGGAGAAGGAAGG - Intronic
1159693956 18:71529697-71529719 CAAAAAATTGAGGAGGAGGAGGG + Intergenic
1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG + Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160320036 18:77881978-77882000 GAGAAGATGGTGGACGAGGAAGG + Intergenic
1160448626 18:78946975-78946997 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1160480305 18:79233988-79234010 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
1160582871 18:79897628-79897650 GGGTATGTGGAGGAGGAGGAGGG - Intronic
1161185319 19:2914737-2914759 TAGAAGTTGGAGGGGCAGGAAGG - Intronic
1161358775 19:3834469-3834491 GTGACTATGAAGGAGGAGGAGGG - Intronic
1161370550 19:3908693-3908715 GAGAAAAGGGAGGAGGAGGGGGG - Intronic
1161370622 19:3908902-3908924 GAGGATGGGGAGGAGGAGGATGG - Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161712325 19:5855928-5855950 TAGATGTTGGAGGAGCAGGAGGG - Intergenic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162156574 19:8682237-8682259 TATGATCTGGAGGATGAGGATGG + Intergenic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162419927 19:10560312-10560334 GAGGAAATGGAGGAAGAGGAGGG - Exonic
1162458018 19:10797553-10797575 TAACACATGGAGGGGGAGGACGG - Intronic
1163171190 19:15532350-15532372 AAGAAGGTGGAGGAGGAGGAGGG - Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163827864 19:19533606-19533628 GAGAATGGGGAGGAGGAGGATGG - Intronic
1164081002 19:21861309-21861331 TAGATGTTGGAGGAGCAGGAGGG - Intergenic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164249610 19:23465629-23465651 TAGGAGGTGGAAGAGGAGGAGGG - Intergenic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164592167 19:29513051-29513073 TAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1164999919 19:32752519-32752541 TAATATATGGGGGAGGAGGGAGG - Intronic
1165100544 19:33436145-33436167 AGGAAGATGGAGGAAGAGGAAGG + Intronic
1165426737 19:35750090-35750112 TAGAGTAGGGAGGAGGTGGGTGG + Intronic
1165441948 19:35833525-35833547 AAGAAGATGGAGGTGGAGGAGGG + Intronic
1165690887 19:37862382-37862404 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1165714514 19:38035772-38035794 GATAATGAGGAGGAGGAGGATGG + Intronic
1165796585 19:38523475-38523497 GAGAAGATACAGGAGGAGGAAGG - Intronic
1165796601 19:38523551-38523573 GAGAAGATACAGGAGGAGGAAGG - Intronic
1165838225 19:38772025-38772047 TGGAACCTGGAAGAGGAGGATGG + Exonic
1165972306 19:39642186-39642208 TAGAACATGGTGGAAGTGGATGG - Intergenic
1166672445 19:44719004-44719026 GAGGAGGTGGAGGAGGAGGAGGG + Intergenic
1166801828 19:45462628-45462650 AATAATACAGAGGAGGAGGAGGG - Intronic
1166905575 19:46106255-46106277 TAGATGTTGGAGGAGCAGGAGGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167507242 19:49877380-49877402 TACAATATGGAGAAGGAAGTGGG + Exonic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1168251582 19:55145343-55145365 GAGGAAGTGGAGGAGGAGGAGGG + Intronic
925174367 2:1771841-1771863 TAGAATCTGCAGGAAGAGGGTGG + Intergenic
925496218 2:4452473-4452495 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
926316775 2:11715802-11715824 ATGAAAATGGAGGAGGAGGATGG + Intronic
926867515 2:17375945-17375967 TATATTTTGGAGGAGGAGGAAGG - Intergenic
926965769 2:18408896-18408918 TAGCAGATGGAGGAAGAGAATGG + Intergenic
927668228 2:25046899-25046921 TAGGATCTGGGGGAGGAGGCTGG - Intronic
927879400 2:26679986-26680008 GAGAAGCTGGAGGAGCAGGAGGG + Intergenic
928105803 2:28469991-28470013 GAGAAGAAAGAGGAGGAGGAGGG + Intronic
928358051 2:30638764-30638786 GAGAATGGGGAGGAGGAGCAGGG - Intronic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929361605 2:41098569-41098591 GAGAAAATGAATGAGGAGGAGGG - Intergenic
929618801 2:43334248-43334270 TGGAGTATGGATGAGGGGGATGG + Intronic
929804261 2:45130854-45130876 TACACTCTGGAGGAGGAGGAAGG + Intergenic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
930158400 2:48128497-48128519 GAGGAAATGGGGGAGGAGGAAGG + Intergenic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930798531 2:55419348-55419370 AGGCATCTGGAGGAGGAGGAAGG + Exonic
931335739 2:61341604-61341626 TAGAATGTGAAGGGGGAGCAGGG - Intronic
931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG + Intergenic
931970556 2:67581488-67581510 TGGAAGATGGAGGAGTTGGAAGG + Intergenic
932201923 2:69836182-69836204 TACATTATGGAGGACTAGGATGG - Intronic
932301091 2:70667388-70667410 TAGAGGCTGGAGGAGGAGGGGGG + Intronic
932669926 2:73728505-73728527 GTGAATGTGGAGGAGGAAGACGG + Intergenic
932889549 2:75580067-75580089 AATGATATGGAAGAGGAGGAAGG + Intergenic
932911242 2:75808116-75808138 TAGACTGTGGAGGGGCAGGAGGG + Intergenic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933197385 2:79407605-79407627 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933985570 2:87589380-87589402 TAGACTGTGAAGGAGGAAGAAGG - Intergenic
934176108 2:89581757-89581779 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
934286418 2:91656119-91656141 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
935098579 2:99970673-99970695 TAGGAAAGGGAGGAGAAGGAGGG - Intronic
935403400 2:102683696-102683718 GATAATAGGGAAGAGGAGGAAGG - Intronic
935531674 2:104240388-104240410 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
936272489 2:111059927-111059949 GAGAAGAAGGAGGAGGAAGAGGG + Intronic
936308273 2:111361420-111361442 TAGACTGTGAAGGAGGAAGAAGG + Intergenic
936388368 2:112050880-112050902 TCTAAGAAGGAGGAGGAGGAAGG - Intergenic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937594796 2:123660311-123660333 TAGATGTTGGAGGAGCAGGAAGG + Intergenic
938301968 2:130221755-130221777 TAGAACAAGAAGGTGGAGGAAGG + Intergenic
938454733 2:131452697-131452719 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
938626988 2:133121222-133121244 TAAAATATGAAGGAAAAGGAAGG + Intronic
938736594 2:134191669-134191691 GAGAAAGAGGAGGAGGAGGAGGG - Intronic
938917879 2:135962073-135962095 TAAAATATGAAGGACTAGGAAGG - Intronic
938999388 2:136716387-136716409 TAGAGTGAGGAGGATGAGGAGGG + Intergenic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939462299 2:142512876-142512898 TACACTATGGAGAAGGAAGAAGG + Intergenic
939554687 2:143660235-143660257 CAGAATGTGGAGGAGGAAGGAGG - Intronic
939966951 2:148619639-148619661 GGGAAAAAGGAGGAGGAGGAGGG - Intergenic
940055524 2:149508980-149509002 GAGAATATGAAGGAGGAGTAAGG + Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940253720 2:151707508-151707530 TACAAGTAGGAGGAGGAGGATGG + Intronic
940479281 2:154207235-154207257 TAGAACATGTAGCAGGAGGTAGG - Intronic
940567748 2:155389423-155389445 GTGAATATGTGGGAGGAGGAAGG + Intergenic
940912288 2:159219193-159219215 TGGAAAATGCAGCAGGAGGATGG + Intronic
941209857 2:162624400-162624422 TATAACATGGATTAGGAGGAAGG + Intronic
942062639 2:172241767-172241789 TAGAATATAGAGGAGGCAGCTGG - Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942306393 2:174611499-174611521 TGGTATCAGGAGGAGGAGGAGGG + Intronic
942418442 2:175782826-175782848 TAAAATGTGCAGGAGGAGGCCGG - Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942785134 2:179692392-179692414 TAGAGAATGGAGGAGTGGGAAGG - Intronic
942789924 2:179749367-179749389 TGGAGTTTGGAGGAGGTGGAAGG - Intronic
942800729 2:179872586-179872608 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
942904579 2:181165746-181165768 TAGAATGTGGTGGTGGAGGAGGG + Intergenic
943467248 2:188243385-188243407 TAACATATGGGTGAGGAGGATGG - Intergenic
943556207 2:189407322-189407344 AAGAATATGGGGGAGGTGGAGGG + Intergenic
944100378 2:196019943-196019965 AAGAAGAAGGGGGAGGAGGAGGG - Intronic
944205448 2:197153283-197153305 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
944315244 2:198277733-198277755 CAGGATCTGGAGCAGGAGGAGGG - Intronic
944900992 2:204215984-204216006 AAGAAGATGGAGGAGGTAGAAGG - Intergenic
945033633 2:205686218-205686240 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945676928 2:212866512-212866534 TATAATATGGCGGAAGATGAAGG + Intergenic
945757829 2:213871284-213871306 GAGAATATGGGGGGAGAGGAGGG + Intronic
946029982 2:216695820-216695842 GAGAATGGGGAGGAGGTGGAGGG + Intergenic
946442657 2:219710031-219710053 GAGAATATGGAGGGGAAGGTTGG - Intergenic
946724108 2:222644378-222644400 GAGAATGAAGAGGAGGAGGAAGG + Intronic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946883802 2:224202816-224202838 TACAACAGGTAGGAGGAGGAGGG + Intergenic
946902178 2:224383345-224383367 AGAAATATGGAGGAGGAGGTCGG - Intronic
947771080 2:232670522-232670544 TTGAATCTGGAGGAGGAGGGTGG + Intronic
947805633 2:232966146-232966168 GAGAATATGGAGCAAGAGGTAGG - Intronic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948011917 2:234655798-234655820 TAAAATCTGGAGTAGGAGGATGG - Intergenic
948309821 2:236976763-236976785 GAGAACAAGGAGGAGGGGGAAGG - Intergenic
948544988 2:238721267-238721289 TAGAAGATGGAGGAAGAACAGGG + Intergenic
948883564 2:240872158-240872180 GTGAACATGGAGGCGGAGGAGGG + Intronic
948883582 2:240872283-240872305 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883588 2:240872315-240872337 GTGAACATGGAGGAGGAGGAGGG + Intronic
948883607 2:240872440-240872462 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883613 2:240872472-240872494 GTGAACATGGAGGCGGAGGAGGG + Intronic
948939284 2:241188031-241188053 GAGAATGAGGACGAGGAGGAGGG + Intergenic
949082763 2:242118031-242118053 TCAAATATGGAGGATGAAGATGG + Intergenic
1168897024 20:1330845-1330867 TAGAAGAGGGAGGAGGAAGCAGG + Intronic
1169417853 20:5432967-5432989 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169855890 20:10102312-10102334 TAGGATGAGGAGGAAGAGGAGGG - Intergenic
1169954354 20:11084682-11084704 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1170306354 20:14942441-14942463 AAGAAAAAGGAGGAGGAGAAAGG - Intronic
1170487432 20:16833024-16833046 TAGAATATGACAGAGGTGGATGG - Intergenic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1170531875 20:17301317-17301339 AAGCAGCTGGAGGAGGAGGAGGG + Intronic
1170939013 20:20833309-20833331 GAGAATATGCAGGGGGAGGCGGG - Intergenic
1170978720 20:21190957-21190979 TGTAAGATGGAGGAGGAGGGAGG + Intronic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1171040319 20:21756829-21756851 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171161388 20:22927288-22927310 TAGGCTGAGGAGGAGGAGGAAGG - Intergenic
1172043035 20:32059460-32059482 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1172379667 20:34477839-34477861 TAGATTATGGAGGTGTAGCAAGG + Exonic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1173034338 20:39394359-39394381 GAAGATATGCAGGAGGAGGAGGG + Intergenic
1173056688 20:39621478-39621500 AAGAAGAAGGAGGAGGAAGAGGG - Intergenic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1173395963 20:42679969-42679991 TAGAACAAGGAAGAGGAGAAAGG + Intronic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1174173227 20:48629690-48629712 AAGGATATGGTGGGGGAGGAGGG - Intronic
1174230946 20:49045243-49045265 TAGGTTATGGATGGGGAGGAGGG + Intergenic
1174576468 20:51541443-51541465 TAGAGGGAGGAGGAGGAGGAGGG - Intronic
1174629280 20:51942448-51942470 TTGAACATGGAGGCGGAGGTTGG - Intergenic
1175100631 20:56576269-56576291 TAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1175298817 20:57928537-57928559 GAGAAAAGGGAGGAGGAAGAGGG - Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175317291 20:58057880-58057902 TAGAATATGGCTGTGGAGCAGGG - Intergenic
1175452092 20:59077925-59077947 GGGAAGAAGGAGGAGGAGGATGG + Intergenic
1175661420 20:60816262-60816284 AAGAAGAAGGAGGAGGAGCAAGG - Intergenic
1176272644 20:64244390-64244412 TAAAATATGGAGGTGGAGTGTGG + Intergenic
1177011222 21:15731774-15731796 TAGAATAGGGAGGATTAGGAAGG - Intronic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177121109 21:17138113-17138135 TACTAAAGGGAGGAGGAGGAAGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177798747 21:25806706-25806728 TAGAATAAAAAGGTGGAGGAAGG + Intergenic
1178165700 21:29973609-29973631 TAGACTATTGAGAAGGAGGAAGG - Intergenic
1178213149 21:30560665-30560687 AAGAATGACGAGGAGGAGGAGGG + Intronic
1178335631 21:31740178-31740200 TAGAAAATAGAGAAGGAGGTCGG - Intergenic
1178349881 21:31865018-31865040 AAGAAGAAGGAGGAGGAGAAGGG - Intergenic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178511574 21:33209565-33209587 GAAAATATGAAGGATGAGGAGGG + Intergenic
1178617785 21:34148390-34148412 TAGGATATGGAGGTGGGGAAGGG + Intergenic
1178626739 21:34224761-34224783 TAGGAGCTGGAGGAAGAGGAGGG + Intergenic
1178692726 21:34763127-34763149 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1179026534 21:37683453-37683475 GAGAAGACAGAGGAGGAGGAGGG - Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179893176 21:44347918-44347940 TAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1181508449 22:23377584-23377606 GAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1181554127 22:23657865-23657887 GAGGAGGTGGAGGAGGAGGAGGG - Intergenic
1181823469 22:25494157-25494179 TAGAAGCTGGATGAGGAGTAGGG - Intergenic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1181931335 22:26403936-26403958 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1182039249 22:27223706-27223728 TAGAATGTGGTGGAGAGGGATGG - Intergenic
1182085807 22:27560401-27560423 TAGAGTCTGGAGCAGGAGGCAGG - Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182561908 22:31166606-31166628 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1182923253 22:34099404-34099426 TAGAATGTGGAGGTGGGGGTAGG - Intergenic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183068105 22:35377592-35377614 TTGAAGATGGAGGATGAGGCTGG - Intergenic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183839429 22:40485803-40485825 TCTAAGATGGAGGAGGAGCAAGG + Intronic
1183868086 22:40720119-40720141 TAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1184291899 22:43501825-43501847 AAGATGAGGGAGGAGGAGGAGGG - Intronic
1184794516 22:46724047-46724069 GAGAAGACGGAGGAGGTGGAAGG - Intronic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1203238069 22_KI270732v1_random:26667-26689 AAAAAGATGGAGGAGGGGGAGGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949250100 3:1973200-1973222 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
949361376 3:3235603-3235625 TAGATTATGGAGGTGGAGTGTGG + Intergenic
949586366 3:5442457-5442479 TAGAAGATGGGGGTGGAGGTGGG - Intergenic
949639269 3:6016706-6016728 TAAAATATGGAGGACAAGGCTGG - Intergenic
949828812 3:8191807-8191829 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
950352470 3:12369940-12369962 GAGAAAATGCAGGAGGAAGAAGG - Intronic
950540125 3:13607428-13607450 TAGGAGGGGGAGGAGGAGGAGGG + Intronic
950575954 3:13832159-13832181 GAGGATCTTGAGGAGGAGGAGGG - Intronic
950704877 3:14773442-14773464 AAGAAGATGGAGGAGGGAGAAGG + Intergenic
951145357 3:19220144-19220166 TAGAATGTGGAGGCTGATGAGGG + Intronic
951369356 3:21826240-21826262 TAGAATATGGGAGAGGGGAATGG + Intronic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
952464302 3:33565059-33565081 TAGGCTAAGGAGGAAGAGGAGGG - Intronic
952670676 3:35963676-35963698 TGGAATAAGCAGGAGGAAGAAGG + Intergenic
953056942 3:39395605-39395627 CAGATTATGAGGGAGGAGGAAGG + Intronic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953834291 3:46329707-46329729 TAGATGTTGGAGGAGCAGGAGGG + Intergenic
953871295 3:46629705-46629727 AGGAGAATGGAGGAGGAGGAGGG + Intergenic
954861202 3:53692351-53692373 TAGTATCTGGAAGAGCAGGAGGG + Intronic
954876397 3:53805711-53805733 GGGAAGATGGAGGAGGAGGAGGG - Intronic
954876420 3:53805791-53805813 GGGAAGATAGAGGAGGAGGAGGG - Intronic
954876425 3:53805811-53805833 GGGAAGATGGAGGAGGAGGAGGG - Intronic
954876456 3:53805930-53805952 AAGATGAGGGAGGAGGAGGAGGG - Intronic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955087826 3:55720104-55720126 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955197555 3:56819339-56819361 TAAAACATGGAGAAGGATGAGGG - Intronic
955599686 3:60631698-60631720 TAGCATATGGTGGCGGTGGATGG - Intronic
955818322 3:62871323-62871345 AAGAATATGAAGGAGAGGGATGG - Intronic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
955941492 3:64150539-64150561 GAGAAGAAGGAGGAGGAAGAAGG - Intronic
955947568 3:64210040-64210062 TAGACAGTGGTGGAGGAGGAGGG - Intronic
956028286 3:65007738-65007760 TAGCACATGGAGGATGAGAAAGG + Intergenic
956122393 3:65979230-65979252 TAGAAGCTGGAGTAGAAGGAAGG - Intronic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956212623 3:66817301-66817323 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
956313961 3:67913835-67913857 TAGAAGAAGGAGGAAAAGGAGGG - Intergenic
956492153 3:69784606-69784628 TCTAATATGGGGGAGGGGGAAGG - Intronic
956811289 3:72866339-72866361 TAGAAGATGGAGAAAGAGGGAGG - Intergenic
956975148 3:74570206-74570228 ATGTATATGGAGGGGGAGGAGGG + Intergenic
957266965 3:77979782-77979804 TAGAAAATGGAGGAGAAGCAAGG - Intergenic
957358692 3:79125855-79125877 GAGCATATGGAGGAGGGAGAGGG + Intronic
957810597 3:85215939-85215961 TAGAGAATGAGGGAGGAGGAGGG + Intronic
958157765 3:89776246-89776268 AAGAAAGAGGAGGAGGAGGAGGG - Intergenic
958442869 3:94177923-94177945 CGGAACTTGGAGGAGGAGGAAGG + Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959034658 3:101346940-101346962 TAAAAAAAGGAGGAGGAGGGAGG + Intronic
959397578 3:105860362-105860384 TCAAATATGGAAGTGGAGGAGGG + Intronic
959614490 3:108331843-108331865 TAGAATGGGGAGGGGGAGGCAGG - Intronic
959890866 3:111554711-111554733 TAGACTGTGGTGGAGGGGGATGG + Intronic
959963810 3:112332213-112332235 AAGACGAAGGAGGAGGAGGAGGG + Intergenic
960740656 3:120830029-120830051 TAGAATGTGAGGGAGGAGGAGGG - Intergenic
960815607 3:121668776-121668798 TAGGATACGGAGGAGGAAAAGGG - Intronic
961030581 3:123600054-123600076 TAGGAAGGGGAGGAGGAGGAAGG - Intergenic
961348706 3:126284363-126284385 CAGAATGTGGAGGTGGAAGATGG - Intergenic
961983998 3:131113259-131113281 TAGAATATGGAGAGAGAAGAAGG + Intronic
962054411 3:131854796-131854818 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
962289483 3:134121604-134121626 TACAATAAGGAGGAAGAGAAAGG - Intronic
962425620 3:135266786-135266808 TAGTGTATGCTGGAGGAGGAAGG - Intergenic
962464273 3:135642196-135642218 GAGAAAATGGAGGAGGGGGAGGG - Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
963044048 3:141089479-141089501 TAGAGCCTGGAGGAGAAGGAGGG + Intronic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963327355 3:143877153-143877175 CTCAAGATGGAGGAGGAGGAGGG - Intergenic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964441716 3:156718169-156718191 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
964445442 3:156752780-156752802 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964568135 3:158080875-158080897 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
966104454 3:176319530-176319552 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966559181 3:181300033-181300055 GAGAAGAAGGAGGAGGAGAAGGG + Intergenic
966908531 3:184544637-184544659 TAGGAGGGGGAGGAGGAGGAGGG - Intronic
966951228 3:184819992-184820014 TAGGCTGAGGAGGAGGAGGAGGG + Intronic
967095516 3:186174392-186174414 AAGGTTATGGAGGAAGAGGAAGG + Intronic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968334543 3:197901650-197901672 AAGCAGATGGAAGAGGAGGAAGG + Intronic
968343842 3:197983419-197983441 TAGAATTTGGAAGAAGATGATGG + Intronic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969512203 4:7624899-7624921 GTGATCATGGAGGAGGAGGACGG + Intronic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970490931 4:16572914-16572936 GAGAAGGTGAAGGAGGAGGAAGG + Intronic
970802572 4:19991488-19991510 GAGACTAAGGAGGATGAGGAGGG - Intergenic
971061479 4:22976842-22976864 TAGAATATACAGGAGGAGGAAGG + Intergenic
971323359 4:25623307-25623329 CAGCCTCTGGAGGAGGAGGAGGG - Intergenic
971769829 4:30882107-30882129 GAGAAACGGGAGGAGGAGGAGGG - Intronic
972210623 4:36832139-36832161 GAGAAGATGGAGTAGGATGAGGG - Intergenic
972601675 4:40578521-40578543 TAGAAAATGGAGGCAGAGGGAGG - Intronic
972652191 4:41028908-41028930 TAGAAAAGGGAAAAGGAGGAGGG - Intronic
973282658 4:48376155-48376177 TAGAATATGAAGGAAGGGGCTGG + Intronic
973898511 4:55441712-55441734 TAGACTTTGGAGGAGGATGGTGG + Intronic
974095894 4:57363539-57363561 TAAAATATGGAAGAGGAAAAAGG + Intergenic
974177449 4:58342747-58342769 TAGAATCTGGAGGAGATGGGTGG + Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974694424 4:65346907-65346929 TAGACTTTGGCAGAGGAGGAGGG + Intronic
974700187 4:65433748-65433770 TTGAACATGGAGGAAGAGGCTGG - Intronic
974919925 4:68226082-68226104 GAGAAGATGGAGGAGGTAGATGG - Intergenic
974940828 4:68465682-68465704 AAGAATAGGGAGGAAGAGAAAGG + Intronic
975388524 4:73788134-73788156 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
976069505 4:81224972-81224994 TTGAAGATGGAGGAAGGGGAGGG - Intergenic
976087728 4:81423247-81423269 TAGAAAATTAAAGAGGAGGAAGG - Intergenic
976168748 4:82282411-82282433 AAAAAAATGGAGGAGGAGGAAGG + Intergenic
976551518 4:86401931-86401953 TAGAACATAGGGGAGGAGGAGGG - Intronic
976713403 4:88098024-88098046 TAGTATCTGGGGGAGGGGGAGGG + Intronic
976739755 4:88345964-88345986 TAGACGTTGGAGGAGCAGGAGGG + Intergenic
976759442 4:88532460-88532482 TAGAATAAAAAGGTGGAGGAAGG - Intronic
976819218 4:89186094-89186116 TGGAAGGTGGAGGAAGAGGAAGG - Intergenic
977221745 4:94345500-94345522 TGGAATAGGGAGGAGGAAAAGGG + Intergenic
977397782 4:96492444-96492466 TATAATATTGAAGAGGAAGAAGG - Intergenic
977731095 4:100352919-100352941 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
978514134 4:109553337-109553359 GATAATGAGGAGGAGGAGGAAGG - Intergenic
978850084 4:113324654-113324676 TAGAATTTGGAGAATTAGGAAGG + Intronic
978935609 4:114371416-114371438 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
979278978 4:118843302-118843324 TAGACCTTGGAGGAAGAGGAAGG - Intergenic
979328216 4:119403384-119403406 GAGAATGTGTAGGAGAAGGACGG - Intergenic
979416780 4:120451070-120451092 TAGTAAATGGAGGAGGAGATAGG + Intergenic
980225152 4:129974041-129974063 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
980666649 4:135948087-135948109 TAGGAAATAGAGGAGGAGGTGGG - Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
981254402 4:142644303-142644325 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
981295600 4:143127379-143127401 TAGAAGGAAGAGGAGGAGGAAGG + Intergenic
982125178 4:152178043-152178065 AGTAATAAGGAGGAGGAGGAAGG + Intergenic
983010737 4:162543532-162543554 AATAATATGGAGGAGAAGAATGG + Intergenic
983102293 4:163639781-163639803 TCTAATAAGGAGGAGGAGTAAGG + Intronic
983137944 4:164107937-164107959 AAGAGGATGGAGGAGGTGGAGGG - Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983589337 4:169390392-169390414 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
983647895 4:170010512-170010534 TAGACTGAGGAGGAGGGGGAGGG - Intronic
983721433 4:170857393-170857415 TACAATTTAGAGGAAGAGGAAGG + Intergenic
983759214 4:171384747-171384769 GAGAAGGTGAAGGAGGAGGAGGG - Intergenic
984251375 4:177339555-177339577 TAGATTGAGGAGGAAGAGGAGGG + Intronic
984539221 4:181016914-181016936 TAGAATATGGAGTATGCGTATGG + Intergenic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
985037585 4:185856826-185856848 TAGAAGATGAAGGAGAAGCAAGG + Intronic
985230905 4:187815363-187815385 TAGAACATTTAGTAGGAGGAAGG - Intergenic
986534424 5:8772192-8772214 TAGGATTTTGAGGAGGAGGAAGG + Intergenic
987095454 5:14545614-14545636 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
987165677 5:15195478-15195500 CAGAAGGTGAAGGAGGAGGAAGG + Intergenic
987241957 5:16009041-16009063 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
987506333 5:18778013-18778035 TAAAATATGGAATAGGAGAAGGG - Intergenic
987528818 5:19088422-19088444 TAGAACACAGAGGAGGAGGAGGG - Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988246449 5:28688741-28688763 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
988297839 5:29390008-29390030 AAGGTCATGGAGGAGGAGGAGGG - Intergenic
988632071 5:32942294-32942316 AAGAAGAAGGAGGAGGACGAGGG + Intergenic
988880133 5:35493547-35493569 TAGTAGACTGAGGAGGAGGAGGG + Intergenic
989227465 5:39046745-39046767 AAGGATATGGAACAGGAGGAGGG - Intronic
989677927 5:43994037-43994059 TAGATTAGGTAGGAGGTGGAAGG + Intergenic
989688722 5:44116924-44116946 TAGATGTTGGAGGAGTAGGAGGG + Intergenic
990300623 5:54445989-54446011 TAGAACAAAAAGGAGGAGGAAGG + Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991636506 5:68711289-68711311 CAGATTCTGGGGGAGGAGGAGGG - Intergenic
991637663 5:68722493-68722515 TAATGCATGGAGGAGGAGGAAGG + Intergenic
992089490 5:73304316-73304338 GGGAAGATGGAGGGGGAGGAAGG + Intergenic
992090644 5:73312955-73312977 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
992090684 5:73313135-73313157 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
992187677 5:74259881-74259903 TAGGGAATGGAGGTGGAGGAGGG - Intergenic
992533112 5:77671402-77671424 CAGAATCTGGAGGGGGTGGAGGG + Intergenic
992556894 5:77912843-77912865 AGGAATGTGAAGGAGGAGGAGGG - Intergenic
992686934 5:79208293-79208315 GAGAAGGTGGAGGAGGAGGAAGG + Intronic
992912667 5:81412601-81412623 ATGAGAATGGAGGAGGAGGAGGG - Intergenic
993100855 5:83538170-83538192 AAGAAAAGGAAGGAGGAGGAGGG + Exonic
994325085 5:98438067-98438089 TAGATGTTGGAGGAGCAGGAGGG - Intergenic
994493230 5:100475218-100475240 ATGAATATTGAGGTGGAGGAAGG - Intergenic
994801680 5:104385132-104385154 AAGAATAAGTAGGAAGAGGAGGG - Intergenic
994816270 5:104591779-104591801 TAGCAGGTGGAGAAGGAGGAGGG - Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
994869685 5:105331629-105331651 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
994924838 5:106101208-106101230 TTGAAGATGGAGCAGAAGGAAGG + Intergenic
995016788 5:107318875-107318897 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
995745425 5:115397379-115397401 TAGAATATGGGTGAGGAGTTGGG - Intergenic
995981879 5:118113914-118113936 GAGAATATGTAGGATGACGAAGG - Intergenic
996504098 5:124249956-124249978 TAAGATATGGAGGAGGAAGATGG - Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997297226 5:132776155-132776177 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
997619530 5:135276564-135276586 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
997682032 5:135763527-135763549 TATTCTATGGAGGAGGAGGAGGG + Intergenic
997736422 5:136215833-136215855 AAAAAAATGGTGGAGGAGGAAGG + Intronic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
997843525 5:137264451-137264473 TGGAATATAGAGGGAGAGGAGGG - Intronic
998049718 5:139022260-139022282 TGGAATCTGGAGGAGAAAGATGG - Intronic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
998933953 5:147214598-147214620 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
999040007 5:148398516-148398538 TAGAGTTTGCAGGAGCAGGATGG + Intronic
999381443 5:151124167-151124189 TAGAGTCTGCAGGATGAGGAAGG - Intronic
999698352 5:154205815-154205837 CAGAAGCTGGAAGAGGAGGAAGG + Intronic
1000049278 5:157547999-157548021 TAGAACAGAGAGCAGGAGGAAGG - Intronic
1000371504 5:160540909-160540931 AAGAATATGAAGGAGGATGACGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001056448 5:168454017-168454039 GAGGAGGTGGAGGAGGAGGAGGG + Exonic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1001290406 5:170453642-170453664 TGGAATATGGCGGAGGTGGTGGG + Intronic
1001432683 5:171675325-171675347 TAGAAGATGGAGGAGCAAAAAGG - Intergenic
1001600099 5:172923072-172923094 TAGGAGGAGGAGGAGGAGGAGGG + Intronic
1001640425 5:173240010-173240032 TTAATTATGGAGGAGGGGGAAGG - Intergenic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002557077 5:180050621-180050643 TAGAATAAGGAGGAGGGAAATGG - Intronic
1002681325 5:180967558-180967580 GAGAATGGGGAAGAGGAGGAGGG - Intergenic
1002743887 5:181455356-181455378 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1002757381 6:174855-174877 TAGTATATGCAGGTGGGGGAGGG + Intergenic
1003097622 6:3154984-3155006 TTGACTATGGAGGAGAAGGTAGG + Intronic
1003101206 6:3177664-3177686 TTGACTATGGAGGAGGAGGTAGG + Intergenic
1003172710 6:3732876-3732898 TAAGAAATGGAGGAGGAGGGTGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003722344 6:8718006-8718028 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1004119676 6:12808834-12808856 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1004241182 6:13924384-13924406 TAAAAGAGAGAGGAGGAGGAGGG + Intergenic
1004355110 6:14923752-14923774 AAGAATATGGAAGAGGAGAGGGG - Intergenic
1004485623 6:16063644-16063666 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1004919714 6:20365096-20365118 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1004973590 6:20939253-20939275 TAGTAAATGCAGCAGGAGGAAGG - Intronic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005992968 6:30914761-30914783 TAGGATATGGGGGTGGAGAAGGG - Intronic
1006113207 6:31761300-31761322 GGGAAAATGGAGGAGGATGAAGG + Intronic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006312613 6:33271593-33271615 TCAGATATGGAGGAGGAAGAGGG - Exonic
1006365769 6:33614300-33614322 TAGAAGATGGAGGGGAAAGAAGG + Intergenic
1006574131 6:35031530-35031552 CAAAATGGGGAGGAGGAGGAAGG - Intronic
1006904659 6:37525206-37525228 TGCAATCTGGTGGAGGAGGAGGG + Intergenic
1006980351 6:38142687-38142709 TAGAGGCTGGAGGAGGTGGAGGG + Intronic
1007362992 6:41371984-41372006 TAGGAGATGGGGGAGGAGGATGG + Intergenic
1007563692 6:42831676-42831698 CTGAATGTGGAGGAGGAGAAAGG - Intronic
1007591072 6:43021312-43021334 TGGAATATGGTGGAGAAGGCTGG + Intergenic
1008037889 6:46765234-46765256 TAGGATTTGGAGAAGCAGGAGGG - Intergenic
1008045918 6:46851030-46851052 TAAGAAATGGGGGAGGAGGATGG + Intergenic
1008541991 6:52553554-52553576 TAGAATGGGGAGGAGGAAGGAGG - Intronic
1008734494 6:54526419-54526441 TAGAAGAGAGAGGAAGAGGAGGG + Intergenic
1008779781 6:55089650-55089672 AAGAGGATGGAGGAGGAAGAAGG - Intergenic
1008930967 6:56939446-56939468 TACAATATGCACAAGGAGGAAGG + Intronic
1009392003 6:63155757-63155779 TAGTATAGGGAGGATGAGGCAGG - Intergenic
1009565435 6:65306110-65306132 TATAATCAGGAGGAAGAGGAAGG + Intronic
1010311404 6:74390030-74390052 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1011265302 6:85511930-85511952 TAAAATATGGAGGGAGAGGAAGG + Intronic
1011484792 6:87830139-87830161 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1011553309 6:88549277-88549299 AAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011866350 6:91833414-91833436 GAGGATATGGAGGAGAATGATGG - Intergenic
1012032780 6:94093800-94093822 TAGGAGATGGAGGATGTGGAAGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1013366758 6:109442931-109442953 TAGGATGTGGGGGAGAAGGAGGG - Intronic
1013408349 6:109862248-109862270 TGTAATATGGAGGAGCAGGTTGG - Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014279503 6:119425255-119425277 TAGACTGTGGAGGAGCAAGAAGG + Intergenic
1014561912 6:122901174-122901196 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1014712664 6:124825898-124825920 TAGAAGGTGGGGGTGGAGGAAGG - Intergenic
1014804868 6:125818095-125818117 GAAAGTAAGGAGGAGGAGGAAGG - Intronic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015153362 6:130063319-130063341 TAGAAGCTGAAGGAGGAGGAGGG + Intronic
1015526042 6:134175866-134175888 CAGAACTTGGAAGAGGAGGAAGG + Intronic
1016231393 6:141809426-141809448 TAGAATATGACCGAGGAGGCAGG + Intergenic
1016301237 6:142634088-142634110 TAGAAAATAAAGGAGTAGGATGG - Intergenic
1016634820 6:146275971-146275993 GAGAAGAAAGAGGAGGAGGAAGG + Intronic
1016733938 6:147455627-147455649 TCTGTTATGGAGGAGGAGGAAGG + Intergenic
1017339640 6:153305453-153305475 AAGAAGAAGGAGGAGGAGTAGGG - Intergenic
1017398655 6:154033277-154033299 TAAAGTGTGGAGGAGGAGAAAGG + Intronic
1017462963 6:154668398-154668420 AAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1018038064 6:159898613-159898635 AAGAAGAGGGAGGAGGAGGAAGG - Intergenic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018464263 6:164028911-164028933 TAGAAGGTGGAGGAGCAAGAAGG - Intergenic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1019248746 6:170728585-170728607 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1019954977 7:4406074-4406096 TAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1020026829 7:4905398-4905420 GAGGAAGTGGAGGAGGAGGAGGG + Intergenic
1020254165 7:6492773-6492795 TAGAGGAGGAAGGAGGAGGAGGG + Intergenic
1020565983 7:9796158-9796180 CATAAAATGGAGGAAGAGGAAGG - Intergenic
1020577401 7:9950017-9950039 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021669427 7:23020514-23020536 TATAAGATGGAGGAGGAAAATGG - Intergenic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1022437161 7:30399310-30399332 CAGAGGCTGGAGGAGGAGGAGGG + Intronic
1022494237 7:30843308-30843330 CAGCATTTGGAGGAGGAGGGTGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022639082 7:32164480-32164502 TAGAATATGCTGAAGGAGCATGG + Intronic
1022846623 7:34216333-34216355 TAGAACAAGAAGGTGGAGGAGGG - Intergenic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023227731 7:37988945-37988967 TAGAACAAGAAGGTGGAGGAAGG - Intronic
1023326823 7:39069820-39069842 TAGGTTGAGGAGGAGGAGGAAGG + Intronic
1023362003 7:39426567-39426589 AAGAAGAGGGAGGAAGAGGAGGG - Intronic
1023401876 7:39796845-39796867 GAGTATGTGTAGGAGGAGGACGG + Intergenic
1023690697 7:42783387-42783409 GAGAAGATGGAGGTGGGGGAAGG + Intergenic
1023888047 7:44374874-44374896 AAGAAGATGGAAGAGGAGCAGGG + Intergenic
1024195568 7:47055368-47055390 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1024647742 7:51383817-51383839 GAGTATGTGTAGGAGGAGGACGG - Intergenic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024770284 7:52714105-52714127 TAGATAAAGGAGGAGGATGAAGG - Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025176924 7:56806854-56806876 GAGTATGTGTAGGAGGAGGAGGG - Intergenic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1025694868 7:63769532-63769554 GAGTATGTGTAGGAGGAGGAGGG + Intergenic
1026148623 7:67769813-67769835 GAGGAGGTGGAGGAGGAGGAGGG - Intergenic
1026158947 7:67852194-67852216 TAGAATAAGGAAGATGAGGAGGG + Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026205617 7:68255040-68255062 AAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1026245417 7:68615282-68615304 GAGAAGAAGGAGGAGGAAGAGGG + Intergenic
1026472285 7:70703945-70703967 TGCAGTATGGAGTAGGAGGAGGG - Intronic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026605218 7:71810134-71810156 CAGAATTTGGAGGAGAAAGATGG + Intronic
1026638631 7:72105766-72105788 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1026645195 7:72161379-72161401 AAGAATAAGGTGGAGAAGGATGG + Intronic
1026662088 7:72311113-72311135 TAGACTGAAGAGGAGGAGGAGGG - Intronic
1026905066 7:74058102-74058124 AAGAATGAGAAGGAGGAGGAGGG - Intronic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027396352 7:77758945-77758967 TAGAGTTTGGAAGTGGAGGAAGG - Intronic
1027569222 7:79842321-79842343 CAGAATATGGAAGAGGAGAAAGG - Intergenic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028317474 7:89421441-89421463 AATAAAATAGAGGAGGAGGAAGG + Intergenic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1029304710 7:99610452-99610474 CAGAGTATGGAGGAGGACCACGG + Intergenic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1029380680 7:100212421-100212443 GAGAAAATGGAGGCTGAGGAGGG - Intronic
1029422082 7:100477099-100477121 CAGAAAATGAAGTAGGAGGAAGG + Intronic
1029584404 7:101461288-101461310 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1029819291 7:103130437-103130459 GAGAAAATGGAGGATGAGAAAGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1029983689 7:104902419-104902441 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030172393 7:106616486-106616508 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1030509040 7:110460483-110460505 AAGAAGATGGAAGAGGAGGAGGG + Intergenic
1030849877 7:114470797-114470819 AAAAACATGGAGAAGGAGGATGG - Intronic
1031050983 7:116945116-116945138 GATAATATTGAGGGGGAGGAAGG + Intergenic
1031153795 7:118085523-118085545 TTGAAAATGGAGGAGGAGTAGGG - Intergenic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1031480542 7:122273564-122273586 AAGAATATGGAGGACCAAGATGG + Intergenic
1031528622 7:122850670-122850692 TAGAAGCTGGAGGATGGGGATGG - Intronic
1031545152 7:123043694-123043716 GACAATCTGGAGGAAGAGGAGGG - Intergenic
1031550339 7:123103763-123103785 TAGAATATGGAGATGTAGAAAGG + Intergenic
1031762917 7:125737116-125737138 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032281417 7:130505447-130505469 TATAGTAAGGAGGAGGAGAAGGG + Exonic
1032451780 7:132037486-132037508 TAGAAAATGGAGATGGAGAATGG - Intergenic
1032466805 7:132151292-132151314 AAGAAGAAGGAGGAGGAAGAAGG + Intronic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032650383 7:133871664-133871686 AAGAATGTGAAGCAGGAGGAAGG - Intronic
1032669383 7:134069354-134069376 GAGAAGAGGGAGGAGGAAGAAGG - Intergenic
1032670417 7:134077292-134077314 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1032721043 7:134551166-134551188 AAGATTCTGGGGGAGGAGGAGGG - Intronic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033120568 7:138664186-138664208 TAGAAGGTGGGGGAGGGGGAGGG - Intronic
1033291879 7:140092072-140092094 TAGATCCTGAAGGAGGAGGAAGG + Exonic
1033355508 7:140595860-140595882 TGGCAGCTGGAGGAGGAGGATGG - Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033497601 7:141915552-141915574 TAGAAAATGGAGCAGTAGGAAGG - Intronic
1033613175 7:142985203-142985225 TAGAATAGGTAGGAGGGAGAAGG + Intergenic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034242212 7:149619294-149619316 TAGACTGAGGAGGAAGAGGAGGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034411704 7:150945546-150945568 GAGGCCATGGAGGAGGAGGAAGG + Intronic
1034696077 7:153055053-153055075 TTGGATATGGTGAAGGAGGAGGG + Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1035499299 8:78750-78772 TGGAAAGAGGAGGAGGAGGACGG - Intronic
1035530298 8:345829-345851 TAGAACACAGAGGTGGAGGAGGG + Intergenic
1035540686 8:434730-434752 TCAAATATGGAGGATGAAGATGG + Intronic
1035667433 8:1389285-1389307 GGGACTCTGGAGGAGGAGGATGG + Intergenic
1036053095 8:5222054-5222076 TAGGGTGAGGAGGAGGAGGAAGG + Intergenic
1036154019 8:6325346-6325368 TGGAATAAGGAGCTGGAGGATGG - Intergenic
1036204476 8:6794896-6794918 TAGGAGATGGAGGACAAGGAAGG - Intergenic
1036442128 8:8790640-8790662 TAAAATATAGAGGGTGAGGATGG - Intronic
1036703927 8:11032470-11032492 TAGATTAGGGAGGAAGAGGTTGG + Intronic
1036916661 8:12810795-12810817 TAGGTTATGGAAGAGGAGAAAGG - Intergenic
1037399306 8:18477752-18477774 TATAATCTGAAGGAAGAGGAAGG + Intergenic
1037778864 8:21854159-21854181 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1037782838 8:21882491-21882513 AAGTGTTTGGAGGAGGAGGAGGG - Intergenic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038313415 8:26463163-26463185 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1038483642 8:27918788-27918810 GAGAAAGAGGAGGAGGAGGAGGG + Intronic
1038839875 8:31174723-31174745 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1038898296 8:31812580-31812602 TAAAAAAGGAAGGAGGAGGAAGG - Intronic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1038943377 8:32330476-32330498 AAGGATGTGGAGGAGGAAGATGG + Intronic
1039177306 8:34824453-34824475 TGGAATTTGGAAAAGGAGGATGG - Intergenic
1039751915 8:40486398-40486420 GAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040599006 8:48866033-48866055 AAGAATATGTAAGAGAAGGAAGG + Intergenic
1041006315 8:53499814-53499836 TAGAATATAGTGGAGGAGGCCGG - Intergenic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041831536 8:62160688-62160710 AAGAAGTAGGAGGAGGAGGAAGG + Intergenic
1042361855 8:67892501-67892523 TAGATTTTGGAGGGTGAGGAGGG - Intergenic
1042853624 8:73241600-73241622 CAGAACCTGGAGGAGGAGGTGGG + Exonic
1043115602 8:76250045-76250067 GAGAAGAAGGAGGAAGAGGAAGG - Intergenic
1043499207 8:80836444-80836466 TAGAATATGGGGAATGAGGAGGG - Intronic
1043588670 8:81799531-81799553 TAGAAAATGGAGGGGGAAAATGG + Intergenic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1044065821 8:87699209-87699231 TACAAAATGATGGAGGAGGAAGG + Intergenic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044437812 8:92186555-92186577 TAGAAAATTGATGAGGAGAATGG - Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1045130036 8:99140687-99140709 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
1045231391 8:100310128-100310150 AAGAAGTGGGAGGAGGAGGAGGG - Intronic
1045358607 8:101411788-101411810 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1045406443 8:101871395-101871417 TAGAATTTTGATTAGGAGGAGGG - Intronic
1045747485 8:105440678-105440700 GAGAAGATGCAGGAGCAGGAGGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046066051 8:109197703-109197725 TAGCATTTTGAGGAGTAGGAAGG - Intergenic
1046399937 8:113691896-113691918 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1046710246 8:117503283-117503305 TAGAAGATAGAGGAAGAAGAAGG + Intergenic
1046711173 8:117513203-117513225 CAGAATGGTGAGGAGGAGGAGGG - Intergenic
1046797360 8:118387464-118387486 TACAATTATGAGGAGGAGGAGGG - Intronic
1047165807 8:122437287-122437309 TTGATTATGGAGGTGGGGGAGGG - Intergenic
1047439920 8:124868482-124868504 CAGAATCTAGAGGAGGATGAAGG - Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048130096 8:131686398-131686420 TAGAAATTGGAGGAGGAAGACGG - Intergenic
1048680979 8:136841777-136841799 GAGAGTATAGAGGAGGGGGAGGG - Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048787835 8:138069686-138069708 CAGAAGATGGAGGAGACGGAGGG + Intergenic
1048921865 8:139238668-139238690 TAGAATAAGAAGGTGGAGAATGG + Intergenic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1049036448 8:140079966-140079988 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1049037230 8:140086230-140086252 CAGAGTATGGAGGATGAAGAAGG + Intronic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049356717 8:142192779-142192801 TAGAACAGGGAGGAGCAGAAGGG + Intergenic
1049454849 8:142681631-142681653 TGGAAGATGGAGGATGGGGAGGG - Intronic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1049654779 8:143792707-143792729 CGGAAGATGCAGGAGGAGGAAGG - Exonic
1049674019 8:143881826-143881848 TAGAAGACAGAGGAGGAGGAGGG + Intergenic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050610438 9:7346871-7346893 TGGAGGATGGAGGAGGAGGATGG - Intergenic
1050624641 9:7489793-7489815 TGTAATATGGATGAGGTGGAAGG - Intergenic
1050803642 9:9646617-9646639 TAGTATAAAGAGGAGGAAGAAGG - Intronic
1050826334 9:9951105-9951127 TAGAATAAGATGTAGGAGGAGGG + Intronic
1050882687 9:10722570-10722592 AGGAATTTAGAGGAGGAGGAAGG + Intergenic
1050942177 9:11473203-11473225 TAGAAGGAGGAGGAGAAGGAGGG + Intergenic
1051170386 9:14314705-14314727 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1051261957 9:15273453-15273475 AGGAATGTGGAGGAGGAGGGAGG - Intronic
1051564402 9:18480859-18480881 TAGAATCTGGAAGTGGATGAGGG + Intronic
1051765244 9:20515499-20515521 GAGAAAATGGGGGAGGAGGAAGG + Intronic
1052216821 9:25976093-25976115 TACAATATAGAGGAGTAAGAAGG - Intergenic
1052887513 9:33664520-33664542 TTGAATATGAAGGAGAAGCATGG - Intergenic
1053130158 9:35610051-35610073 TAGAATGGGGTGGGGGAGGAGGG - Exonic
1053225350 9:36350395-36350417 TTGAATATTGTGGAGGAGGAAGG - Intronic
1053449140 9:38178987-38179009 TGGAATGAGGAGGAGGTGGAAGG - Intergenic
1053589379 9:39496234-39496256 TAGAATATGAAGGAGAACCATGG + Intergenic
1053624189 9:39851944-39851966 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1053880677 9:42591284-42591306 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1053891992 9:42703048-42703070 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054219708 9:62398754-62398776 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1054231007 9:62510419-62510441 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054576920 9:66869055-66869077 TAGAATATGAAGGAGAACCATGG - Intronic
1054999065 9:71427751-71427773 TAGTAGAGGGAGGAGGAGGCAGG + Intronic
1055195115 9:73581554-73581576 GAGAAAAAGGAGGAGCAGGAGGG - Intergenic
1055266071 9:74497565-74497587 TGGACTGAGGAGGAGGAGGAAGG - Exonic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056024213 9:82475732-82475754 GAAAAGATGGAGGAGGTGGAAGG + Intergenic
1056240746 9:84644099-84644121 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1056512831 9:87321875-87321897 TGGTCTATGGAGTAGGAGGAAGG - Intergenic
1056566337 9:87776019-87776041 GAGAATATGCAGGAGAAGAAGGG - Intergenic
1056648159 9:88432896-88432918 AAGAAAATGGGGGAGGAAGAGGG - Intronic
1056719100 9:89058265-89058287 TGGAAGATGGTGGTGGAGGACGG + Intronic
1056733702 9:89186295-89186317 CAGAATATGGAGGGCGATGAGGG - Intergenic
1056958262 9:91099764-91099786 TAGAAAATGAAAGAGGAGGAGGG + Intergenic
1057226602 9:93296294-93296316 GGGAAGATGGAGGGGGAGGAAGG - Intronic
1057373432 9:94495678-94495700 TAGAATTTGGAAGAAGATGATGG + Intergenic
1057472441 9:95369537-95369559 TAGAAATTGAAGGTGGAGGAAGG - Intergenic
1057799578 9:98182075-98182097 CAGAATCTGGAGGAGGAGAGAGG - Intronic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1057997330 9:99829824-99829846 TAAAATATGGGGGAGGCTGATGG - Intronic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058400935 9:104618333-104618355 GAAAATAGGGAAGAGGAGGAAGG + Intergenic
1058452821 9:105113040-105113062 AAGAAGATGAAGGAGAAGGAGGG + Intergenic
1058561469 9:106233307-106233329 AAGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058913285 9:109541023-109541045 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1058950443 9:109898747-109898769 CCAAATATGGGGGAGGAGGAAGG - Intronic
1059047380 9:110883949-110883971 TAGAAAATGGGGGTGGGGGAGGG - Intronic
1059179596 9:112199385-112199407 TAGAATAAGTAGGAGTAGGCTGG - Intergenic
1059420243 9:114186141-114186163 TGGACTCTGGAGGAGGAAGATGG - Intronic
1059592777 9:115679956-115679978 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059737722 9:117118895-117118917 TAGAGTGAGGAGGTGGAGGAAGG - Intronic
1059961642 9:119570759-119570781 TAGAATTTGGACAAGGAGAATGG + Intergenic
1060504763 9:124189496-124189518 TAGGCTGGGGAGGAGGAGGAGGG + Intergenic
1060610941 9:124963881-124963903 TAGGCTGTGGAGGAGGAGGAGGG + Intronic
1060620122 9:125057666-125057688 CCGAGTGTGGAGGAGGAGGAGGG + Intronic
1060680332 9:125557136-125557158 GAGAATAGGAAGGAGGGGGAAGG - Intronic
1060950499 9:127599128-127599150 TAGAATTTGCAGGTTGAGGAGGG - Intergenic
1061645385 9:131996751-131996773 TAGAGTAAGGAGGAGGAGGTTGG - Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062744610 9:138203433-138203455 GAGAATTAGGAAGAGGAGGAGGG + Intergenic
1203609704 Un_KI270748v1:85849-85871 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185550667 X:980798-980820 GGGATGATGGAGGAGGAGGAGGG + Intergenic
1185550729 X:980996-981018 GGGATGATGGAGGAGGAGGAGGG + Intergenic
1185550779 X:981151-981173 GGGATGATGGAGGAGGAGGAGGG + Intergenic
1185550797 X:981203-981225 GGGATGATGGAGGAGGAGGAGGG + Intergenic
1185603490 X:1354616-1354638 GAGAAAATGGAGAAAGAGGAGGG + Intronic
1185662142 X:1736001-1736023 GAGAAAGCGGAGGAGGAGGAGGG - Intergenic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186463474 X:9766061-9766083 AGGAAGAGGGAGGAGGAGGAGGG + Intronic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1187248526 X:17575526-17575548 GAAAACATGGAGGAGGGGGAGGG - Intronic
1187406924 X:19012807-19012829 TAGAATTTGGAGGATGGGGGAGG - Intronic
1187504186 X:19865418-19865440 TAGAGGGTGGAGGTGGAGGAGGG + Intronic
1187524868 X:20045224-20045246 TAGCAAATGGAGGAGGTGCATGG - Intronic
1187623421 X:21084537-21084559 TAGAATGGGAAGGCGGAGGAAGG - Intergenic
1188275726 X:28198417-28198439 AAAAACATTGAGGAGGAGGATGG - Intergenic
1188305211 X:28553507-28553529 AAGAATATGGAGGAGGGTGGAGG + Intergenic
1188813643 X:34684343-34684365 AAAAAAATTGAGGAGGAGGACGG - Intergenic
1189169751 X:38897722-38897744 TACAATATGTGTGAGGAGGAAGG - Intergenic
1189193544 X:39132738-39132760 TTGAAGATGGAGGAAGAGGTAGG - Intergenic
1189197072 X:39161922-39161944 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1189197098 X:39162060-39162082 GAGAAAGGGGAGGAGGAGGAAGG - Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189454803 X:41176260-41176282 CAGACCATGAAGGAGGAGGAGGG - Intronic
1190497179 X:51037847-51037869 TAGGAAAAGGATGAGGAGGAGGG + Intergenic
1190703052 X:53002423-53002445 GAGAATGTGGAGGAAGGGGATGG + Intergenic
1191779297 X:64848933-64848955 TAGAGTGTGGAGGAGTAGAAGGG - Intergenic
1191779554 X:64850712-64850734 AAGGTCATGGAGGAGGAGGAGGG - Intergenic
1192454834 X:71268002-71268024 TAGATGTTGGAGGAGCAGGAGGG - Intergenic
1192533639 X:71910788-71910810 GAGAAAAGAGAGGAGGAGGAGGG + Intergenic
1192639059 X:72846070-72846092 TGGGAGATGGAGGAGGAAGAGGG + Intronic
1192642653 X:72874738-72874760 TGGGAGATGGAGGAGGAAGAGGG - Intronic
1193248451 X:79259133-79259155 CACAAAGTGGAGGAGGAGGATGG + Intergenic
1194437171 X:93881760-93881782 TAGAAAATAGAGGGGCAGGAAGG + Intergenic
1194757408 X:97753403-97753425 GAGAATATGGATGGGGATGATGG + Intergenic
1195198357 X:102520893-102520915 GAGAAAATGGAGGATAAGGAAGG - Intergenic
1195244243 X:102981184-102981206 TAGAAGAAGGAGGAGGATCAGGG - Intergenic
1195346075 X:103952540-103952562 TAGACTATGGAGGATTAGCAAGG + Intronic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1195720436 X:107862149-107862171 TAGCAGGAGGAGGAGGAGGAGGG + Intronic
1196808524 X:119609872-119609894 TGCAATAGAGAGGAGGAGGATGG - Intergenic
1196856463 X:119989959-119989981 GAGAAGCAGGAGGAGGAGGATGG + Intergenic
1197114170 X:122812657-122812679 TAGACTAAGGAGGAGAAAGAAGG - Intergenic
1197222107 X:123924244-123924266 TAAAATATGGAGCAGGTGGAGGG - Intergenic
1197579159 X:128260340-128260362 TAGATGAGGGAGGAGTAGGAAGG + Intergenic
1197648259 X:129040257-129040279 TACAATATGGAGTCCGAGGAGGG + Intergenic
1197728786 X:129793596-129793618 CAGAATATGGGGGTGGAGGTAGG - Intronic
1197856798 X:130921751-130921773 GAGAAAAAGGAGGAAGAGGAAGG - Intergenic
1198463591 X:136885163-136885185 TAGAAGATCCATGAGGAGGAGGG - Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198795971 X:140395039-140395061 TGAAAAATAGAGGAGGAGGAGGG + Intergenic
1198802217 X:140459567-140459589 TGGAGAATAGAGGAGGAGGAGGG + Intergenic
1199109932 X:143919749-143919771 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199665200 X:150090944-150090966 GAGAATGTGGAGAAGGTGGATGG + Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1199943434 X:152647208-152647230 TAGAATATTCAGTAGGAAGAAGG - Intronic
1200002335 X:153068512-153068534 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1200005389 X:153081498-153081520 TAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1200081458 X:153578807-153578829 TGGAAGATGGAGGAGGAGACGGG + Intronic
1201304631 Y:12540247-12540269 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1201461748 Y:14233042-14233064 AAGAAGAATGAGGAGGAGGAGGG - Intergenic
1201724612 Y:17138908-17138930 TAGACATTGGAGGAGCAGGAGGG + Intergenic
1202304258 Y:23451580-23451602 GAGTATACAGAGGAGGAGGATGG + Intergenic
1202566552 Y:26219011-26219033 GAGTATACAGAGGAGGAGGATGG - Intergenic