ID: 1033449148

View in Genome Browser
Species Human (GRCh38)
Location 7:141447537-141447559
Sequence CAGAGCAAGCAGAATGCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033449148_1033449150 6 Left 1033449148 7:141447537-141447559 CCATCCGCATTCTGCTTGCTCTG 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1033449150 7:141447566-141447588 ATCTGTTTCACAGCTTGCCCTGG No data
1033449148_1033449153 20 Left 1033449148 7:141447537-141447559 CCATCCGCATTCTGCTTGCTCTG 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1033449153 7:141447580-141447602 TTGCCCTGGGCTTCTTTCCTGGG No data
1033449148_1033449152 19 Left 1033449148 7:141447537-141447559 CCATCCGCATTCTGCTTGCTCTG 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1033449152 7:141447579-141447601 CTTGCCCTGGGCTTCTTTCCTGG 0: 1
1: 0
2: 9
3: 147
4: 475
1033449148_1033449151 7 Left 1033449148 7:141447537-141447559 CCATCCGCATTCTGCTTGCTCTG 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1033449151 7:141447567-141447589 TCTGTTTCACAGCTTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033449148 Original CRISPR CAGAGCAAGCAGAATGCGGA TGG (reversed) Intronic
900592225 1:3465254-3465276 CAGCGCAGGGAGAATGCCGAGGG + Intronic
900966276 1:5960916-5960938 CACAGCAGCCAGAAGGCGGAAGG + Intronic
902290509 1:15431836-15431858 CAGAGAAAGCAGGTTGAGGAGGG + Intergenic
903787328 1:25870113-25870135 CTGAGCCAGCAGGATGAGGATGG + Intronic
904018929 1:27446887-27446909 GAGAGCAAGAAGAATGCTCACGG - Intronic
905375766 1:37519060-37519082 CAAAGCAGCCACAATGCGGAAGG - Intergenic
906910921 1:49949410-49949432 CAGAGTAAACAGAATGCTGTGGG + Intronic
907273578 1:53304725-53304747 CAGGGCCAGCAGTATGGGGATGG + Intronic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
910238020 1:85055805-85055827 CGGAGAAAGGAGAATGAGGAAGG + Intronic
914988793 1:152480817-152480839 CAGAGCAAGCAGAGTGGAGGTGG - Intergenic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
915865669 1:159495348-159495370 GAGAGCAAGCAGAAACAGGATGG - Intergenic
917938911 1:179896678-179896700 AATAGCAGGCAGAATGAGGACGG + Intronic
923440274 1:234012010-234012032 CTCAGCAAGAAGAATGCGGTAGG + Intronic
923876562 1:238055683-238055705 CAGAGTAACCAGAATTCTGAAGG - Intergenic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1062897804 10:1117702-1117724 CAGAGCGGGCAGCATGGGGAGGG + Intronic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070400714 10:76051127-76051149 CAGAGCGACCAGACGGCGGAGGG - Intronic
1070647873 10:78214029-78214051 GAGAGCAAGCAGCATGAGGCTGG - Intergenic
1070870294 10:79745369-79745391 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1071170749 10:82860916-82860938 CAAAGCAAGCAGTATGCCCAGGG - Intronic
1071637213 10:87267589-87267611 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1073037694 10:100575739-100575761 CAGTGCAGGGAGAATGCTGATGG - Intergenic
1074158430 10:110817785-110817807 CAGAGGAAGCAGCATGCACAAGG + Intronic
1074975517 10:118577978-118578000 GAGAGCTATCAGAATGGGGAAGG + Intergenic
1076092066 10:127694865-127694887 CAGAGAAAGCAGAGTGGGTATGG + Intergenic
1077478116 11:2800496-2800518 CAGAGCAGGCAAAGTGGGGAGGG - Intronic
1078927524 11:15887978-15888000 TAGAGCATGCTGAATGAGGAAGG - Intergenic
1078929141 11:15900036-15900058 CAGAGCAAGCTGCAAGCAGATGG + Intergenic
1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG + Intronic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1083880088 11:65544063-65544085 CAGAGCAGGAGGAATGAGGAAGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084445562 11:69201734-69201756 CAGAGCCAGCAGGCTGAGGAAGG - Intergenic
1084639283 11:70414823-70414845 GAGAGGAAGCAGGATGCGGCGGG + Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090745139 11:129699323-129699345 CACAGGAAGCAAAATGGGGAGGG + Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091963773 12:4721086-4721108 TAGAGCAAGCAGTATGGGGGAGG + Intronic
1092395539 12:8122367-8122389 GAGTGCAAGCAGAGTGAGGAGGG + Intergenic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG + Intergenic
1102859222 12:116321027-116321049 CAGAGCAAGAACAATGCTGATGG - Intergenic
1104031296 12:125067010-125067032 CAAAGCAAGCAGGATGCAAATGG - Intronic
1104177391 12:126346249-126346271 AAGAGCAAGGAGATTGCTGAGGG - Intergenic
1112018916 13:95354594-95354616 CAGAGCAGGTAGAATGTGGAAGG - Intergenic
1112475640 13:99729039-99729061 CAGAGAAAGCAGAATGGCCAGGG + Intronic
1113448489 13:110388510-110388532 CAGAGCAAGATGAATGCTGTTGG + Intronic
1116750101 14:48872355-48872377 TAGAGCAAGCTGAATGCAAAGGG - Intergenic
1117740684 14:58816352-58816374 CAGAGCAAGCAAATAGGGGAAGG - Intergenic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1119760317 14:77146246-77146268 CAGAGCACGCAGGAGGCAGAGGG + Intronic
1119961550 14:78863439-78863461 CAGAGCAGGCAGTATGGGTAGGG - Intronic
1121575261 14:94979843-94979865 CAGAGCAAGCAGAGTGCAGATGG + Intergenic
1122997660 14:105274254-105274276 CTCAGCAAGAAGAATGCGGCAGG - Intronic
1123200524 14:106658987-106659009 AAGAGCAAGAGGAATGCTGAGGG - Intergenic
1124343350 15:28904147-28904169 CAGAGATAGCAGAAAGCGAAAGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1127860455 15:62989568-62989590 CAGAGCAGGCAGAGTGGGCATGG - Intergenic
1129226874 15:74175280-74175302 CAGAGCACGGAGGCTGCGGAAGG - Exonic
1129750507 15:78059581-78059603 CACCTCAAGCAGAATGTGGATGG - Intronic
1129801438 15:78418059-78418081 AAGAGCAGGCAGAATGTGTAGGG + Intergenic
1132143467 15:99413063-99413085 CAGAGCAAGAAAAATGCCGAGGG - Intergenic
1133235748 16:4386630-4386652 CAGAGCAGGCAGGAGGCTGAGGG + Intronic
1133293019 16:4735003-4735025 CAGAGCATCCAGAAGGCGAAGGG - Intronic
1134095182 16:11414294-11414316 CAGAGAGAACAGAATGTGGAGGG + Intronic
1134872407 16:17663832-17663854 CAGAGCTAGCAGATTGAGGTGGG + Intergenic
1137518412 16:49170851-49170873 CAGAGCAAGGAGAAAGTTGAAGG - Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1139686177 16:68605425-68605447 CAGAGGAAGTAGAGTGTGGAAGG - Intergenic
1141165136 16:81655296-81655318 CAGACCAACCAGAAGGTGGAAGG + Intronic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1142660218 17:1424012-1424034 CGGAGCAGGCAGAAAGCTGAGGG - Intronic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1144853457 17:18255612-18255634 CAGAGAAATCAGAATCTGGATGG + Intronic
1146667510 17:34714968-34714990 CAGAGAAAGAAGAATGGGTAGGG + Intergenic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147326370 17:39671653-39671675 CAGAGGAAGGAAAATGGGGATGG - Exonic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1150402758 17:64872411-64872433 CAGAGGGAGCAGAATGGAGATGG + Intronic
1152034023 17:77860986-77861008 AAGAGCAAGCAAAGTGGGGATGG + Intergenic
1153352047 18:4092190-4092212 CAAAGAAAGCAGAAAGCTGAGGG - Intronic
1153541635 18:6161761-6161783 CAGAGTGAGCAGAATGCAGTGGG - Intronic
1154220656 18:12450731-12450753 CAGAGCAGGAAGAATCCAGACGG - Intronic
1156218877 18:35030753-35030775 CAGAGAAACCAGAATGTGCAGGG - Intronic
1157448224 18:47764332-47764354 CAGAGAAAACAGAATGCTGTTGG + Intergenic
1157574779 18:48736317-48736339 CAGAGCATGCCGAGTGCAGAAGG - Intronic
1158488740 18:57891328-57891350 GAGAGCAACCAGAATGGGGTGGG - Intergenic
1158675066 18:59510985-59511007 CAGAGCCAGCTGAATGGGGCTGG - Intronic
1161744512 19:6047480-6047502 CTGAGCATGCAGAATTCCGAGGG - Exonic
1164541942 19:29128024-29128046 AAGAGCAAGGGGAAAGCGGAGGG + Intergenic
1165824490 19:38698097-38698119 CAGAGCAGGCACACTGTGGAGGG + Intronic
1166012142 19:39950397-39950419 CAGAGAAACCTGAATGCGGGGGG - Intergenic
1166356166 19:42228895-42228917 CAGGGCAGGCAGAATGCAGTTGG + Intergenic
1166423833 19:42658349-42658371 CACAGCTAGCAGGATGAGGATGG - Intronic
932176241 2:69605385-69605407 CAGAGCAAGGAGAATGGTTAGGG - Intronic
934059721 2:88282998-88283020 CAGAGCACACAGAATGAGGTGGG - Intergenic
934060653 2:88289564-88289586 CAAAGCAAGCAGAAACTGGAAGG + Intergenic
936034277 2:109098171-109098193 CAGAGCAGGCAGATTTAGGAAGG - Intergenic
937656653 2:124384753-124384775 CAGAGGAAGAACAAAGCGGAGGG - Intronic
938925607 2:136038803-136038825 CAGAGAAAGCAGAAAGGGAAGGG - Intergenic
939144257 2:138393906-138393928 CAGAGGAAGGTGAATGCGGAAGG - Intergenic
939855385 2:147352758-147352780 CAGAGAGAGAAGAATGAGGAAGG + Intergenic
940276892 2:151948996-151949018 GAGAGCAAGCAGAAAGAGGTAGG - Intronic
940709057 2:157140326-157140348 CAGAGCAATCAGACTACAGAAGG - Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
942208596 2:173648226-173648248 CAGAGAAAGCAGGACGGGGAGGG + Intergenic
942239158 2:173943105-173943127 CAGAGTAAGCATAAGGCTGATGG - Intronic
942455621 2:176136574-176136596 CTGGGAAAGCAGAATGCGGGGGG - Intergenic
943426884 2:187749144-187749166 AAGGGCAAGCAGAATGGTGAGGG + Intergenic
943757382 2:191570556-191570578 CACAGAAAGCAGACTGGGGATGG - Intergenic
944285193 2:197941737-197941759 GAGAGAAAGCAGAATGGTGAGGG - Intronic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
948033097 2:234835869-234835891 CAGGGCAAGCTGACTGCAGAGGG - Intergenic
1171777963 20:29388312-29388334 CAGAGCCAGTAGAATGTGGAGGG - Intergenic
1171819726 20:29823708-29823730 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1173359632 20:42330795-42330817 AAGAACAAGCAGAATGCTGCAGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1175171378 20:57083884-57083906 CAGAGCAGCCAGAGTGAGGATGG - Intergenic
1177516885 21:22164426-22164448 CAAAGCAAGCAAAATAAGGAAGG - Intergenic
1178596409 21:33957421-33957443 CATAGCATGCAGACTGAGGAAGG + Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1179421472 21:41240111-41240133 CATAGGAAGCAGAATGTGGCTGG + Intronic
1180074994 21:45457674-45457696 CATAGCAAGCAGAATCTGAATGG - Intronic
1180162713 21:46005514-46005536 CAGAGCAAGAAGAGGGCGGAGGG + Intergenic
1180323728 22:11348399-11348421 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1184538861 22:45106569-45106591 CATAGCATGCTGAATGCTGACGG - Intergenic
949146187 3:702299-702321 CAGTGCAAACAGCATGTGGAAGG - Intergenic
951344952 3:21536857-21536879 CAAAGCACGCAGAAATCGGAGGG + Intronic
952685923 3:36148369-36148391 CAAAGCAAGCAGAAGACGGTGGG + Intergenic
952711731 3:36438680-36438702 CAGAGCAAGAAAAATGTGGCAGG + Intronic
953116557 3:39998181-39998203 CAGAGCAATCAGGCTGCAGAAGG + Intronic
953145539 3:40271164-40271186 GAGACCAAGCAGAAAGAGGAAGG + Intergenic
953420018 3:42747129-42747151 CAGAGCAAGCAGTGTGCTCAAGG + Intronic
953576958 3:44120624-44120646 GAGAGCAAACAGAATGGGCAAGG + Intergenic
954526341 3:51275082-51275104 CACAGGAAGCAGGATGCGGCGGG - Exonic
955935217 3:64096497-64096519 CAGAGAATGCTGAATGAGGAAGG - Exonic
956126847 3:66018693-66018715 CCGAGCACTCAGAATGCAGAAGG - Intronic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
956471060 3:69567245-69567267 CAGAGGAAGCAGCATAAGGAAGG - Intergenic
957087209 3:75692247-75692269 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
959063126 3:101633708-101633730 CAGAAAAGGCAGGATGCGGAAGG - Intergenic
959860732 3:111212083-111212105 GAGAGCAGGAAGAATGGGGAAGG - Intronic
960243295 3:115371142-115371164 GAGAGAAAGGAGAATGTGGAAGG - Intergenic
964633959 3:158841205-158841227 CTGAGAAAGCAGAAAGCAGATGG + Intergenic
966532212 3:180993627-180993649 AAGAGCAAGCAGGAAGTGGAAGG + Intergenic
966921265 3:184613145-184613167 CCGGGCAACCAGAATGGGGAGGG + Intronic
968705656 4:2076212-2076234 AAGTGCAAGCACAAGGCGGACGG + Intronic
969279458 4:6160507-6160529 CAGGGCATGCAGCATGCGGGAGG - Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969582922 4:8076317-8076339 AAAAGCATTCAGAATGCGGAGGG - Intronic
970006611 4:11416956-11416978 CAGAGGAAACAGTATGCGTAGGG + Intronic
970418135 4:15879332-15879354 CTCAGCAAGAAGAATGCGGTAGG - Intergenic
972199483 4:36696851-36696873 CAAAGGAAGCAGAATGGGCAAGG - Intergenic
972244501 4:37230453-37230475 CAGAGCAAGCTTAATGAGGACGG - Intergenic
973676481 4:53268577-53268599 CAGAGCCTGCAGAATGAGGAGGG + Intronic
974144374 4:57928487-57928509 CAGTGCAGGCAGAATGGGAATGG + Intergenic
976584330 4:86778371-86778393 CATAGCAAGCAGCATGAGCATGG + Intronic
978667470 4:111201888-111201910 CAGAGCAAACAGTATGTGTAAGG - Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
984549898 4:181147552-181147574 CAGAGCAAGCACCTTGCGGAAGG + Intergenic
984556712 4:181222932-181222954 TTCAGCAAGCAGAATGTGGATGG + Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986865516 5:11981859-11981881 CAGAGAAAGTAGAATGTGGAAGG - Intergenic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
990341020 5:54823246-54823268 CAGAGTATGCAGAATGGGGGAGG + Intergenic
990497180 5:56360019-56360041 CAGAGAAATCAGAATGCGAGTGG + Intergenic
995743904 5:115383687-115383709 CAGAGTAAGCAGTCTGTGGATGG + Intergenic
997299067 5:132789218-132789240 GAGAGCAAGAACAATGGGGATGG - Intronic
997630690 5:135366595-135366617 AAGAGCAAGTAGGATGGGGAGGG + Intronic
998407086 5:141880061-141880083 CCCAGCAAGCAGACTGGGGAGGG - Intergenic
998801280 5:145872163-145872185 CAAAGCAGGCAGTATGAGGAAGG + Intronic
999136411 5:149322863-149322885 CAGAGCAAGCACAATGATAAAGG + Intronic
1001633540 5:173194063-173194085 CAGATGAAGCACAATGTGGATGG - Intergenic
1004410176 6:15374201-15374223 CAGAAGAGGCAGCATGCGGAAGG + Exonic
1007054855 6:38872624-38872646 AGGCGCAAACAGAATGCGGAAGG + Exonic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1008394802 6:50994030-50994052 CAGAGCAAGCATACTGGAGAAGG + Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1013073007 6:106746036-106746058 CAGAGCAAACAGAATACCCATGG + Intergenic
1013189630 6:107791156-107791178 CAGAGCAAGAAGAACAGGGATGG + Intronic
1015471633 6:133612785-133612807 CAGAGGAAGGAGCATGCAGAGGG - Intergenic
1015853451 6:137598833-137598855 CAGGGCATGCAGAATGCTGATGG - Intergenic
1016077705 6:139817009-139817031 CAGAACTAGCAAAATGCTGATGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1020111549 7:5450840-5450862 CAGAGCCTGCAGAATCTGGAAGG - Intronic
1020119759 7:5496395-5496417 AAGAGGAAGAAGAATGTGGAAGG - Intronic
1020208539 7:6139699-6139721 CAGGGCAGGGAGAATGCAGAGGG - Intronic
1022315630 7:29242417-29242439 CACAGCCAGCAGTATGCAGAGGG - Intronic
1022838226 7:34136978-34137000 CAGAGAAAGCAGAGAGCAGAGGG + Intronic
1023723080 7:43114552-43114574 CAGAGGAAGCAGCAAGCGGAGGG - Intronic
1023768139 7:43531055-43531077 TAGAGCATACAGAATGAGGAAGG - Intronic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027994944 7:85413931-85413953 CAGGGCAGGCAGAATCTGGAGGG - Intergenic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1033116797 7:138632621-138632643 CAGAGGAAGTAGGATGTGGAGGG + Intronic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1033490242 7:141836360-141836382 CAGAGCCAGTGGAATGCAGAGGG + Exonic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1036390961 8:8324085-8324107 CAGGGCAAGCACAATGGGGAAGG + Intronic
1037068517 8:14613608-14613630 CAGAGCATGCAGAATTTGCAGGG + Intronic
1038339641 8:26674541-26674563 CGGAGCAAGCAGGAGGCTGATGG + Intergenic
1039244149 8:35589644-35589666 CTGAGCAAGGAGTATGGGGAAGG - Intronic
1039981168 8:42410981-42411003 CCGAGGAAGCGGCATGCGGAAGG - Intergenic
1042737306 8:72004047-72004069 CAGATCAGGCAGAATCCTGACGG + Intronic
1043830079 8:84978077-84978099 CAGAGTTAGAAGAATGTGGAAGG + Intergenic
1044268545 8:90212066-90212088 CAGAGGAAGAGGAATGCTGAAGG - Intergenic
1044541979 8:93418626-93418648 CAGAGAAAGCAGACTGGGAAGGG - Intergenic
1044761063 8:95518159-95518181 CACAGCAAGCAGCATGGGGCTGG - Intergenic
1045092427 8:98760096-98760118 CAGAACAAGCAGGATACAGAGGG + Intronic
1046935765 8:119883921-119883943 CAGAGCAGGCAGGATTCAGAAGG + Intronic
1051102225 9:13534825-13534847 CACAGAATGCAGAATACGGAAGG - Intergenic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1053750661 9:41251267-41251289 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1054256172 9:62815610-62815632 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1054335132 9:63800004-63800026 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1055426635 9:76203482-76203504 CAAAACAAGCAGAAGGCAGAAGG + Intronic
1057374794 9:94510773-94510795 CGGAGCAAACAGAAAGCAGATGG + Intergenic
1203371400 Un_KI270442v1:308973-308995 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1186584761 X:10861064-10861086 CAGAGGCAGCAGTATGAGGATGG - Intergenic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1195235556 X:102894017-102894039 CAGAGTAAGAGGAATGCTGAGGG + Intergenic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1196297424 X:114015138-114015160 AACAGCAAGCAGACTGCGGCGGG + Intergenic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1198036084 X:132802844-132802866 GAGATCAAGCAGAAGGGGGAAGG + Intronic
1198301491 X:135338062-135338084 CAGAGCTCGCAGGATGGGGAGGG + Intronic
1200251179 X:154554794-154554816 CAGAGCAAGCGGGATTCTGATGG + Intronic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1200743870 Y:6885102-6885124 CAGAGAAAGGAGAATGCTTACGG + Intergenic
1201066944 Y:10106110-10106132 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1201595196 Y:15660488-15660510 CAAAGCAAGAAGAAGGGGGAAGG - Intergenic